Phenotypic Mutation 'quicksilver'

• Allele: quicksilver
• Mutation Type: missense
• Chromosome: 7
• Coordinate: 55,974,409 bp (GRCm39)
• Base Change: G ⇒ A (forward strand)
• Gene: Oca2
• Gene Name: oculocutaneous albinism II
• Synonym(s): p, D7H15S12, D7H15S12
• Chromosomal Location: 55,889,508-56,186,266 bp (+) (GRCm39)
• MGI Phenotype: FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the human homolog of the mouse p (pink-eyed dilution) gene. The encoded protein is believed to be an integral membrane protein involved in small molecule transport, specifically tyrosine, which is a precursor to melanin synthesis. It is involved in mammalian pigmentation, where it may control skin color variation and act as a determinant of brown or blue eye color. Mutations in this gene result in type 2 oculocutaneous albinism. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2014] ; PHENOTYPE: Mutations generally result in varying degrees of coat and eye pigment dilution. Specific alleles produce cleft palate, reproductive, endocrine or neurological disorders, and/or lethality. [provided by MGI curators]
• Mapped: Yes
• Amino Acid Change: Glutamic Acid changed to Lysine
• Institutional Source: Beutler Lab
• Gene Model: not available
• AlphaFold: Q62052
• SMART Domains: Protein: ENSMUSP00000032633; Gene: ENSMUSG00000030450; AA Change: E453K

Domain	Start	End	E-Value	Type
transmembrane domain	171	193	N/A	INTRINSIC
Pfam:ArsB	319	558	2e-10	PFAM
Pfam:CitMHS	337	770	2e-49	PFAM
Pfam:ArsB	562	827	8.9e-9	PFAM
Pfam:Na_sulph_symp	573	832	6e-13	PFAM

• Predicted Effect: probably benign ; PolyPhen 2 Score 0.190 (Sensitivity: 0.92; Specificity: 0.87)
  (Using ENSMUST00000032633)
• Predicted Effect: probably benign
• SMART Domains: Protein: ENSMUSP00000119099; Gene: ENSMUSG00000030450

Domain	Start	End	E-Value	Type
transmembrane domain	171	193	N/A	INTRINSIC

• Predicted Effect: probably benign
• Meta Mutation Damage Score: Not available
• Is this an essential gene?: Probably nonessential (E-score: 0.106)
• Phenotypic Category: Autosomal Recessive
• Penetrance: 100%
• Mode of Inheritance: Autosomal Recessive
• Local Stock: Sperm, gDNA
• Last Updated: 2018-01-12 4:31 PM by Diantha La Vine
• Record Created: unknown
• Record Posted: 2008-04-10
• Science Writers: Nora G. Smart
• Illustrators: Diantha La Vine
• Authors: Celine Eidenschenk, Bruce Beutler

Accession Number

NCBI RefSeq: NM_021879; MGI: 97454

Alleles Listed at MGI

All alleles(66) : Gene trapped(1) Spontaneous(19) Chemically induced(7) Radiation induced(39)

Repository

none

Phenotypic Description

The quicksilver mutation was induced by ENU mutagenesis on the C57BL/6J (black) background and was discovered in G3 animals.  Quicksilver is a strictly recessive phenotype with hypopigmented fur and ocular albinism, similar to the phenotype created by mutations at the Oca2 or p (pink-eyed dilution) locus.  Mutations at Oca2 are known to cause a reduction of eumelanin (black-brown) pigment and altered morphology of black pigment granules (eumelanosomes), but have little effect on pheomelanin (yellow-red) pigment (1;2).  

 

Immune system function is largely normal in quicksilver mutants.  Quicksilver mice, like allelic charbon and snowflake mice, display normal resistance to murine cytomegalovirus (MCMV) (MCMV Susceptibility and Resistance Screen).  Quicksilver mutants are slightly susceptible to infection by Listeria monocytogenes, showing a 75% survival rate compared with 100% survival in wild type controls.  However, they produce normal amounts of cytokines in response to Listeria infection and clear infection from the liver as well as wild type mice.  In vitro, NK cells from quicksilver mice degranulate normally upon stimulation of Ly49H or NKp46 receptors, or upon PMA ionomycin treatment.  IFN-γ production after PMA ionomycin stimulation is also normal.  Quicksilver and charbon mice display the same immune system phenotypes, except that quicksilver NK cells fail to degranulate after exposure to YAC-1 cells; this phenotype has been repeated.

Nature of Mutation

The quicksilver mutation was mapped to Chromosome 7, and corresponds to a G to A transition at position 1487 of the Oca2 transcript, in exon 14 of 24 total exons.  This mutation is identical to the one found in faded mutants.

 

1472 ACCATAAGGTTATGTGAAGTGCTCAATCTTGAT

448  -T--I--R--L--C--E--V--L--N--L--D-

 

The mutated nucleotide is indicated in red lettering, and results in a glutamic acid to lysine change at amino acid 453 in the mouse OCA2 protein.

Protein Prediction

Figure 1. Domain organization and function of the OCA2 protein. A, Topography. B, Domain structure. The quicksilver mutation results in a glutamic acid to lysine change at amino acid 453 in the mouse OCA2 protein. Other mutations found in OCA2  are noted in red. This image is interactive. Click on the mutations for more specific information.

The mouse OCA2 or P protein contains 833 residues, and is 78% identical to the 838 residue human OCA2 located at 15q11.2-q12 (1;3;4).

 

OCA2 is a 110-kDa twelve transmembrane-spanning protein (Figure 1) that exhibits homology to a number of bacterial transporters (4).  These include Na⁺/sulfate symporters that transport sulfate, citrate, succinate, and dicarboxylate, as well as arsenate-translocating channels important for arsenic resistance (1;3-5).  Analysis of the human OCA2 polypeptide sequence demonstrates a single copy of a structural motif, ExxPLL (codons 96-101) (1), thought to be involved in intracellular trafficking of proteins to the melanosome (6).  This motif also occurs at the corresponding position in the mouse OCA2 polypeptide (residues 92-97), in the region upstream of the first transmembrane domain that otherwise has not been highly conserved.  In addition, another motif, SKL, thought to mediate intracellular trafficking of proteins to the peroxisome (7), occurs in the human OCA2 protein at amino acid residues 169-171 and at residues 165-167 in the mouse (1;4), but the functional significance of this is unknown as such sequences typically occur at the C-terminus.  

 

The quicksilver mutation occurs between the fifth and sixth transmembrane domains of the OCA2 protein and is located on the lumenal side of the vesicular membrane.  It is unknown whether normal levels of the altered OCA2 protein exist in quicksilver mice or whether this protein is localized appropriately.

Expression/Localization

The expression pattern of Oca2 correlates with the pigmentation phenotype observed in Oca2 mutants.  Oca2 is found only in areas of black pigment (eumelanin) and not in areas lacking eumelanin.  Indeed, the Oca2 gene is not transcribed during the pheomelanic phase of the murine agouti hair cycle (1;8).  In mouse, Oca2 transcripts are expressed predominantly in melanocytes, but are also found in the brain (cerebellum), testes, and ovaries (3).  In situ hybridization localizes Oca2 transcript beginning at embryonic day (E) 10.5 in the dorsal part of the eyecup during eye development.  Expression is detected only in the external layer fated to become retinal pigmented epithelium (RPE).  At E11.5 Oca2 is transcribed by all cells of the external layer of the developing eyecup and extendsto the ciliary body by E18.5.  Expression in the RPE is maintained in adult animals (9).  During early eye development, the Oca2 expression pattern is complementary to the expression of Pax2, a transcription factor critical for eye development that may negatively regulate melanin production (9;10).  

 

In humans, OCA2 transcript is found in primary melanocytes and fetal brain, but not in other tissue types including pancreas, kidney, skeletal muscle, liver, lung, placenta, heart, hematapoietic cells or adult brain (1).  An expression anatomy database indicates that OCA2 is expressed at high levels in both mouse and human thyroid (http://symatlas.gnf.org/SymAtlas/).  

 

The OCA2 protein is located largely in the endoplasmic reticulum (ER) of melanocytes or RPE cells (5), but has also been found associated with melanosomal membranes (1;3;11;12).  Melanosomes are endolysosomal-like organelles where melanin synthesis and storage takes place.

Background

Figure 2. Premelanosomes arise from the late secretory or endosomal pathway. Premelanosomes arise from the late secretory or endosomal pathway. Stage 1 premelanosomes (depicted here as "Early endosome/Stage I" for simplicity) lacking pigment are thought to correspond to the coated endosome, an intermediate between early and late endosomes densely coated on one face with clathrin. PMEL17, a structural component of the melanosome on which melanins are deposited (not depicted) accumulates in stage I and II; PMEL17 is masked by melanin in later stages. Melanin synthesis begins in Stage II premelanosomes that contain regular arrays of parallel fibers that give these organelles a striated appearance by electron microscopy. During Stage III, these fibers gradually darken and thicken (red arrows, inset) as eumelanin is deposited along them, such that by Stage IV no striations are visible and the melansome is filled with melanin; this action has been illustrated in the inset. All cargoes required for melanin synthesis, processing, and transport (OCA2, SLC45A2, Rab32, Rab38, DCT (alternatively, Tyrp2), Tyr, and Tyrp1) derive from the Golgi and traverse vacuolar and/or tubular elements (not shown) of early endosomes en route to the stage III melanosome. Adaptor protein-3 and -1 as well as biogeneisis of lysosome-related organelle complex-1 (BLOC-1) and BLOC-2 regulate the intracellular trafficking of Tyrp1. SLC45A2 and OCA2 function in the trafficking of Tyrp1 and DCT to melanosomes. OCA2 maintains the proper pH in the melanosomes and transports glutathione, a protein necessary for Tyr and Tyrp1 trafficking to melanosomes. Black arrows represent transport of vesicles; red arrows represent protein-mediated regulation at a specific transport step as indicated in the key. The image is interactive, click to reveal mutations in several of the proteins. Several mouse models with mutations in components of the pigment-producing pathway are shown below; the mutation name (black) and mutated gene (red) are indicated. The melanosome pathway has been adapted from several sources including: Raposo, G. and Marks, M.S. (2007), Nat. Rev. Mol. Cell Biol., 8:786 and Lakkaraju, A. et al. (2009), J. Cell Biol., 187:161.

To date, there have been more than one hundred mutant Oca2 alleles identified in mice, some of which were spontaneous in origin.  Many others have been induced either by X-rays or chemical mutagens.  When present in the homozygous state, these mutant alleles cause hypopigmentation of the coat and eye resulting in color dilution ranging from moderate to severe. In addition to affecting pigmentation, several of these mutant alleles are associated with other abnormalities including neurological disorders, cleft palate, male sterility and female semi-fertility, genetic instability and prenatal lethality (13-16).  However, these alleles are nearly all radiation-induced, and likely occur in combination with multi-locus deletions (see discussion of Prader-Willi and Angelman syndromes below) (1;3;17;18).  Mice (and humans) null for the Oca2 locus exhibit normal behavior and fertility.  The only phenotypes specifically associated with loss of the Oca2 gene are pigmentation defects (1;3).

In mice with Oca2 mutations, the eumelanosomes present in melanocytes and in RPE cells are small and abnormally shaped and have alterations of the pigment granules.  The severity of the phenotype correlates with severity of the Oca2 mutation.  Mice carrying null Oca2 alleles exhibit a greatly reduced number of very small eumelanosomes in pigmented tissue.  This phenotype also correlates with the level of melanosomal proteins, including tyrosinase (please see the record for ghost), present in these tissues.  Very low levels of melanosomal proteins are present in mice with null alleles for Oca2 (16;19;20).  These studies suggest that OCA2 directly affects the biogenesis of melanosomes, resulting in loss of these organelles and their contents.  However, other studies suggest that OCA2 regulates the processing of tyrosinase and other melanosomal proteins in the ER, and subsequent trafficking of these proteins to melanosomes (5;12;21-24).  Thus, melanosomal defects could be a secondary consequence to the mislocalization of melanosomal proteins critical for melanosomal structure and function.  The absence of these proteins in mice mutant for Oca2 may be due to protein degradation or abnormal secretion from melanocytes, as OCA2-deficient melanocytes secrete tyrosinase into the medium in vitro (12;21;22).  

The exact function of the OCA2 protein is unknown (Figure 2).  Based on its similarity to bacterial transporters (1;3;4), presence in the melanosomal membrane (1;3;11;12), and partial compensation for pigmentation defects in vitro by exposing OCA2-deficient melanocytes to high levels of tyrosine, OCA2 was suggested to be a tyrosine transporter, the substrate necessary for melanin production within the melanosome (4;11;19;25).  However, further in vitro studies in melanocytes suggested the rate of tyrosine uptake in cells mutant for Oca2 was normal (22;26).  Since OCA2 has some structural similarity to the E. coli Na⁺/H⁺ antiporter, one hypothesis is that it plays a role in maintaining the proper pH of the melanosome by functioning as a proton pump (27-30), but some of the studies supporting this hypothesis are contradictory.  In general, melanosomes maintain an acidic environment and it has been suggested that acidification leads to higher tyrosinase activity and production of eumelanin.  The finding that Oca2-deficient melanocytes are non-acidic supports this hypothesis (27;28).  However, this result has been questioned (29;30), and numerous studies suggest that a more neutral pH is optimal for tyrosinase activity and eumelanin production (31;32).  The OCA2 protein functions to neutralize melanosomal pH, resulting in increased tyrosinase activity (29;30).  However, these results are not inconsistent with a more indirect role of OCA2 on melanosomal pH, such as regulating trafficking of a critical protein to the melanosome (30). Finally, OCA2 has also been suggested to be a glutathione transporter because of its ability to modulate glutathione levels when expressed in yeast (5).  Glutathione may inhibit tyrosinase activity via the reduction of copper atoms at the active site or by inhibiting melanin formation through redox mechanisms (33).  However, glutathione is also required for the folding of proteins in the ER and could play a role in tyrosinase maturation (34).  OCA2 may regulate the folding of tyrosinase by transporting glutathione into the ER (5), and aid tyrosinase activity by transporting glutathione out of the melanosome.

Adaptor protein (AP)-3 complex and the lysosome-related organelles complex BLOC-1 and BLOC-2 are important parts in the formation and maturation of melanosomes through the trafficking of melanin-synthesizing enzymes [reviewed in (35)].  The AP-3, BLOC-1, and BLOC-2 complexes contain proteins that can be defective in Hermansky-Pudlak syndrome (e.g.  the β3 subunit of AP-3 is defective in the pearl mice [Ap3b1^pe; also see the record for bullet gray] and the HPS6 subunit of the BLOC-2 complex is defective in ruby-eye animals [Hps6^ru; see the record for stamper-coat).  Using several mouse models that exhibit mutations in the AP-3, BLOC-1, BLOC-2, and Oca2, Hoyle et al. demonstrated that there epistatic interactions between an Oca mutant allele (Oca2^p-un) and mutant alleles from the other complexes (35).  For example, the coat color effects of the Oca2^p-un mutation can be masked by a null mutant of the pallidin subunit of the BLOC-1 complex (Pldn^pa) (35).  Hoyle et al. speculate that OCA2 activity may require BLOC-1 function (35).  Mating the Oca2^p-un mouse with mice carrying either a mutation in Hps3 (Hps3^coa), a subunit of the BLOC-2 complex, or the pearl mouse, revealed that Oca2^p-un acted as a semidomainant enhancer of Hps^coa and pearl (35).   Hoyle et al. speculate that in cells deficient in BLOC-2 or AP-3, the gene dosage of Oca2 is rate limiting (i.e. the lack of the BLOC-2 and AP-3 complexes would effect the sorting and/or activity of OCA2) (35).

In humans, mutations in OCA2 cause oculocutaneous albinism type 2 or tyrosinase-positive albinism, the most common type of albinism in the world (OCA2, OMIM #203200, mutated in snowflake, whitemouse, charbon, faded, and quicksilver) (36;37).  Oculocutaneous albinism in humans is a recessive, genetically heterogeneous congenital disorder characterized by decreased or absent pigmentation in the hair, skin, and eyes. The reduction of melanin pigment in the skin and eyes results in an increased sensitivity to ultraviolet radiation, and a predisposition to skin cancer (36).  The reduction of melanin pigment in the eye during development leads to foveal hypoplasia and abnormal routing of the nerve fibers from the eye to the brain, resulting in nystagmus (rapid movements of the eyes), strabismus (lazy eye), reduced visual acuity, and loss of binocular vision (36;38).  Aside from mutations in OCA2, OCA is caused by mutations in several genes including tyrosinase (OCA1A, OMIM #203100 and OCA1B, OMIM #606952; mutated in ghost), tyrosinase-related protein 1 or Tyrp1 (OCA3, OMIM #203290 or red OCA, OMIM #278400), and the solute carrier family 45, member 2 gene or SLC45A2 (OCA4, OMIM #606574, mutated in cardigan, grey goose, galak, and sweater) (1;36;39-41).  Tyrp1, along with tyrosinase, has a direct role in melanin synthesis, and also stabilizes tyrosinase (42-44), while SLC45A2 plays a role similar to that of OCA2 and is important for proper maturation, processing and trafficking of tyrosinase to post-Golgi melanosomes (1;42;45;46).  OCA, amongst other phenotypes, is also characteristic of Hermansky-Pudlak syndrome (OMIM #203300), and Chediak-Higashi syndrome (OMIM #214500).  Mutations in genes associated with these diseases cause a more generalized defect in protein trafficking resulting in defects in lysosome-related organelles including melanosomes (please see toffee, dorian gray, pam gray, minnie, stamper-coat, bullet gray, sooty, souris, and grey wolf) (47;48).

Deletions in the region surrounding the OCA2 gene in humans results in two syndromes; Prader-Willi (OMIM #176270) and Angelman (OMIM #105830).  Prader-Willi syndrome (PWS) results from deletion of the paternal copy of an imprinted region of Chromosome 15 that includes the imprinted SNRPN gene (small nuclear ribonucleoprotein polypeptide), the Necdin gene important in brain function, and other genes (18;49;50).  PWS is characterized by diminished fetal activity, obesity, muscular hypotonia, mental retardation, short stature, hypogonadotropic hypogonadism, and small hands and feet.  Most patients also exhibit hypopigmentation and ocular albinism probably caused by deletion of the OCA2 gene.  Similarly, Angelman syndrome is caused by absence of a maternal contribution to the same region on Chromosome 15.  Angelman syndrome is characterized by mental retardation, movement or balance disorder, characteristic abnormal behaviors, and severe limitations in speech and language along with hypopigmentation (18;49;51).

Genetic studies of OCA2 polymorphisms suggest a link with melanomas (52;53), and with human iris color variation (52).  Some melanoma cell lines do not express OCA2 (3).

Putative Mechanism

The quicksilver mutation results in an E453K change in the lumenal region of the protein located between transmembrane domains 5 and 6.  This region is highly conserved between mouse and human OCA2, but the function is unknown.  However, the change from glutamic acid, an acidic residue, to lysine which is basic, could be significant.  Mutation of the same nucleotide in faded mutants (G1487A) and the relatively close C1506T (P459L) mutation in snowflake mice, indicate that this region of the protein is important for function.  Human mutations in this region cause oculocutaneous albinism, although none of the mutations lie adjacent to the nucleotide affected in quicksilver mice.

 

Mice with null alleles of Oca2 have very little to no eumelanin in their coat and eyes, resulting in light grey mice with pink eyes on a nonagouti background (e.g. C57BL/6J), and cream-colored mice on an agouti background (16;20).  Quicksilver mutants exhibit darker fur and dark-red eyes, suggesting that the quicksilver mutation is hypomorphic for OCA2 activity.  Allelic charbon mice have a very similar pigmentation defect as quicksilver, while snowflake and whitemouse exhibit lighter coat colors, suggesting reduced function of the OCA2 protein in these animals.  The locations of the residues altered in these mutants are depicted in Figure 1.     

 

The susceptibility to L. monocytogenes seen in charbon and quicksilver mice is mild, and initial studies suggest near-normal immune function for these animals.  It is difficult to explain how the OCA2 protein may affect immune system function as defects in Oca2 mutants appear to be specific to melanocytes.  However, it is possible that Oca2 mutant mice are generally less healthy than wild type animals, providing a basis for the reduced viability in response to L.monocytogenes infection.  The mechanism underlying the defect in NK cell degranulation in response to YAC-1 cells is unknown.

Primers

Primers cannot be located by automatic search.

Genotyping

Quicksilver genotyping is performed by amplifying the region containing the mutation using PCR, followed by sequencing of the amplified region to detect the single nucleotide change.

 

Primers for PCR amplification

Quick(F): 5’-GGCTTTCCAAGACATAGACTGTCCC-3’

Quick(R): 5’-GTTCTCAGTGACGAAACCACCTCC-3’

 

PCR program

1) 94°C             2:00

2) 94°C             0:30

3) 56°C             0:30

4) 72°C             1:00

5) repeat steps (2-4) 29X

6) 72°C             7:00

7) 4°C               ∞

 

Primers for sequencing

Quick_seq(F): 5’- CACTCTCTGGACTGAAGGAATCTG -3’

Quick_seq(R): 5’- AGCCCCTTAATCTTGAAGACTG -3’

 

The following sequence of 1056 nucleotides (from Genbank genomic region NC_000073 for linear DNA sequence of Oca2) is amplified:

 

84209                               gg ctttccaaga catagactgt cccagggaat

84241 ataggcaaga gatttgtgca gattgctagg taccaagagt ttttgctcat ggtttcccac

84301 attttcatct tccacctatt catagagctt agtcttcaac agatcagggt ataggacttc

84361 caaagatccc aagacaaata tcatgcagcc aacctatagc caagaggaag taaaggtaat

84421 gattcaagta atgagcagag agggtttaaa gtctcttcag aaaagggaga gcacacaagg

84481 gtctaagtca gcaggcttag tgttatttta ttgctggtga tttttgattc cccaccactc

84541 tctggactga aggaatctga tagctgatgt ccattcacct gctccaggcc ctttcctcta

84601 ctgtggccct acacgtggag ctcaacactc ccccagggct gtgggagcag gcagaagcca

84661 taccatcaca cggatagctc agactgtggt gtgtgaactt agaagtatac ttgtaatttg

84721 ttgtatctga ggatgttact gctgatagtc attccctgca ttatgtgtgt tttggggagt

84781 gtgcgtatgt gtgcatgtga atcgatgtgc cttcctgtac aagcaaatac tttaaaaatt

84841 tgggttgtgg acggacctta tcactgtctt ccattcatgg taggttatgt gaagtgctca

84901 atcttgatcc gagacaagtc ctcattgcag aagtgatctt cacaaacatt ggaggagctg

84961 ccactgctat tggggaccca ccaaatgtta tcattgtttc caatcaggag ttgagaaaaa

85021 tggtaggtaa cagcacggta gggttgattt caggaaatgt aaactcaaca gagcactcta

85081 tgcagcttcc tttaataagt actgtgaacc aaggttcttg ctgtcacctg ttcacagcag

85141 gtgctattga tcataagtag tttaggaggg gaaaatcagg agagacagtc ttcaagatta

85201 aggggctgca tttagggcct gtattgacag taacgtgatg ggaggtggtt tcgtcactga

85261 gaac

 

PCR primer binding sites are underlined; sequencing primer binding sites are highlighted in gray; the mutated G is shown in red text.

References

  1. Rinchik, E. M., Bultman, S. J., Horsthemke, B., Lee, S. T., Strunk, K. M., Spritz, R. A., Avidano, K. M., Jong, M. T., and Nicholls, R. D. (1993) A Gene for the Mouse Pink-Eyed Dilution Locus and for Human Type II Oculocutaneous Albinism. Nature. 361, 72-76.

  2. RUSSELL, E. S. (1949) A Quantitative Histological Study of the Pigment found in the Coat-Color Mutants of the House Mouse; the Nature of the Effects of Genic Substitution in Five Major Allelic Series. Genetics. 34, 146-166.

  3. Gardner, J. M., Nakatsu, Y., Gondo, Y., Lee, S., Lyon, M. F., King, R. A., and Brilliant, M. H. (1992) The Mouse Pink-Eyed Dilution Gene: Association with Human Prader-Willi and Angelman Syndromes. Science. 257, 1121-1124.

  4. Lee, S. T., Nicholls, R. D., Jong, M. T., Fukai, K., and Spritz, R. A. (1995) Organization and Sequence of the Human P Gene and Identification of a New Family of Transport Proteins. Genomics. 26, 354-363.

  5. Staleva, L., Manga, P., and Orlow, S. J. (2002) Pink-Eyed Dilution Protein Modulates Arsenic Sensitivity and Intracellular Glutathione Metabolism. Mol. Biol. Cell. 13, 4206-4220.

  6. Kwon, B. S. (1993) Pigmentation Genes: The Tyrosinase Gene Family and the Pmel 17 Gene Family. J. Invest. Dermatol.. 100, 134S-140S.

  7. Gould, S. J., Keller, G. A., and Subramani, S. (1988) Identification of Peroxisomal Targeting Signals Located at the Carboxy Terminus of Four Peroxisomal Proteins. J. Cell Biol.. 107, 897-905.

  8. Tamate, H. B., Hirobe, T., Wakamatsu, K., Ito, S., Shibahara, S., and Ishikawa, K. (1989) Levels of Tyrosinase and its mRNA in Coat-Color Mutants of C57BL/10J Congenic Mice: Effects of Genic Substitution at the Agouti, Brown, Albino, Dilute, and Pink-Eyed Dilution Loci. J. Exp. Zool.. 250, 304-311.

  9. Surace, E. M., Angeletti, B., Ballabio, A., and Marigo, V. (2000) Expression Pattern of the Ocular Albinism Type 1 (Oa1) Gene in the Murine Retinal Pigment Epithelium. Invest. Ophthalmol. Vis. Sci.. 41, 4333-4337.

  10. Torres, M., Gomez-Pardo, E., and Gruss, P. (1996) Pax2 Contributes to Inner Ear Patterning and Optic Nerve Trajectory. Development. 122, 3381-3391.

  11. Rosemblat, S., Durham-Pierre, D., Gardner, J. M., Nakatsu, Y., Brilliant, M. H., and Orlow, S. J. (1994) Identification of a Melanosomal Membrane Protein Encoded by the Pink-Eyed Dilution (Type II Oculocutaneous Albinism) Gene. Proc. Natl. Acad. Sci. U. S. A.. 91, 12071-12075.

  12. Toyofuku, K., Valencia, J. C., Kushimoto, T., Costin, G. E., Virador, V. M., Vieira, W. D., Ferrans, V. J., and Hearing, V. J. (2002) The Etiology of Oculocutaneous Albinism (OCA) Type II: The Pink Protein Modulates the Processing and Transport of Tyrosinase. Pigment Cell Res.. 15, 217-224.

  13. Johnson, D. K., Stubbs, L. J., Culiat, C. T., Montgomery, C. S., Russell, L. B., and Rinchik, E. M. (1995) Molecular Analysis of 36 Mutations at the Mouse Pink-Eyed Dilution (p) Locus. Genetics. 141, 1563-1571.

  14. Lyon, M. F., King, T. R., Gondo, Y., Gardner, J. M., Nakatsu, Y., Eicher, E. M., and Brilliant, M. H. (1992) Genetic and Molecular Analysis of Recessive Alleles at the Pink-Eyed Dilution (p) Locus of the Mouse. Proc. Natl. Acad. Sci. U. S. A.. 89, 6968-6972.

  15. Russell, L. B., Montgomery, C. S., Cacheiro, N. L., and Johnson, D. K. (1995) Complementation Analyses for 45 Mutations Encompassing the Pink-Eyed Dilution (p) Locus of the Mouse. Genetics. 141, 1547-1562.

  16. Silvers, W. K. (1979) The Coat Colors of Mice: A Model for Mammalian Gene Action and Interaction. Springer Verlag, New York.

  17. Brilliant, M. H. (1992) The Mouse Pink-Eyed Dilution Locus: A Model for Aspects of Prader-Willi Syndrome, Angelman Syndrome, and a Form of Hypomelanosis of Ito. Mamm. Genome. 3, 187-191.

  18. Brilliant, M. H., King, R., Francke, U., Schuffenhauer, S., Meitinger, T., Gardner, J. M., Durham-Pierre, D., and Nakatsu, Y. (1994) The Mouse Pink-Eyed Dilution Gene: Association with Hypopigmentation in Prader-Willi and Angelman Syndromes and with Human OCA2. Pigment Cell Res.. 7, 398-402.

  19. Rosemblat, S., Sviderskaya, E. V., Easty, D. J., Wilson, A., Kwon, B. S., Bennett, D. C., and Orlow, S. J. (1998) Melanosomal Defects in Melanocytes from Mice Lacking Expression of the Pink-Eyed Dilution Gene: Correction by Culture in the Presence of Excess Tyrosine. Exp. Cell Res.. 239, 344-352.

  20. Orlow, S. J., and Brilliant, M. H. (1999) The Pink-Eyed Dilution Locus Controls the Biogenesis of Melanosomes and Levels of Melanosomal Proteins in the Eye. Exp. Eye Res.. 68, 147-154.

  21. Manga, P., Boissy, R. E., Pifko-Hirst, S., Zhou, B. K., and Orlow, S. J. (2001) Mislocalization of Melanosomal Proteins in Melanocytes from Mice with Oculocutaneous Albinism Type 2. Exp. Eye Res.. 72, 695-710.

  22. Potterf, S. B., Furumura, M., Sviderskaya, E. V., Santis, C., Bennett, D. C., and Hearing, V. J. (1998) Normal Tyrosine Transport and Abnormal Tyrosinase Routing in Pink-Eyed Dilution Melanocytes. Exp. Cell Res.. 244, 319-326.

  23. Chen, K., Manga, P., and Orlow, S. J. (2002) Pink-Eyed Dilution Protein Controls the Processing of Tyrosinase. Mol. Biol. Cell. 13, 1953-1964.

  24. Bennett, D. C., and Lamoreux, M. L. (2003) The Color Loci of Mice--a Genetic Century. Pigment Cell Res.. 16, 333-344.

  25. Hirobe, T., Wakamatsu, K., Ito, S., Abe, H., Kawa, Y., and Mizoguchi, M. (2002) Stimulation of the Proliferation and Differentiation of Mouse Pink-Eyed Dilution Epidermal Melanocytes by Excess Tyrosine in Serum-Free Primary Culture. J. Cell. Physiol.. 191, 162-172.

  26. Gahl, W. A., Potterf, B., Durham-Pierre, D., Brilliant, M. H., and Hearing, V. J. (1995) Melanosomal Tyrosine Transport in Normal and Pink-Eyed Dilution Murine Melanocytes. Pigment Cell Res.. 8, 229-233.

  27. Puri, N., Gardner, J. M., and Brilliant, M. H. (2000) Aberrant pH of Melanosomes in Pink-Eyed Dilution (p) Mutant Melanocytes. J. Invest. Dermatol.. 115, 607-613.

  28. Brilliant, M. H. (2001) The Mouse p (Pink-Eyed Dilution) and Human P Genes, Oculocutaneous Albinism Type 2 (OCA2), and Melanosomal pH. Pigment Cell Res.. 14, 86-93.

  29. Ancans, J., Hoogduijn, M. J., and Thody, A. J. (2001) Melanosomal pH, Pink Locus Protein and their Roles in Melanogenesis. J. Invest. Dermatol.. 117, 158-159.

  30. Manga, P., and Orlow, S. J. (2001) Inverse Correlation between Pink-Eyed Dilution Protein Expression and Induction of Melanogenesis by Bafilomycin A1. Pigment Cell Res.. 14, 362-367.

  31. Fuller, B. B., Spaulding, D. T., and Smith, D. R. (2001) Regulation of the Catalytic Activity of Preexisting Tyrosinase in Black and Caucasian Human Melanocyte Cell Cultures. Exp. Cell Res.. 262, 197-208.

  32. Ancans, J., Tobin, D. J., Hoogduijn, M. J., Smit, N. P., Wakamatsu, K., and Thody, A. J. (2001) Melanosomal pH Controls Rate of Melanogenesis, eumelanin/phaeomelanin Ratio and Melanosome Maturation in Melanocytes and Melanoma Cells. Exp. Cell Res.. 268, 26-35.

  33. Jara, J. R., Aroca, P., Solano, F., Martinez, J. H., and Lozano, J. A. (1988) The Role of Sulfhydryl Compounds in Mammalian Melanogenesis: The Effect of Cysteine and Glutathione upon Tyrosinase and the Intermediates of the Pathway. Biochim. Biophys. Acta. 967, 296-303.

  34. Cuozzo, J. W., and Kaiser, C. A. (1999) Competition between Glutathione and Protein Thiols for Disulphide-Bond Formation. Nat. Cell Biol.. 1, 130-135.

  35. Hoyle, D. J., Rodriguez-Fernandez, I. A., and Dell'angelica, E. C. (2011) Functional Interactions between OCA2 and the Protein Complexes BLOC-1, BLOC-2, and AP-3 Inferred from Epistatic Analyses of Mouse Coat Pigmentation. Pigment Cell. Melanoma Res.. 24, 275-281.

  36. Oetting, W. S., and King, R. A. (1999) Molecular Basis of Albinism: Mutations and Polymorphisms of Pigmentation Genes Associated with Albinism. Hum. Mutat.. 13, 99-115.

  37. Oetting, W. S., Garrett, S. S., Brott, M., and King, R. A. (2005) P Gene Mutations Associated with Oculocutaneous Albinism Type II (OCA2). Hum. Mutat.. 25, 323.

  38. Creel, D. J., Summers, C. G., and King, R. A. (1990) Visual Anomalies Associated with Albinism. Ophthalmic Paediatr. Genet.. 11, 193-200.

  39. Boissy, R. E., Zhao, H., Oetting, W. S., Austin, L. M., Wildenberg, S. C., Boissy, Y. L., Zhao, Y., Sturm, R. A., Hearing, V. J., King, R. A., and Nordlund, J. J. (1996) Mutation in and Lack of Expression of Tyrosinase-Related Protein-1 (TRP-1) in Melanocytes from an Individual with Brown Oculocutaneous Albinism: A New Subtype of Albinism Classified as "OCA3". Am. J. Hum. Genet.. 58, 1145-1156.

  40. Manga, P., Kromberg, J. G., Box, N. F., Sturm, R. A., Jenkins, T., and Ramsay, M. (1997) Rufous Oculocutaneous Albinism in Southern African Blacks is Caused by Mutations in the TYRP1 Gene. Am. J. Hum. Genet.. 61, 1095-1101.

  41. Newton, J. M., Cohen-Barak, O., Hagiwara, N., Gardner, J. M., Davisson, M. T., King, R. A., and Brilliant, M. H. (2001) Mutations in the Human Orthologue of the Mouse Underwhite Gene (Uw) Underlie a New Form of Oculocutaneous Albinism, OCA4. Am. J. Hum. Genet.. 69, 981-988.

  42. Wang, N., and Hebert, D. N. (2006) Tyrosinase Maturation through the Mammalian Secretory Pathway: Bringing Color to Life. Pigment Cell Res.. 19, 3-18.

  43. Kobayashi, T., Imokawa, G., Bennett, D. C., and Hearing, V. J. (1998) Tyrosinase Stabilization by Tyrp1 (the Brown Locus Protein). J. Biol. Chem.. 273, 31801-31805.

  44. Francis, E., Wang, N., Parag, H., Halaban, R., and Hebert, D. N. (2003) Tyrosinase Maturation and Oligomerization in the Endoplasmic Reticulum Require a Melanocyte-Specific Factor. J. Biol. Chem.. 278, 25607-25617.

  45. Toyofuku, K., Wada, I., Valencia, J. C., Kushimoto, T., Ferrans, V. J., and Hearing, V. J. (2001) Oculocutaneous Albinism Types 1 and 3 are ER Retention Diseases: Mutation of Tyrosinase Or Tyrp1 can Affect the Processing of both Mutant and Wild-Type Proteins. FASEB J.. 15, 2149-2161.

  46. Costin, G. E., Valencia, J. C., Vieira, W. D., Lamoreux, M. L., and Hearing, V. J. (2003) Tyrosinase Processing and Intracellular Trafficking is Disrupted in Mouse Primary Melanocytes Carrying the Underwhite (Uw) Mutation. A Model for Oculocutaneous Albinism (OCA) Type 4. J. Cell. Sci.. 116, 3203-3212.

  47. Di Pietro, S. M., and Dell'Angelica, E. C. (2005) The Cell Biology of Hermansky-Pudlak Syndrome: Recent Advances. Traffic. 6, 525-533.

  48. Shiflett, S. L., Kaplan, J., and Ward, D. M. (2002) Chediak-Higashi Syndrome: A Rare Disorder of Lysosomes and Lysosome Related Organelles. Pigment Cell Res.. 15, 251-257.

  49. Brilliant, M. H., and Gondo, Y. (1992) Molecular Characterization of the p(Un) Allele of the Mouse Pink-Eyed Dilution Locus. Pigment Cell Res.. 5, 271-273.

  50. Benarroch, F., Hirsch, H. J., Genstil, L., Landau, Y. E., and Gross-Tsur, V. (2007) Prader-Willi Syndrome: Medical Prevention and Behavioral Challenges. Child Adolesc. Psychiatr. Clin. N. Am.. 16, 695-708.

  51. Lalande, M., and Calciano, M. A. (2007) Molecular Epigenetics of Angelman Syndrome. Cell Mol. Life Sci.. 64, 947-960.

  52. Sturm, R. A., Duffy, D. L., Zhao, Z. Z., Leite, F. P., Stark, M. S., Hayward, N. K., Martin, N. G., and Montgomery, G. W. (2008) A Single SNP in an Evolutionary Conserved Region within Intron 86 of the HERC2 Gene Determines Human Blue-Brown Eye Color. Am. J. Hum. Genet.. 82, 424-431.

  53. Jannot, A. S., Meziani, R., Bertrand, G., Gerard, B., Descamps, V., Archimbaud, A., Picard, C., Ollivaud, L., Basset-Seguin, N., Kerob, D., Lanternier, G., Lebbe, C., Saiag, P., Crickx, B., Clerget-Darpoux, F., Grandchamp, B., Soufir, N., and Melan-Cohort. (2005) Allele Variations in the OCA2 Gene (Pink-Eyed-Dilution Locus) are Associated with Genetic Susceptibility to Melanoma. Eur. J. Hum. Genet.. 13, 913-920.