Phenotypic Mutation 'uhr' (pdf version)
List |< first << previous [record 98 of 132] next >> last >|
Alleleuhr
Mutation Type nonsense
Chromosome5
Coordinate76,229,554 bp (GRCm38)
Base Change G ⇒ A (forward strand)
Gene Clock
Gene Name circadian locomotor output cycles kaput
Synonym(s) 5330400M04Rik, bHLHe8, KAT13D
Chromosomal Location 76,209,868-76,304,792 bp (-)
MGI Phenotype FUNCTION: The protein encoded by this gene plays a central role in the regulation of circadian rhythms. The protein encodes a transcription factor of the basic helix-loop-helix (bHLH) family and contains DNA binding histone acetyltransferase activity. The encoded protein forms a heterodimer with Arntl (Bmal1) that binds E-box enhancer elements upstream of Period (Per1, Per2, Per3) and Cryptochrome (Cry1, Cry2) genes and activates transcription of these genes. Per and Cry proteins heterodimerize and repress their own transcription by interacting in a feedback loop with Clock/Arntl complexes. Polymorphisms in this gene may be associated with behavioral changes, obesity, and metabolic syndrome. Two transcripts encoding the same protein have been found for this gene. [provided by RefSeq, Jan 2014]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit abnormal circadian phase. Mice homozygous for a spontaneous mutation exhibit abnormal circadian rhythm, reproduction, behavior, hair cycle, macronutrient absorption, and metabolism. [provided by MGI curators]
Accession Number

NM_007715 (variant 1), NM_001289826 (variant 2), NM_001305222 (variant 3); MGI:99698

Mapped Yes 
Amino Acid Change Glutamine changed to Stop codon
Institutional SourceBeutler Lab
Gene Model predicted gene model for protein(s): [ENSMUSP00000074656] [ENSMUSP00000144022] [ENSMUSP00000143939]
PDB Structure
Crystal Structure of the Heterodimeric CLOCK:BMAL1 Transcriptional Activator Complex [X-RAY DIFFRACTION]
SMART Domains Protein: ENSMUSP00000074656
Gene: ENSMUSG00000029238
AA Change: Q633*

DomainStartEndE-ValueType
HLH 40 90 7.77e-12 SMART
PAS 109 175 1.88e-6 SMART
PAS 264 330 3.65e-4 SMART
PAC 336 379 7.63e-7 SMART
low complexity region 426 446 N/A INTRINSIC
low complexity region 478 493 N/A INTRINSIC
coiled coil region 523 559 N/A INTRINSIC
low complexity region 619 634 N/A INTRINSIC
low complexity region 640 657 N/A INTRINSIC
low complexity region 738 796 N/A INTRINSIC
low complexity region 818 837 N/A INTRINSIC
Predicted Effect probably null
SMART Domains Protein: ENSMUSP00000144022
Gene: ENSMUSG00000029238
AA Change: Q632*

DomainStartEndE-ValueType
TFS2N 34 106 4.1e-3 SMART
HLH 40 90 3.4e-14 SMART
PAS 109 175 9.6e-9 SMART
PAS 264 330 1.8e-6 SMART
PAC 336 379 3.9e-9 SMART
low complexity region 426 446 N/A INTRINSIC
low complexity region 478 493 N/A INTRINSIC
coiled coil region 523 559 N/A INTRINSIC
low complexity region 619 633 N/A INTRINSIC
low complexity region 639 656 N/A INTRINSIC
low complexity region 737 795 N/A INTRINSIC
low complexity region 817 836 N/A INTRINSIC
Predicted Effect probably null
SMART Domains Protein: ENSMUSP00000143939
Gene: ENSMUSG00000029238
AA Change: Q633*

DomainStartEndE-ValueType
HLH 40 90 7.77e-12 SMART
PAS 109 175 1.88e-6 SMART
PAS 264 330 3.65e-4 SMART
PAC 336 379 7.63e-7 SMART
low complexity region 426 446 N/A INTRINSIC
low complexity region 478 493 N/A INTRINSIC
coiled coil region 523 559 N/A INTRINSIC
low complexity region 619 634 N/A INTRINSIC
low complexity region 640 657 N/A INTRINSIC
low complexity region 738 796 N/A INTRINSIC
low complexity region 818 837 N/A INTRINSIC
Predicted Effect probably null
Phenotypic Category
Phenotypequestion? Literature verified References
Body Weight - increased 15845877
Body Weight (DSS Male) - increased 15845877
Body Weight (DSS) - increased 15845877
Penetrance  
Alleles Listed at MGI

All Mutations and Alleles(62) : Chemically induced (ENU)(1) Chemically induced (other)(2) Gene trapped(51) Spontaneous(1) Targeted(4) Transgenic(3)

Lab Alleles
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00598:Clock APN 5 76229464 missense probably benign 0.17
IGL00725:Clock APN 5 76254413 nonsense probably null
IGL01304:Clock APN 5 76266355 critical splice donor site probably null
IGL01369:Clock APN 5 76237086 missense probably benign 0.30
IGL01542:Clock APN 5 76231475 missense possibly damaging 0.82
IGL02541:Clock APN 5 76262672 splice site probably null
IGL02602:Clock APN 5 76254426 missense probably null 1.00
IGL02602:Clock APN 5 76254427 missense probably damaging 1.00
IGL03186:Clock APN 5 76243082 missense probably damaging 0.98
IGL03309:Clock APN 5 76231394 critical splice donor site probably null
R0304:Clock UTSW 5 76226985 missense unknown
R0593:Clock UTSW 5 76265836 missense probably benign 0.25
R0654:Clock UTSW 5 76227129 missense possibly damaging 0.95
R0684:Clock UTSW 5 76245518 missense probably damaging 0.96
R0707:Clock UTSW 5 76227129 missense possibly damaging 0.95
R0751:Clock UTSW 5 76229361 missense possibly damaging 0.75
R0865:Clock UTSW 5 76266424 splice site probably benign
R0920:Clock UTSW 5 76230320 missense possibly damaging 0.80
R1396:Clock UTSW 5 76266802 missense probably benign 0.00
R1450:Clock UTSW 5 76262731 nonsense probably null
R1487:Clock UTSW 5 76266354 splice site probably null
R1574:Clock UTSW 5 76242832 missense probably damaging 1.00
R1574:Clock UTSW 5 76242832 missense probably damaging 1.00
R1858:Clock UTSW 5 76240909 missense possibly damaging 0.92
R1872:Clock UTSW 5 76248462 missense possibly damaging 0.67
R1905:Clock UTSW 5 76266888 splice site probably benign
R1937:Clock UTSW 5 76229493 missense probably damaging 0.99
R2411:Clock UTSW 5 76231513 missense probably benign 0.08
R2887:Clock UTSW 5 76245273 missense probably damaging 0.99
R3410:Clock UTSW 5 76229554 nonsense probably null
R4514:Clock UTSW 5 76230199 missense probably benign 0.00
R4598:Clock UTSW 5 76235810 missense probably benign 0.00
R4599:Clock UTSW 5 76235810 missense probably benign 0.00
R4795:Clock UTSW 5 76265916 missense probably damaging 1.00
R4796:Clock UTSW 5 76265916 missense probably damaging 1.00
R4973:Clock UTSW 5 76254411 missense possibly damaging 0.62
R5204:Clock UTSW 5 76243170 splice site probably null
R5271:Clock UTSW 5 76241954 missense probably damaging 1.00
R5547:Clock UTSW 5 76230338 missense probably benign 0.02
R5630:Clock UTSW 5 76230338 missense probably benign 0.02
R5631:Clock UTSW 5 76230338 missense probably benign 0.02
R5632:Clock UTSW 5 76230338 missense probably benign 0.02
R5787:Clock UTSW 5 76237051 missense probably damaging 1.00
R6274:Clock UTSW 5 76237153 missense probably benign 0.45
R6578:Clock UTSW 5 76216709 missense unknown
R6622:Clock UTSW 5 76241954 missense probably damaging 1.00
R6760:Clock UTSW 5 76226976 missense unknown
R6793:Clock UTSW 5 76237120 frame shift probably null
Mode of Inheritance Autosomal Recessive
Local Stock
Repository
Last Updated 2017-05-10 1:32 PM by Katherine Timer
Record Created 2016-01-13 11:36 AM
Record Posted 2017-02-14
Phenotypic Description

Figure 1. Uhr mice display increased body weight. Scaled weight data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The uhr phenotype was identified among G3 mice of the pedigree R3410, some of which showed increased body weights compared to wild-type controls (Figure 1).

Nature of Mutation
Figure 2. Linkage mapping of body weight using a recessive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 61 mutations (X-axis) identified in the G1 male of pedigree R3410. Scaled body weight data were used for single locus linkage analysis without consideration of G2 dam identity.  Horizontal pink and red lines represent, respectively, thresholds of P = 0.05, and P = 0.05 after applying Bonferroni correction.

Whole exome HiSeq sequencing of the G1 grandsire identified 61 mutations. The body weight phenotype was linked to a mutation in Clock: a C to T transition at base pair 76,229,554 (v38) on chromosome 5, or base pair 75,447 in the GenBank genomic region NC_000071 encoding Clock. Linkage was found with a recessive model of inheritance, wherein five variant homozygotes differed phenotypically from 19 heterozygous and 13 homozygous reference mice (P = 6.964 x 10-5; Figure 2).

 

The mutation corresponds to residue 2,285 in the NM_007715 mRNA sequence in exon 21 of 23 total exons, residue 2,242 in the NM_001289826 mRNA sequence in exon 21 of 23 total exons, and residue 2,101 in the NM_001305222 mRNA sequence in exon 21 of 23 total exons. 

 

75436 ACTCAGCAGAGTCAACAGAGTGTAATGAGTGGA

628   -T--Q--Q--S--Q--Q--S--V--M--S--G-

 

Genomic numbering corresponds to NC_000071. The mutated nucleotide is indicated in red.  The mutation results in substitution of glutamine 633 to a premature stop codon (Q633*) in the CLOCK protein.

Protein Prediction
Figure 3. Domain organization of mouse CLOCK. bHLH, basic helix-loop-helix domain; PAS, Per-Arnt-Sim domain. The uhr mutation is indicated in red.

The CLOCK transcription factor is one of 19 proteins of the bHLH-PAS family, which contain a DNA-binding basic helix-loop-helix domain (bHLH) and two Per-Arnt-Sim (PAS) domain repeats (PAS-A and PAS-B) (Figure 3).  These proteins form dimers that bind to E-box sequences in target genes to regulate transcription.  The CLOCK protein dimerizes with the bHLH-PAS protein BMAL1 (also called Arntl, aryl hydrocarbon receptor nuclear translocator-like) to regulate transcription of the Per and Cry genes, as well as other genes that control circadian rhythm in mammals. 

 

Figure 4. Crystal structure of a complex of the bHLH domains of CLOCK and BMAL1 bound to E-box DNA (PDB 4H10). See description in text.

Together, the bHLH and PAS domains mediate dimerization of bHLH-PAS proteins.  The bHLH domain consists of an HLH dimerization domain and 4-6 basic amino acids that bind to E-box motifs in DNA.  Although these motifs are defined as 6-bp DNA elements with a consensus sequence of CANNTG (typically CG or GC at degenerate positions) (1-3), the CLOCK-BMAL1 bHLH domains have been shown to bind many E-box like and non-canonical E-box elements including CACGTT, CCAATG, CATTGG, CATGTG, and AACGTG, in addition to the consensus sequence CACGTG (4-7).  The crystal structure of a complex containing CLOCK-BMAL1 bHLH domains bound to canonical E-box DNA showed the basic helical regions of CLOCK and BMAL1 inserting into the major groove of the DNA, similar to other bHLH protein-DNA structures (Figure 4) (8).  The CLOCK-BMAL1 heterodimer interacted with all six nucleotides of the E-box.  In addition, BMAL1 formed a hydrophobic contact with a thymine nucleotide flanking the consensus E-box sequence; this interaction permitted specific binding to non-canonical E-boxes.  Heterodimerization of the two bHLH domains was shown to depend on CLOCK His84 and BMAL1 Leu125, which preclude homodimer formation due to side chain clash (8).

 

The PAS domain is approximately 100-120 amino acids in length.  Sequence analysis of 34 mouse PAS domain-containing proteins suggests that PAS-A and PAS-B domains have distinct consensus sequences (PAS-A: LxALDGFxxV VxxxxGxxxY xSExVxxxLG xxQxxLxxxG xSxxxxxHPx DxxExxxxL; PAS-B: IxxxxxxFx xRHxxDxxFx xxDxRxxxxx GYxPxxLxGx xxYxxxHxxD xxxxxxxH) (9).  However, they exhibit a similar three dimensional fold in a variety of proteins, with four to five α-helices surrounding a sheet of five antiparallel β-strands (10;11).  The PAS-A domain is important for preventing dimerization with non-PAS containing bHLH proteins, and for mediating binding to non-canonical E-box sequences (12).  It has been proposed that the PAS-B domain is important as a sensor of environmental signals through binding to proteins that transduce sensory information (9;13).  The PAS domains of CLOCK have been implicated in binding to PER and CRY1, components of the negative arm of the feedback loop regulating circadian rhythm (14;15)

Figure 5. Crystal structure of the bHLH-PAS domains from the mouse CLOCK-BMAL1 heterodimer (PDB 4F3L). The PAS-A, PAS-B, and bHLH domains of CLOCK are shown in blue, purple, and green, respectively. BMAL1 is colored gray with domains labeled. See description in text.

 

The crystal structure of a complex containing the bHLH-PAS domains of mouse CLOCK:BMAL1 shows a tightly intertwined heterodimer with three distinct contact interfaces mediated by homotypic domain interactions (Figure 5) (11).  The overall conformation of the complex is asymmetric, as is the distribution of electrostatic potential over the two protein subunits.  In particular, BMAL1 has an overall positive electrostatic potential while CLOCK has an overall negative electrostatic potential.  The dimer interface between the PAS-A domains of CLOCK and BMAL1 appears similar to those of other complexes (16) and contains multiple residues that are conserved among other bHLH-PAS proteins, suggesting a common mode of dimerization via this domain.  In contrast, the dimer interface between the CLOCK and BMAL1 PAS-B domains is more unusual, with the β sheet of BMAL1 PAS-B making contacts with the helical face of CLOCK PAS-B in a parallel stack of the domains.

 

PAS domains are covalently linked to and regulate the activities of a wide range of effector domains (10).  The C-terminal half of CLOCK is rich in glutamine residues, a characteristic of transactivation domains of transcription factors (17).  However, experiments measuring reporter activation in vitro by heterodimers of truncated CLOCK and wild type BMAL1, or by CLOCK fused to a GAL4 DNA-binding domain, suggest that no transactivation domain is present in the CLOCK C-terminus (18).  Rather, CLOCK may play a regulatory or structural role to promote the transactivation activity of BMAL1 in the CLOCK-BMAL1 heterodimer (18;19).  The uhr mutation occurs within the glutamine-rich region of CLOCK.

Expression/Localization

Gene and protein expression of CLOCK is ubiquitous (20;21).  CLOCK localization cycles between the nucleus and cytoplasm (68).

Background

Figure 6. Model of mammalian circadian clock. CLOCK-BMAL1 heterodimers bind to E-box DNA to drive the expression of PER and CRY genes in the core feedback loop of the clock.  CLOCK-BMAL1 also drives transcription of Rev-Erbα and RORα/β, which act as negative and positive transcriptional regulators, respectively, of a second feedback loop that controls rhythmic expression of BMAL1. The nuclear translocation and proteasome-mediated degradation of PER proteins are regulated by CK1δ/ε and PP1/5. CRY protein degradation is mediated by the SKP1-CUL1-FBXL3 E3 ubiquitin ligase complex in the nucleus, and by the SKP1-CUL1-FBXL21 E3 ubiquitin ligase complex in the cytoplasm.

Circadian rhythms are intrinsic daily cycles of behavioral and physiological changes driven by an endogenous “clock” or “oscillator” [reviewed in (22-24)].  Changes in sleep/wakefulness, locomotion, feeding, and temperature are all overt signs of the body’s circadian rhythm.  These rhythms, which follow a 24-hour cycle or period, are both self-sustained, occurring even in the absence of external inputs, and entrained (synchronized) by environmental cues such as the light-dark cycle.  In mammals, the master circadian clock is located in the hypothalamic suprachiasmatic nucleus (SCN) (25), where a network of interconnected and therefore synchronized neurons receives photic input from the retina and provides circadian timing information to the rest of the body (26).  This information is conveyed by direct neuronal projections to other brain and peripheral regions, as well as by diffusible factors (27;28) and systemic cues (e.g. body temperature) from the SCN (29-31).  Peripheral organs can sustain circadian rhythms in the absence of SCN input, and do so with tissue-specific differences in period and phase (21).  However, peripheral tissues rely on the master clock for long term synchronization to an internally coherent timing system (21;32-34).

 

At the molecular level, the circadian clock consists of several interacting positive and negative transcriptional feedback loops that drive recurrent cycling of RNA and protein levels of clock components (Figure 6) (23;35;36).  The core feedback loop consists of BMAL1 and CLOCK, components of the positive arm of the loop, and three Period (PER) and two Cryptochrome (CRY) proteins, components of the negative arm of the loop.  CLOCK-BMAL1 heterodimers activate the transcription of Per (see kortiku), Cry, and Rev-Erbα genes through interaction with E-box enhancers (37;38).  After heterodimerization in the cytoplasm, PER-CRY complexes translocate into the nucleus where they directly interact with CLOCK-BMAL1 and inhibit transcription (19;39-42).  Ubiquitin-mediated degradation of PER and CRY proteins gradually relieves their repression of CLOCK-BMAL1, and the cycle begins again (43-47).  The 24-hour period of the cycle is modulated by casein kinase 1δ (CK1δ) and CK1ε, serine kinases that phosphorylate PER proteins and thereby control their translocation into the nucleus (48;49) or their degradation (46).  CK1δ/ε deficiency results in the constitutive cytoplasmic localization of PER proteins (48).  The activities of CK1δ and CK1ε are regulated by phosphatases PP1 and PP5 (48;49).

 

Rhythmic changes in Bmal1 transcription are controlled by another transcriptional feedback loop involving the retinoic acid receptor (RAR)-related orphan receptors (RORα, RORβ, RORγ; see 4-limb clasper and chestnut) and Rev-Erbα/Rev-Erbβ (Figure 6).  RORα and RORβ have been shown to interact with several ROR response elements (RORE) in the promoter of Bmal1, cyclically competing with the transcriptional repressors Rev-Erbα and Rev-Erbβ for binding (38;50-52).  ROREs are also found in intron 1 of Cry1; these, together with E-box elements found in the Cry1 promoter, generate an essential delay in Cry1 expression relative to genes regulated strictly by CLOCK-BMAL1 (53;54).  Although rhythmicity of BMAL1 expression is not necessary for proper timing of the core feedback loop (55), the delay in feedback repression by CRY1 is required for mammalian circadian clock function (53).

 

The role of CLOCK in regulating circadian rhythm was first discovered through study of an ENU-induced mutant mouse strain harboring a dominant mutation of Clock (17;56;57).  A point mutation within intron 18 of Clock resulted in aberrant splicing that excluded exon 19 from the mRNA.  ClockΔ19/+ and ClockΔ19/Δ19 mice exhibited excessively long circadian periods, exaggerated resetting responses to light, and reduced amplitude of Per gene expression (peak mRNA level) (56;58).  The mutant CLOCK protein in these animals was found to compete with wild type CLOCK for binding to BMAL1 (17) and sequester BMAL1 in a complex capable of binding to E-box DNA but incompetent in transactivation activity (37).

 

With the exception of Bmal1 deficiency (59), single gene knockout of core clock components did not abolish circadian rhythms of behavior, which are supported by the genetic redundancy of clock components (55;60) and by the intercellular coupling of SCN neurons (26).  Mice with a null mutation of CLOCK displayed robust circadian rhythms in locomotor activity, although they had a slightly shortened circadian period in constant darkness and altered behavioral responses (locomotor activity) to light (61).  In addition, rhythmic gene expression of Per1, Per2, Rev-erbα, and Bmal1 in the SCN of CLOCK-deficient mice was maintained, despite a reduction in the amplitude of expression.  Mice lacking both CLOCK and NPAS2, a paralog of CLOCK which can be coimmunoprecipitated with BMAL1 from whole brain extracts (61-63), exhibited arrhythmic locomotor behavior immediately upon placement in constant darkness, suggesting that it functions redundantly with CLOCK in forming transcriptionally active complexes with BMAL1 (60).  Although initially surprising, these findings are nevertheless consistent with the dominant negative effects of the ClockΔ19 mutation.

 

ClockΔ19/Δ19 mice exhibited multiple physiological defects as a result of alterations in circadian timing.  These include an attenuated diurnal feeding rhythm, hyperphagia, obesity, and metabolic syndrome, which were associated with altered expression of neuropeptides involved in appetite and energy regulation (64)ClockΔ19/Δ19 mice also showed abnormal circadian regulation of heart rate and systemic blood pressure (65), abnormal sleep homeostasis characterized by less time asleep and less non-REM sleep (66), and abnormally elevated exploratory and escape-seeking behavior in behavior tests (67).  These phenotypes may stem from tissue-specific rather than SCN-derived defects in circadian timing.

Putative Mechanism

Like ClockΔ19/Δ19 mice, homozygous urh mutants displayed increased body weights relative to heterozygous and wild type littermates.  Both the Δ19 and uhr mutations occur within the glutamine-rich region of CLOCK, specifically deleting aa 514-564 or creating a premature stop codon at aa position 633, respectively.  The similarities of phenotype and relative positions of the two mutations in the linear amino acid sequence of CLOCK suggests the possibility that their mechanistic effects are also alike.  The uhr mutation may leave the dimerization and DNA binding activities of CLOCKuhr intact while abrogating transactivation activity of the CLOCKuhr-BMAL1 heterodimer, resulting in a dominant negative effect similar to that of the Δ19 mutation; this hypothesis remains to be tested.  Circadian timing of feeding and other behaviors, gene expression of core clock components, and CLOCK protein function have not been tested in uhr mice.

Primers PCR Primer
uhr(F):5'- CGTAGTGACTGTAGCACTCTGG -3'
uhr(R):5'- CCAACAACGTTGTGTGTATTTTACC -3'

Sequencing Primer
uhr_seq(F):5'- ACTGTAGCACTCTGGGTACTG -3'
uhr_seq(R):5'- AAGTCTTAGTTTGCCTTCCATCAAG -3'
References
Science Writers Eva Marie Y. Moresco
Illustrators Katherine Timer
AuthorsEmre Turer, Bruce Beutler
List |< first << previous [record 98 of 132] next >> last >|