Phenotypic Mutation 'nidoking' (pdf version)
Allelenidoking
Mutation Type missense
Chromosome15
Coordinate94,403,445 bp (GRCm38)
Base Change C ⇒ T (forward strand)
Gene Adamts20
Gene Name a disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 20
Synonym(s) ADAMTS-20, bt
Chromosomal Location 94,270,163-94,465,418 bp (-)
MGI Phenotype FUNCTION: This gene encodes a member of "a disintegrin and metalloproteinase with thrombospondin motifs" (ADAMTS) family of multi-domain matrix-associated metalloendopeptidases that have diverse roles in tissue morphogenesis and pathophysiological remodeling, in inflammation and in vascular biology. The encoded preproprotein undergoes proteolytic processing to generate an active protease. Certain mutations in this gene cause defective development of neural crest-derived melanoblasts resulting in a "belted" phenotype that is characterized by white spots in the lumbar region. [provided by RefSeq, Jul 2016]
PHENOTYPE: Mice homozygous for spontaneous or ENU-induced mutations exhibit abnormal coat/hair pigmentation, including a typical white belt phenotype. [provided by MGI curators]
Accession Number

NCBI RefSeq: NM_177431 (variant 1), NM_001164785 (variant 2), NM_001164786 (variant 3); MGI: 2260628

MappedYes 
Amino Acid Change Arginine changed to Histidine
Institutional SourceBeutler Lab
Gene Model predicted gene model for protein(s): [ENSMUSP00000036330] [ENSMUSP00000121696]
AlphaFold P59511
SMART Domains Protein: ENSMUSP00000036330
Gene: ENSMUSG00000022449
AA Change: R66H

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:Pep_M12B_propep 41 186 1.4e-30 PFAM
Pfam:Reprolysin_5 253 445 3.6e-13 PFAM
Pfam:Reprolysin_4 253 460 1.1e-7 PFAM
Pfam:Reprolysin 255 464 1.5e-26 PFAM
Pfam:Reprolysin_2 272 454 1.8e-10 PFAM
Pfam:Reprolysin_3 276 410 5.8e-10 PFAM
TSP1 556 608 7.73e-11 SMART
Pfam:ADAM_spacer1 718 836 2.6e-34 PFAM
TSP1 846 901 1.47e-1 SMART
TSP1 904 958 2.83e0 SMART
TSP1 965 1019 4.28e-4 SMART
TSP1 1020 1074 1.89e-5 SMART
TSP1 1075 1131 4.87e-8 SMART
TSP1 1152 1201 6.05e-4 SMART
TSP1 1204 1260 1.22e-8 SMART
TSP1 1304 1356 1.37e-2 SMART
TSP1 1357 1411 6e-8 SMART
TSP1 1416 1470 1.69e-2 SMART
TSP1 1471 1526 2.3e0 SMART
TSP1 1530 1579 1.23e0 SMART
TSP1 1653 1706 5.27e-4 SMART
Pfam:GON 1708 1905 5.8e-80 PFAM
Predicted Effect probably damaging

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
(Using ENSMUST00000035342)
SMART Domains Protein: ENSMUSP00000121696
Gene: ENSMUSG00000022449
AA Change: R66H

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:Pep_M12B_propep 40 186 1e-31 PFAM
Pfam:Reprolysin_5 253 445 2.7e-13 PFAM
Pfam:Reprolysin_4 253 460 7.2e-8 PFAM
Pfam:Reprolysin 255 464 2.4e-28 PFAM
Pfam:Reprolysin_2 272 454 4e-10 PFAM
Pfam:Reprolysin_3 276 410 1.1e-10 PFAM
TSP1 556 608 7.73e-11 SMART
Pfam:ADAM_spacer1 718 836 2e-34 PFAM
TSP1 846 901 1.47e-1 SMART
TSP1 904 958 2.83e0 SMART
TSP1 965 1019 4.28e-4 SMART
TSP1 1020 1074 1.89e-5 SMART
TSP1 1075 1131 4.87e-8 SMART
TSP1 1152 1201 6.05e-4 SMART
TSP1 1204 1260 1.22e-8 SMART
TSP1 1304 1356 1.37e-2 SMART
TSP1 1357 1411 6e-8 SMART
Predicted Effect probably damaging

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
(Using ENSMUST00000155907)
Meta Mutation Damage Score 0.8215 question?
Is this an essential gene? Probably nonessential (E-score: 0.110) question?
Phenotypic Category
Phenotype question? Literature verified References
pigmentation 14138974
skin/coat/nails 14138974
Candidate Explorer Status CE: excellent candidate; Verification probability: 0.535; ML prob: 0.512; human score: 0
Single pedigree
Linkage Analysis Data
Penetrance  
Alleles Listed at MGI

All Mutations and Alleles(23) : Chemically induced (ENU)(8) Radiation induced(2) Spontaneous(12) Targeted(1)

Lab Alleles
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00433:Adamts20 APN 15 94394641 missense probably benign
IGL00491:Adamts20 APN 15 94273232 missense possibly damaging 0.89
IGL00502:Adamts20 APN 15 94403397 missense probably damaging 0.99
IGL00672:Adamts20 APN 15 94341105 missense probably damaging 0.99
IGL00840:Adamts20 APN 15 94282482 missense probably damaging 1.00
IGL00909:Adamts20 APN 15 94379813 missense probably damaging 1.00
IGL01101:Adamts20 APN 15 94344042 missense probably damaging 1.00
IGL01137:Adamts20 APN 15 94394611 critical splice donor site probably null
IGL01457:Adamts20 APN 15 94331448 missense probably damaging 0.97
IGL01685:Adamts20 APN 15 94403446 missense possibly damaging 0.81
IGL01949:Adamts20 APN 15 94326106 missense probably benign 0.08
IGL02525:Adamts20 APN 15 94283078 splice site probably null
IGL03088:Adamts20 APN 15 94329914 critical splice donor site probably null
IGL03175:Adamts20 APN 15 94273255 nonsense probably null
belt UTSW 15 94345990 missense probably damaging 1.00
buckeye UTSW 15 94341087 missense probably damaging 1.00
jack_white UTSW 15 unclassified
meowth UTSW 15 94331458 missense probably damaging 1.00
panda UTSW 15 94326699 intron probably benign
pikachu UTSW 15 94345990 missense probably damaging 1.00
poliwag UTSW 15 94394622 nonsense probably null
splotch2 UTSW 15 94335561 intron probably benign
wash UTSW 15 94347670 nonsense probably null
whitebelly UTSW 15 unclassified
whopper UTSW 15 94347810 missense probably damaging 1.00
R0483:Adamts20 UTSW 15 94353571 missense probably benign 0.00
R0514:Adamts20 UTSW 15 94270376 missense probably damaging 1.00
R0568:Adamts20 UTSW 15 94291713 splice site probably benign
R0730:Adamts20 UTSW 15 94347690 missense probably benign 0.00
R0973:Adamts20 UTSW 15 94286371 missense probably benign 0.00
R1339:Adamts20 UTSW 15 94322896 missense probably benign 0.19
R1721:Adamts20 UTSW 15 94338459 missense probably benign 0.44
R1809:Adamts20 UTSW 15 94341087 missense probably damaging 1.00
R1832:Adamts20 UTSW 15 94286344 missense probably benign 0.00
R1846:Adamts20 UTSW 15 94345990 missense probably damaging 1.00
R1867:Adamts20 UTSW 15 94338459 missense probably benign 0.44
R1875:Adamts20 UTSW 15 94331396 missense probably benign 0.01
R1930:Adamts20 UTSW 15 94404010 missense probably benign 0.03
R1931:Adamts20 UTSW 15 94404010 missense probably benign 0.03
R1932:Adamts20 UTSW 15 94404010 missense probably benign 0.03
R2001:Adamts20 UTSW 15 94347718 missense possibly damaging 0.96
R2116:Adamts20 UTSW 15 94355362 missense probably damaging 1.00
R2162:Adamts20 UTSW 15 94331458 missense probably damaging 1.00
R2350:Adamts20 UTSW 15 94283916 missense probably damaging 1.00
R2887:Adamts20 UTSW 15 94330578 missense probably benign 0.00
R2889:Adamts20 UTSW 15 94330578 missense probably benign 0.00
R2890:Adamts20 UTSW 15 94330578 missense probably benign 0.00
R3109:Adamts20 UTSW 15 94345904 splice site probably benign
R3719:Adamts20 UTSW 15 94361838 missense probably damaging 0.99
R3832:Adamts20 UTSW 15 94331458 missense probably damaging 1.00
R3901:Adamts20 UTSW 15 94328845 missense possibly damaging 0.81
R4398:Adamts20 UTSW 15 94333695 missense possibly damaging 0.93
R4402:Adamts20 UTSW 15 94379946 missense probably benign
R4431:Adamts20 UTSW 15 94344043 missense probably damaging 1.00
R4479:Adamts20 UTSW 15 94403445 missense probably damaging 1.00
R4482:Adamts20 UTSW 15 94345920 missense probably damaging 1.00
R4503:Adamts20 UTSW 15 94379750 missense probably damaging 0.99
R4671:Adamts20 UTSW 15 94403325 missense possibly damaging 0.48
R4700:Adamts20 UTSW 15 94394622 nonsense probably null
R4707:Adamts20 UTSW 15 94333647 missense possibly damaging 0.53
R4725:Adamts20 UTSW 15 94351762 missense probably damaging 0.99
R4771:Adamts20 UTSW 15 94351635 splice site probably null
R4829:Adamts20 UTSW 15 94326396 missense probably benign 0.01
R4937:Adamts20 UTSW 15 94379775 missense probably benign
R4960:Adamts20 UTSW 15 94379774 missense probably benign
R5270:Adamts20 UTSW 15 94282519 missense probably benign 0.00
R5388:Adamts20 UTSW 15 94345778 missense possibly damaging 0.81
R5410:Adamts20 UTSW 15 94281957 missense possibly damaging 0.94
R5453:Adamts20 UTSW 15 94326088 missense possibly damaging 0.69
R5611:Adamts20 UTSW 15 94273280 missense possibly damaging 0.65
R5687:Adamts20 UTSW 15 94325971 missense probably benign 0.36
R5758:Adamts20 UTSW 15 94394650 missense probably benign 0.00
R5801:Adamts20 UTSW 15 94347670 nonsense probably null
R5834:Adamts20 UTSW 15 94353584 missense probably damaging 0.99
R5993:Adamts20 UTSW 15 94338723 missense probably damaging 0.99
R5997:Adamts20 UTSW 15 94379747 missense probably damaging 1.00
R6044:Adamts20 UTSW 15 94282483 missense probably damaging 1.00
R6058:Adamts20 UTSW 15 94330047 nonsense probably null
R6217:Adamts20 UTSW 15 94338715 missense probably benign 0.00
R6283:Adamts20 UTSW 15 94351721 missense probably benign
R6354:Adamts20 UTSW 15 94347810 missense probably damaging 1.00
R6415:Adamts20 UTSW 15 94324659 critical splice donor site probably null
R6419:Adamts20 UTSW 15 94333675 missense possibly damaging 0.84
R6476:Adamts20 UTSW 15 94361810 missense probably benign 0.22
R6485:Adamts20 UTSW 15 94343971 missense probably benign 0.17
R6517:Adamts20 UTSW 15 94283104 splice site probably null
R6675:Adamts20 UTSW 15 94331316 critical splice donor site probably null
R6863:Adamts20 UTSW 15 94379746 nonsense probably null
R7186:Adamts20 UTSW 15 94322808 missense possibly damaging 0.76
R7263:Adamts20 UTSW 15 94322891 missense possibly damaging 0.52
R7441:Adamts20 UTSW 15 94353673 missense probably damaging 1.00
R7519:Adamts20 UTSW 15 94325988 missense possibly damaging 0.64
R7747:Adamts20 UTSW 15 94291587 nonsense probably null
R7770:Adamts20 UTSW 15 94333698 missense probably benign 0.02
R7816:Adamts20 UTSW 15 94322844 missense probably benign 0.00
R7827:Adamts20 UTSW 15 94325933 missense probably damaging 1.00
R7853:Adamts20 UTSW 15 94345990 missense probably damaging 1.00
R7894:Adamts20 UTSW 15 94351760 missense probably damaging 1.00
R7951:Adamts20 UTSW 15 94341066 missense probably damaging 1.00
R8233:Adamts20 UTSW 15 94291652 missense probably benign 0.19
R8458:Adamts20 UTSW 15 94353640 missense probably benign 0.02
R8709:Adamts20 UTSW 15 94341066 missense probably damaging 1.00
R8719:Adamts20 UTSW 15 94344022 missense probably damaging 0.99
R8728:Adamts20 UTSW 15 94331400 missense probably benign 0.00
R8787:Adamts20 UTSW 15 94286413 missense possibly damaging 0.83
R8801:Adamts20 UTSW 15 94360609 missense probably damaging 1.00
R9055:Adamts20 UTSW 15 94283986 missense probably damaging 0.98
R9069:Adamts20 UTSW 15 94338468 missense probably benign 0.00
Mode of Inheritance Autosomal Recessive
Local Stock
Repository
Last Updated 2021-10-21 7:13 AM by Diantha La Vine
Record Created 2015-12-31 7:42 AM by Carlos Reyna
Record Posted 2016-08-22
Phenotypic Description
Figure 1. The nidoking mice (top) exhibit variable belting.

The nidoking phenotype was identified among N-ethyl-N-nitrosourea (ENU)-induced G3 mice of the pedigree R4479, some of which exhibited a variable belted phenotype (Figure 1).

Nature of Mutation

Figure 2. Linkage mapping of the pigmentation phenotype using a recessive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 34 mutations (X-axis) identified in the G1 male of pedigree R4479. Binary phenotype data are shown for single locus linkage analysis without consideration of G2 dam identity. Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 34 mutations.The pigmentation phenotype was linked to a mutation in Adamts20: a G to A transition at base pair 94,403,445 (v38) on chromosome 15, or base pair 61,983 in the GenBank genomic region NC_000081. Linkage was found with a recessive model of inheritance (P = 4.413 x 10-12), wherein 10 affected mice were homozygous for the variant allele, and 55 unaffected mice were either heterozygous (N = 38) or homozygous for the reference allele (N = 17) (Figure 2).
 
The mutation corresponds to residue 458 in the mRNA sequence NM_177431 (isoform 1) within exon 2 of 39 total exons and residue 458 in the mRNA sequence NM_00164785 (isoform 2) within exon 2 of 28 total exons. 
 

61967 TTCAGCCGGAAGAAACGTAGCTCCGGGGTGCCG

61    -F--S--R--K--K--R--S--S--G--V--P-

 

Genomic numbering corresponds to NC_000081. The mutated nucleotide is indicated in red. The mutation results in an arginine (R) to histidine (H) substitution at position 66 (R66H) in both ADAMTS-20 protein variants.

Illustration of Mutations in
Gene & Protein
Putative Mechanism

The ADAMTS proteins are predicted to interact with the extracellular matrix (ECM) and play a wide role in normal and pathological processes (1;3). White-spotting mutants are often the result of improper melanoblast development or survival. The lack of pigment in the adult reflects the absence of mature melanocytes in that area due to defects at various stages of melanocyte development including proliferation, survival, migration, invasion of the integument, hair follicle entry, and melanocyte stem cell renewal (6;7). Adamts20 is the gene mutated in belted and splotch2 mutant mice. Belted animals exhibit a mostly pigmented coat except for a region near the hindlimbs that resembles a belt (8). At least fifteen different belted alleles are in existence and four of these, including splotch2, have been sequenced. Two of the three previously described mutations result in single amino acid changes either in the Cys-rich domain or one of the C-terminal TSP1 repeats. The third mutation generates a premature stop codon, resulting in truncation of the protein and loss of eight C-terminal TSP1 domains. Deficient ADAMTS-20 activity may cause loss of melanoblast entry into the hair follicles (3). ADAMTS-20 may degrade specific peptide substrates, either ECM components or signaling molecules, and this degradation could be necessary for melanoblast migration to the proper areas. Examination of ADAMTS-20 function during melanoblast development determined that mice with mutations in Adamts20 had a normal distribution of melanoblasts during embryogenesis suggesting that melanoblast migration is normal in these animals. The phenotype of the nidoking mice resembles those of other Adamts20 alleles indicating that the mutation results in impaired ADAMTS-20 function.

Primers PCR Primer
nidoking_pcr_F: TAGAAACAGTGGCGCAGGTC
nidoking_pcr_R: TGAGACTGACCAAAACTGGG

Sequencing Primer
nidoking_seq_F: AGGTCTGGGGACTCCGTG
nidoking_seq_R: GGTAGGGATGCTTGGCTCAAGAG
Genotyping

PCR program

1) 94°C 2:00
2) 94°C 0:30
3) 55°C 0:30
4) 72°C 1:00
5) repeat steps (2-4) 40x
6) 72°C 10:00
7) 4°C hold

 

The following sequence of 404 nucleotides is amplified (chromosome 15, - strand):

 

 

1   tgagactgac caaaactggg gaccttgggt agggatgctt ggctcaagag cttgtgggtt
61  ggacagcgtc ggggcttcat agacatttcg ctgtgtgttg cagaagccct ggtgaagact
121 ctggcctcct acgaagtggt gacccccacg cgggtcaatg agttcggaga cgtgtttccc
181 cagaaccggc atttcagccg gaagaaacgt agctccgggg tgccggagcc tcctccgttc
241 aggacccact accgaatcag cgcctacggg cagctcttcc agctgaacct gagcgctgat
301 gcggccttcc tggctgcagg ctacactgag gtgcacttgg ggaccccggt acctggacca
361 ggcgggcgca gcacggagtc cccagacctg cgccactgtt tcta

 

 

Primer binding sites are underlined and the sequencing primers are highlighted; the mutated nucleotide is shown in red.

References

1. Tang, B. L. (2001) ADAMTS: A Novel Family of Extracellular Matrix Proteases. Int J Biochem Cell Biol. 33, 33-44.

  8. Murray, J. M., and Snell, G. D. (1945) Belted, A New 6Th Chromosome Mutation in the Mouse. J Hered. 36, 266-268.
Science Writers Anne Murray
Illustrators Peter Jurek
AuthorsCarlos Reyna, Jamie Russell, and Bruce Beutler