Phenotypic Mutation 'Lilliputian2' (pdf version)
List |< first << previous [record 88 of 132] next >> last >|
AlleleLilliputian2
Mutation Type nonsense
Chromosome1
Coordinate158,834,918 bp (GRCm38)
Base Change A ⇒ T (forward strand)
Gene Pappa2
Gene Name pappalysin 2
Synonym(s) pregnancy-associated plasma preproprotein-A2, placenta-specific 3, pregnancy-associated plasma protein-E, PAPP-A2, PLAC3, Pappe
Chromosomal Location 158,711,727-158,980,490 bp (-)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the pappalysin family of metzincin metalloproteinases. The encoded protein cleaves insulin-like growth factor-binding protein 5 and is thought to be a local regulator of insulin-like growth factor (IGF) bioavailability. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2010]
PHENOTYPE: Mice homozygous for a null mutation are viable and fertile but display postnatal growth retardation that is more pronounced in females compared to males. [provided by MGI curators]
Accession Number

NCBI RefSeq: NM_001085376; MGI:3051647

Mapped Yes 
Amino Acid Change Tyrosine changed to Stop codon
Institutional SourceBeutler Lab
Gene Model predicted gene model for protein(s): [ENSMUSP00000124022]
SMART Domains Protein: ENSMUSP00000124022
Gene: ENSMUSG00000073530
AA Change: Y1162*

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:Laminin_G_3 271 440 1.2e-25 PFAM
NL 572 614 2.81e-5 SMART
Pfam:Peptidase_M43 669 832 1.5e-12 PFAM
Blast:FN3 844 1103 1e-169 BLAST
low complexity region 1130 1139 N/A INTRINSIC
low complexity region 1361 1370 N/A INTRINSIC
CCP 1394 1457 4.97e0 SMART
CCP 1462 1519 4.81e-1 SMART
CCP 1523 1588 2.58e-4 SMART
CCP 1593 1644 1.13e0 SMART
NL 1720 1757 2.66e-6 SMART
Predicted Effect probably null
Phenotypic Category
Phenotypequestion? Literature verified References
Body Weight (Female) - decreased 23457539
FACS B1b cells - decreased
growth/size
Penetrance  
Alleles Listed at MGI

All Mutations and Alleles(6) : Chemically induced (other)(2) Targeted(4)

Lab Alleles
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01097:Pappa2 APN 1 158857148 missense probably damaging 1.00
IGL01394:Pappa2 APN 1 158765104 splice site probably benign
IGL01570:Pappa2 APN 1 158814540 nonsense probably null
IGL01618:Pappa2 APN 1 158857378 missense probably damaging 1.00
IGL01717:Pappa2 APN 1 158857132 critical splice donor site probably null
IGL01804:Pappa2 APN 1 158936519 missense probably benign
IGL01904:Pappa2 APN 1 158783941 missense probably damaging 0.99
IGL02116:Pappa2 APN 1 158845125 missense probably benign 0.01
IGL02174:Pappa2 APN 1 158761618 missense probably damaging 1.00
IGL02302:Pappa2 APN 1 158715001 missense probably benign 0.38
IGL02422:Pappa2 APN 1 158936933 missense probably damaging 1.00
IGL02572:Pappa2 APN 1 158851216 missense probably benign
IGL02659:Pappa2 APN 1 158936794 missense probably damaging 0.97
IGL02887:Pappa2 APN 1 158782259 missense probably damaging 1.00
IGL02981:Pappa2 APN 1 158851144 missense probably benign 0.00
IGL03128:Pappa2 APN 1 158936484 missense probably benign 0.16
IGL03142:Pappa2 APN 1 158854931 missense probably damaging 1.00
IGL03270:Pappa2 APN 1 158765067 missense possibly damaging 0.78
Lilliputian UTSW 1 158716990 missense probably damaging 1.00
lilliputian3 UTSW 1 158782403 splice site probably null
Pitzel UTSW 1 158956645 missense
R0106:Pappa2 UTSW 1 158714977 missense probably damaging 1.00
R0106:Pappa2 UTSW 1 158714977 missense probably damaging 1.00
R0172:Pappa2 UTSW 1 158854849 critical splice donor site probably null
R0194:Pappa2 UTSW 1 158765101 splice site probably benign
R0418:Pappa2 UTSW 1 158716990 missense probably damaging 1.00
R0421:Pappa2 UTSW 1 158848080 missense probably damaging 1.00
R0441:Pappa2 UTSW 1 158763058 unclassified probably benign
R0602:Pappa2 UTSW 1 158763055 unclassified probably benign
R0630:Pappa2 UTSW 1 158832773 missense probably benign
R0760:Pappa2 UTSW 1 158716961 critical splice donor site probably null
R1146:Pappa2 UTSW 1 158854982 missense probably damaging 1.00
R1146:Pappa2 UTSW 1 158854982 missense probably damaging 1.00
R1243:Pappa2 UTSW 1 158845100 missense probably damaging 1.00
R1413:Pappa2 UTSW 1 158936554 missense probably benign 0.00
R1502:Pappa2 UTSW 1 158957288 missense probably damaging 1.00
R1599:Pappa2 UTSW 1 158857172 missense probably damaging 1.00
R1689:Pappa2 UTSW 1 158957398 missense probably damaging 1.00
R1750:Pappa2 UTSW 1 158763150 nonsense probably null
R1772:Pappa2 UTSW 1 158814368 missense possibly damaging 0.92
R1832:Pappa2 UTSW 1 158857316 missense probably damaging 1.00
R1905:Pappa2 UTSW 1 158803503 splice site probably null
R1914:Pappa2 UTSW 1 158750563 missense probably damaging 0.97
R2013:Pappa2 UTSW 1 158834928 missense probably damaging 1.00
R2037:Pappa2 UTSW 1 158956644 nonsense probably null
R2118:Pappa2 UTSW 1 158857266 missense probably damaging 1.00
R2268:Pappa2 UTSW 1 158857271 missense probably damaging 1.00
R2269:Pappa2 UTSW 1 158857271 missense probably damaging 1.00
R2347:Pappa2 UTSW 1 158765043 missense probably damaging 1.00
R3024:Pappa2 UTSW 1 158936225 missense probably benign 0.00
R3706:Pappa2 UTSW 1 158834918 nonsense probably null
R3707:Pappa2 UTSW 1 158834918 nonsense probably null
R3708:Pappa2 UTSW 1 158834918 nonsense probably null
R4600:Pappa2 UTSW 1 158814445 missense probably damaging 1.00
R4737:Pappa2 UTSW 1 158957012 missense probably benign
R4738:Pappa2 UTSW 1 158957012 missense probably benign
R4739:Pappa2 UTSW 1 158957002 missense probably damaging 0.99
R4739:Pappa2 UTSW 1 158957012 missense probably benign
R4788:Pappa2 UTSW 1 158783917 missense possibly damaging 0.86
R4798:Pappa2 UTSW 1 158857379 missense probably damaging 0.99
R4952:Pappa2 UTSW 1 158857136 missense probably null 1.00
R5121:Pappa2 UTSW 1 158838627 missense probably benign 0.01
R5144:Pappa2 UTSW 1 158957133 missense probably benign 0.03
R5159:Pappa2 UTSW 1 158761619 missense probably damaging 1.00
R5278:Pappa2 UTSW 1 158782403 splice site probably null
R5428:Pappa2 UTSW 1 158814785 missense possibly damaging 0.53
R5452:Pappa2 UTSW 1 158838602 missense probably benign 0.00
R5477:Pappa2 UTSW 1 158956738 missense probably benign 0.00
R5504:Pappa2 UTSW 1 158848045 missense probably benign 0.00
R5852:Pappa2 UTSW 1 158717014 missense probably damaging 1.00
R6003:Pappa2 UTSW 1 158936250 missense probably benign 0.23
R6129:Pappa2 UTSW 1 158714997 nonsense probably null
R6137:Pappa2 UTSW 1 158871543 missense probably damaging 1.00
R6374:Pappa2 UTSW 1 158956645 missense probably damaging 1.00
R6472:Pappa2 UTSW 1 158834799 missense probably damaging 1.00
R6804:Pappa2 UTSW 1 158936868 missense probably benign 0.24
X0058:Pappa2 UTSW 1 158814397 missense probably null
X0061:Pappa2 UTSW 1 158936618 missense possibly damaging 0.87
Mode of Inheritance Autosomal Semidominant
Local Stock
Repository
Last Updated 2019-01-15 5:15 PM by Diantha La Vine
Record Created 2016-01-25 10:58 AM
Record Posted 2016-06-02
Phenotypic Description
Figure 1. Lilliputian2 mice exhibit reduced body weights compared to wild-type littermates. Scaled body weight data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The Lilliputian2 phenotype was identified among G3 mice of the pedigree R3707, some of which showed reduced body weights compared to wild-type littermates (Figure 1).

Nature of Mutation

Figure 2. Linkage mapping of the reduced body weight using an additive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 41 mutations (X-axis) identified in the G1 male of pedigree R3707. Scaled body weight phenotype data are shown for single locus linkage analysis without consideration of G2 dam identity.  Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 41 mutations. The body weight phenotype was linked to mutations in two genes on chromosome 1: Pappa2 and Pigc. The mutation in Pappa2 was presumed to be causative because the Lilliputian phenotype mimics that of other Pappa2 mouse models (see MGI). The mutation in Pappa2 is a T to A transversion at base pair 158,834,918 (v38) on chromosome 1, or base pair 145,606 in the GenBank genomic region NC_000067 encoding Pappa2. Linkage was found with an additive model of inheritance (P = 4.70 x 10-4), wherein five variant homozygotes and seven heterozygotes departed phenotypically from 11 homozygous reference mice (Figure 2).

 

The mutation corresponds to residue 3,486 in the mRNA sequence NM_001085376 in exon 10 of 22 total exons. 

 

3469 AGCCTTTGCTACAGGTATGAGGGAGATGGGGTT

1157 -S--L--C--Y--R--Y--E--G--D--G--V-

 

The mutated nucleotide is indicated in red.  The mutation results in substitution of tyrosine 1,162 to a premature stop codon (Y1162*) in the PAPP-A2 protein.

Protein Prediction
Figure 3. Domain figure of PAPP-A2. The Lilliputian2 mutation results in substitution of tyrosine 1,162 to a premature stop codon (Y1162*). Abbreviations: SP, signal peptide; Laminin, laminin G-like domain; LNR, Lin12/Notch repeats; FN3, fibronectin 3-like domain; CCP/SCR, complement control protein/short consensus repeat. This image is interactive. Other mutations found in PAPP-A2 are noted. Click on each mutation for more information.

Pappa2 encodes pregnancy-associated plasma protein A2 (PAPP-A2; alternatively, PAPP-E), a member of the pappalysin group of the metzincin protease family along with PAPP-A and ulilysin. PAPP-A2 is a 1,789-amino acid protein that has several domains: a signaling peptide (amino acids 1-18), a laminin G-like domain (amino acids 271-440), a peptidase/proteolytic domain (amino acids 669-832), a fibronectin 3-like domain (FN3; amino acids 844-1103), four complement control protein (CCP) domains (alternatively, short consensus repeat (SCR); amino acids 1394-1457, 1462-1519, 1523-1588, and 1593-1644), and two Lin12/Notch repeats (LNRs; amino acids 572-614 and 1720-1757) (Figure 3) (1).

 

The mutation in Lilliputian2 results in substitution of tyrosine 1,162 to a premature stop codon (Y1162*). Amino acid 1,162 is within an undefined domain between the FN3 domain and the first CCP domain.

 

Please see the record Lilliputian for more information about Pappa2.

Putative Mechanism

PAPP-A2 is a protease that acts on insulin-like growth factor binding protein 5 (IGFBP5), a factor involved in bone metabolism (2;3) and IGFBP3 (4). IGFBP5 regulates the IGF-I signaling pathways by binding IGF-I. IGFBP5 also has IGF-I-independent functions. IGFPB5 is able to bind its putative receptor to enter the cytoplasm and subsequently interact with, and regulate, other proteins. Studies have shown that PAPP-A2 has roles in human pregnancy (5), reproductive traits in cattle (6), and postnatal growth in mice (7;8). Pappa2-deficient (Pappa2-/-) mice are viable and smaller than wild-type mice (8). At 3-18 weeks of age, the male Pappa2-/- mice had approximately 10% lower body weights than that in age-matched wild-type mice (8). Weight reduction was more pronounced in female mice compared to that in age-matched male mice (8). In the female mice, all organs except ovaries were larger than that in wild-type mice. The Pappa2-/- mice have shorter femur length than that in wild-type mice, but do not exhibit changes in bone mineral density. Pappa2 deletion does not affect placental or embryonic mass at embryonic day 12.5 (9). At birth, the Pappa2-/- mice exhibited a trend towards lower birth mass (9). At 3, 6, and 10 weeks of age, the Pappa2-/- mice exhibited reduced body mass and tail lengths compared to wild-type mice (9). The shape of the pelvic girdle significantly differed between that in the Pappa2-/- and wild-type mice; the Pappa2-/- mice had a more feminine shape and was disproportionately small (9). Matings between Pappa2-/- mice exhibited a delay to first litter, increased number of days between litter, and a reduced number of pups per litter compared to matings between wild-type mice (8). Although Pappa2 deletion results in diminished levels of circulating IGF-I, IGFBP-3, and IGFBP-5, there were no glucose metabolism phenotypes observed (10). In addition, loss of Pappa2 expression did not result in weight gain or adiposity on a high-fat diet (10). Loss of Pappa2 expression in mouse does not effect female fertility, but has subtle effects on male fertility (11). The body weight phenotype of the Lilliputian2 mice indicates loss-of-function of PAPP-A2Lilliputian2.

Primers PCR Primer
Lilliputian2(F):5'- AGCCATGACTCCATTCTTCTGG -3'
Lilliputian2(R):5'- TGCTTCTTCCCTCATAAAGAGTG -3'

Sequencing Primer
Lilliputian2_seq(F):5'- CTGGCTTAACTTACCATTGAATGAGG -3'
Lilliputian2_seq(R):5'- TCTTCCCTCATAAAGAGTGAAAAAC -3'
References
Science Writers Anne Murray
Illustrators Peter Jurek
AuthorsEmre Turer and Bruce Beutler
List |< first << previous [record 88 of 132] next >> last >|