Phenotypic Mutation 'ito' (pdf version)
List |< first << previous [record 82 of 132] next >> last >|
Alleleito
Mutation Type nonsense
Chromosome15
Coordinate66,766,162 bp (GRCm38)
Base Change C ⇒ T (forward strand)
Gene Tg
Gene Name thyroglobulin
Synonym(s) Tgn
Chromosomal Location 66,670,753-66,850,721 bp (+)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Thyroglobulin (Tg) is a glycoprotein homodimer produced predominantly by the thryroid gland. It acts as a substrate for the synthesis of thyroxine and triiodothyronine as well as the storage of the inactive forms of thyroid hormone and iodine. Thyroglobulin is secreted from the endoplasmic reticulum to its site of iodination, and subsequent thyroxine biosynthesis, in the follicular lumen. Mutations in this gene cause thyroid dyshormonogenesis, manifested as goiter, and are associated with moderate to severe congenital hypothyroidism. Polymorphisms in this gene are associated with susceptibility to autoimmune thyroid diseases (AITD) such as Graves disease and Hashimoto thryoiditis. [provided by RefSeq, Nov 2009]
PHENOTYPE: Mice homozygous for a spontaneous mutation exhibit enlarged thyroid gland, hypothyroidism, abnormal thyroid gland morphology, and decreased body weight. [provided by MGI curators]
Accession Number

NCBI RefSeq: NM_009375; MGI:98733

Mapped Yes 
Amino Acid Change Glutamine changed to Stop codon
Institutional SourceBeutler Lab
Gene Model predicted gene model for protein(s): [ENSMUSP00000070239] [ENSMUSP00000129868] [ENSMUSP00000126454]
SMART Domains Protein: ENSMUSP00000070239
Gene: ENSMUSG00000053469
AA Change: Q2275*

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
TY 50 97 5.9e-16 SMART
TY 118 165 5.59e-17 SMART
Pfam:Thyroglobulin_1 174 252 4e-9 PFAM
TY 317 363 4.36e-19 SMART
low complexity region 495 504 N/A INTRINSIC
TY 617 662 3.58e-15 SMART
TY 684 730 1.47e-16 SMART
TY 880 926 1.51e-4 SMART
TY 1029 1078 1.21e-12 SMART
TY 1106 1150 7.56e-5 SMART
TY 1167 1215 7.26e-16 SMART
low complexity region 1244 1255 N/A INTRINSIC
Pfam:GCC2_GCC3 1464 1509 2.7e-16 PFAM
TY 1519 1568 9.81e-13 SMART
Pfam:COesterase 2181 2717 8.4e-140 PFAM
Predicted Effect probably null
SMART Domains Protein: ENSMUSP00000129868
Gene: ENSMUSG00000053469

DomainStartEndE-ValueType
TY 14 63 1.21e-12 SMART
Predicted Effect noncoding transcript
SMART Domains Protein: ENSMUSP00000126454
Gene: ENSMUSG00000053469
AA Change: Q656*

DomainStartEndE-ValueType
internal_repeat_1 93 331 1.53e-6 PROSPERO
Pfam:COesterase 562 1098 2.1e-137 PFAM
Predicted Effect probably null
SMART Domains Protein: ENSMUSP00000128410
Gene: ENSMUSG00000053469

DomainStartEndE-ValueType
Pfam:COesterase 313 849 6e-140 PFAM
Predicted Effect noncoding transcript
Phenotypic Category
Phenotypequestion? Literature verified References
Body Weight - decreased 1508304 3803305
Body Weight (Female) - decreased 1508304 3803305
OVA-specific IgE - increased
Penetrance  
Alleles Listed at MGI

All Mutations and Alleles(10) Chemically induced (ENU)(1) Chemically induced (other)(3) Gene trapped(1) Radiation induced(2) Spontaneous(1) Targeted(1) Transgenic(1)

Lab Alleles
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00157:Tg APN 15 66847166 missense probably damaging 1.00
IGL00230:Tg APN 15 66827290 missense probably benign 0.00
IGL00324:Tg APN 15 66693424 missense probably benign
IGL00428:Tg APN 15 66773424 missense probably benign 0.33
IGL00703:Tg APN 15 66696489 missense probably benign 0.34
IGL00808:Tg APN 15 66683813 missense probably damaging 1.00
IGL00833:Tg APN 15 66688801 missense probably benign 0.34
IGL00899:Tg APN 15 66674073 critical splice donor site probably null
IGL00921:Tg APN 15 66764453 missense probably benign 0.28
IGL00975:Tg APN 15 66681882 missense probably benign
IGL01288:Tg APN 15 66736276 missense possibly damaging 0.81
IGL01397:Tg APN 15 66696092 splice site probably benign
IGL01634:Tg APN 15 66729566 missense probably benign 0.34
IGL01646:Tg APN 15 66678087 missense probably damaging 1.00
IGL01704:Tg APN 15 66671351 missense probably damaging 0.98
IGL01958:Tg APN 15 66759486 missense probably benign 0.06
IGL02093:Tg APN 15 66692374 missense possibly damaging 0.83
IGL02113:Tg APN 15 66705330 missense probably benign 0.08
IGL02138:Tg APN 15 66717233 missense probably benign 0.01
IGL02156:Tg APN 15 66705348 missense probably benign 0.19
IGL02169:Tg APN 15 66757943 missense probably benign 0.04
IGL02342:Tg APN 15 66764291
IGL02434:Tg APN 15 66764342 missense probably damaging 0.97
IGL02506:Tg APN 15 66741594 missense possibly damaging 0.71
IGL02513:Tg APN 15 66705274 missense probably benign
IGL02549:Tg APN 15 66839361 missense probably damaging 1.00
IGL02669:Tg APN 15 66748726
IGL02756:Tg APN 15 66734586
IGL02800:Tg APN 15 66757886 missense probably damaging 1.00
IGL02828:Tg APN 15 66682394 missense probably damaging 1.00
IGL02927:Tg APN 15 66678093 missense probably damaging 1.00
IGL03061:Tg APN 15 66671405 missense probably damaging 1.00
IGL03105:Tg APN 15 66715106 missense probably benign 0.01
IGL03160:Tg APN 15 66839303 nonsense probably null
IGL03242:Tg APN 15 66683798 missense probably damaging 0.99
ito2 UTSW 15 66671396 missense probably damaging 1.00
ito3 UTSW 15 66773474 missense probably damaging 1.00
ito4 UTSW 15 66696520 missense possibly damaging 0.47
ticker UTSW 15 66827382 nonsense probably null
IGL03134:Tg UTSW 15 66740718 missense probably damaging 1.00
P0019:Tg UTSW 15 66688863 missense probably benign 0.01
R0121:Tg UTSW 15 66740781 missense probably benign 0.04
R0135:Tg UTSW 15 66694870 missense probably benign 0.01
R0227:Tg UTSW 15 66698446 missense possibly damaging 0.84
R0448:Tg UTSW 15 66764442 missense probably damaging 1.00
R0453:Tg UTSW 15 66828533 missense probably benign 0.09
R0504:Tg UTSW 15 66682404 missense probably damaging 0.97
R0543:Tg UTSW 15 66729597 missense probably benign 0.13
R0638:Tg UTSW 15 66717208 missense probably damaging 0.99
R0639:Tg UTSW 15 66741484 critical splice acceptor site probably null
R0646:Tg UTSW 15 66729626 missense probably damaging 0.99
R0666:Tg UTSW 15 66737521 missense probably benign
R0673:Tg UTSW 15 66741484 critical splice acceptor site probably null
R0689:Tg UTSW 15 66839404 splice site probably benign
R0704:Tg UTSW 15 66757880 missense probably benign 0.02
R0730:Tg UTSW 15 66678789 missense probably damaging 1.00
R0830:Tg UTSW 15 66725144 missense probably damaging 1.00
R0959:Tg UTSW 15 66708010 missense probably damaging 0.98
R1027:Tg UTSW 15 66672409 missense possibly damaging 0.65
R1061:Tg UTSW 15 66698559 missense probably benign 0.09
R1086:Tg UTSW 15 66684062 missense probably benign
R1103:Tg UTSW 15 66719655 missense probably benign 0.45
R1240:Tg UTSW 15 66828548 missense probably benign 0.16
R1281:Tg UTSW 15 66696489 missense probably benign 0.34
R1470:Tg UTSW 15 66849463 missense possibly damaging 0.95
R1470:Tg UTSW 15 66849463 missense possibly damaging 0.95
R1531:Tg UTSW 15 66850502 missense probably benign 0.02
R1544:Tg UTSW 15 66705232 missense probably benign 0.04
R1550:Tg UTSW 15 66693430 missense possibly damaging 0.52
R1575:Tg UTSW 15 66729685 critical splice donor site probably null
R1638:Tg UTSW 15 66696166 nonsense probably null
R1655:Tg UTSW 15 66828568 critical splice donor site probably null
R1671:Tg UTSW 15 66692387 missense possibly damaging 0.89
R1789:Tg UTSW 15 66737548 missense probably benign 0.00
R1883:Tg UTSW 15 66671309 missense probably damaging 1.00
R1984:Tg UTSW 15 66682842 missense probably benign
R2063:Tg UTSW 15 66828553 missense probably damaging 1.00
R2092:Tg UTSW 15 66849607 missense probably null 0.10
R2109:Tg UTSW 15 66729594 missense probably benign 0.02
R2128:Tg UTSW 15 66694894 missense probably benign 0.10
R2129:Tg UTSW 15 66694894 missense probably benign 0.10
R2207:Tg UTSW 15 66681939 missense probably benign 0.15
R2219:Tg UTSW 15 66681933 missense probably benign 0.03
R2228:Tg UTSW 15 66674011 missense probably damaging 0.99
R2229:Tg UTSW 15 66674011 missense probably damaging 0.99
R2259:Tg UTSW 15 66683898 missense probably benign
R2994:Tg UTSW 15 66681953 missense probably benign
R3904:Tg UTSW 15 66766162 nonsense probably null
R3946:Tg UTSW 15 66674023 missense probably damaging 1.00
R3965:Tg UTSW 15 66684190 missense probably benign
R4245:Tg UTSW 15 66696469 missense possibly damaging 0.68
R4451:Tg UTSW 15 66766147 missense probably benign 0.01
R4487:Tg UTSW 15 66671396 missense probably damaging 1.00
R4489:Tg UTSW 15 66707942 missense probably damaging 1.00
R4623:Tg UTSW 15 66735271 missense probably benign 0.23
R4659:Tg UTSW 15 66673920 missense possibly damaging 0.67
R4728:Tg UTSW 15 66682827 missense probably damaging 1.00
R4760:Tg UTSW 15 66693319 missense probably damaging 1.00
R4797:Tg UTSW 15 66758006 critical splice donor site probably null
R4944:Tg UTSW 15 66764337 missense probably damaging 1.00
R4998:Tg UTSW 15 66674050 missense probably damaging 1.00
R5009:Tg UTSW 15 66696586 missense probably benign 0.01
R5025:Tg UTSW 15 66707930 missense probably damaging 1.00
R5035:Tg UTSW 15 66681813 splice site probably null
R5049:Tg UTSW 15 66827382 nonsense probably null
R5073:Tg UTSW 15 66735252 missense probably benign 0.05
R5169:Tg UTSW 15 66678780 nonsense probably null
R5185:Tg UTSW 15 66773474 missense probably damaging 1.00
R5227:Tg UTSW 15 66759567 missense possibly damaging 0.87
R5300:Tg UTSW 15 66678855 missense probably damaging 1.00
R5334:Tg UTSW 15 66678055 missense probably damaging 1.00
R5339:Tg UTSW 15 66678093 missense probably damaging 1.00
R5402:Tg UTSW 15 66739168 missense probably damaging 0.98
R5441:Tg UTSW 15 66696520 missense possibly damaging 0.47
R5509:Tg UTSW 15 66827293 missense probably benign 0.45
R5580:Tg UTSW 15 66685300 missense possibly damaging 0.66
R5582:Tg UTSW 15 66693435 missense probably damaging 1.00
R5624:Tg UTSW 15 66838057 missense probably benign 0.11
R5686:Tg UTSW 15 66688889 missense probably benign 0.28
R6042:Tg UTSW 15 66683993 missense probably benign 0.01
R6122:Tg UTSW 15 66828457 missense probably damaging 1.00
R6146:Tg UTSW 15 66673367 splice site probably null
R6159:Tg UTSW 15 66735247 missense possibly damaging 0.71
R6223:Tg UTSW 15 66707922 missense probably benign 0.15
R6480:Tg UTSW 15 66671311 missense probably damaging 1.00
R6505:Tg UTSW 15 66759558 missense probably damaging 0.99
R6531:Tg UTSW 15 66839362 missense probably damaging 0.99
R6614:Tg UTSW 15 66735259 missense probably damaging 0.99
R6698:Tg UTSW 15 66839362 missense probably damaging 1.00
R6798:Tg UTSW 15 66678839 missense probably damaging 1.00
R6837:Tg UTSW 15 66696135 missense probably damaging 1.00
R6861:Tg UTSW 15 66688891 missense probably benign 0.00
R6888:Tg UTSW 15 66696246 missense probably damaging 0.99
R6933:Tg UTSW 15 66764309 missense possibly damaging 0.73
R6983:Tg UTSW 15 66693358 missense probably benign 0.01
T0975:Tg UTSW 15 66688863 missense probably benign 0.01
X0005:Tg UTSW 15 66688863 missense probably benign 0.01
X0065:Tg UTSW 15 66682454 missense probably damaging 1.00
X0067:Tg UTSW 15 66748743 missense probably benign 0.10
Mode of Inheritance Autosomal Recessive
Local Stock
Repository
Last Updated 2018-01-15 8:28 PM by Diantha La Vine
Record Created 2016-01-26 1:58 PM
Record Posted 2016-09-19
Phenotypic Description

Figure 1. Ito mice exhibited reduced body weights compared to their wild-type littermates. Scaled weight data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The ito phenotype was identified among G3 mice of the pedigree R3904, some of which had reduced body weights compared to wild-type controls (Figure 1).

Nature of Mutation

Figure 2. Linkage mapping of the reduced body weight using a recessive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 38 mutations (X-axis) identified in the G1 male of pedigree R3904. Scaled weight data are shown for single locus linkage analysis with consideration of G2 dam identity. Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 38 mutations. The body weight phenotype was linked to a mutation in Tg: a C to T transition at base pair 66,766,162 (v38) on chromosome 15, or base pair 95,407 in the GenBank genomic region NC_000081 encoding Tg. Linkage was found with a recessive model of inheritance, wherein three variant homozygotes departed phenotypically from nine homozygous reference mice and nine heterozygous mice with a P value of 1.393 x 10-5 (Figure 2).

 

The mutation corresponds to residue 6,845 in the NM_009375 mRNA sequence in exon 39 of 48 total exons. 

 

6830 ACCCCCACACCTCCACAAATCAATGAAGACTGC

2270 -T--P--T--P--P--Q--I--N--E--D--C-

 

The mutated nucleotide is indicated in red. The mutation results in substitution of glutamine 2,275 to a premature stop codon (Q2275*) in the thyroglobulin protein.

Protein Prediction
Figure 3. The protein domains of TG. The TG protein has a signal peptide (amino acids 1-20), 11 type 1, three type 2, three type 3a, and two type 3b Cys-rich repeats followed by an acetylcholinesterase (AChE)-like domain. Tg can be divided into distinct regions: region I containing 10 type 1 repeats along with linker and hinge segments; region II-III contains the type 2 repeats, the type 1 repeat, and the type 3 repeats; and the AchE-like domain. The location of the ito mutation is indicated. Other mutations found in TG are noted in red. This image is interactive. Click on the mutations for more specific information.

Tg encodes thyroglobulin (Tg), a precursor of two thyroid hormones: 3,5,3’ triiodothyronine (T3) and 3,5,3’,5’ tetraiodothyronine (thyroxine; T4). The Tg protein has a signal peptide (amino acids 1-20), 11 type 1, three type 2, three type 3a, and two type 3b Cys-rich repeats followed by an acetylcholinesterase (AChE)-like domain (Figure 3) (1-3). Tg can be divided into distinct regions: region I containing 10 type 1 repeats between amino acids 32 and 1,211 along with linker and hinge segments; region II-III contains the type 2 repeats, the type 1 repeat at amino acids 1,510-1,564, and the type 3 repeats; and the AchE-like domain (amino acids 2,181-2,717) (4).

 

Each of the type 1 repeats are approximately 50 amino acids in length and have a structural motif that may bind and reversibly inhibit proteases in the lysosomal pathway (5). Type 1 domains are found in several other proteins including testicans, secreted modular calcium-binding proteins (SMOCs), the MHC class II-associated p41 invariant chain, and insulin-like growth factor binding proteins (IGFBP-1, -2, -3, -4, -5, and -6) (6). The type 2 domains are 14-17 amino acids in length and are between amino acids 1,455 and 1,502. The type 2 repeats are distant members of the GRIP and coiled-coil domain-containing protein 2 (GCC2)/GCC3 domain superfamily, which includes SVEP1 (alternatively, polydom) (7). The GCC2/GCC3 domains may assist in trafficking Tg. The type 3 domains vary between 57-160 amino acids in length and reside between amino acids 1,602 and 2,183.

 

The AChE-like domain mediates protein dimerization and the export of Tg by acting as an intramolecular chaperone (2;7;8). Six cysteines in the AChE-like domain are involved in the formation of interchain disulfide bonds (2;3). Megalin, a regulator of Tg transepithelial transport from the apical to basolateral surface of the thyrocyte, interacts with a heparin-binding region (SRRLKRP) in the C-terminus of Tg (9;10); the megalin-interacting domain is not in human Tg.

 

Tg is a 660 kDa homodimeric protein. Dimerization occurs in the endoplasmic reticulum, and is required for conformational maturation and intracellular transport of Tg to the lumen of thyroid follicles (8). Within the secretory system, Tg undergoes several posttranslational modifications including glycosylation, sialylation, sulfation, phosphorylation, iodination, and formation of approximately 60 intrachain disulfide binds per monomer. Upon reaching the follicular lumen, several tyrosines are iodinated. Several of the iodinated tyrosines are coupled to form T3 and T4. The release of thyroid hormone occurs after several steps including intra-and extracellular proteolytic degradation of Tg by several proteases including cysteine cathepsins B, L, and K and the aspartic protease cathepsin D (see the Background section for more details) (11;12).

 

An alternative transcript (designated kTg) has been identified in the mouse kidney (13). The kTg transcript transcription start site is within intron 41 of Tg and continues in-frame with the remaining thyroid-derived Tg beginning with exon 42. The encoded kTg protein is 367 amino acids in length, with a unique 13 amino acid signal peptide sequence at the N-terminus followed by a 354 amino acid sequence corresponding to the C-terminus of thyroid Tg.

 

The ito mutation results in substitution of glutamine 2,275 to a premature stop codon (Q2275*). Amino acid 2,275 is within the AChE-like domain.

Expression/Localization

Tg synthesis is restricted to the thyroid gland. Tg is secreted and stored in the colloid inside of the thyroid follicles. Newly secreted Tg remains near the apical membrane of thyroid cells, where it undergoes hormone formation and is internalized and/or degraded rapidly. Tg in the center of the follicle is stored in the form of aggregates to function as an iodine and hormone reservoir.

Background
Figure 4. The steps of thyroid hormone synthesis. Initial Tg synthesis occurs in the endoplasmic reticulum. After relesase into secretory vesicles, thyroid pyroxidase, TPO, and iodine coverts Tg to MIT and DIT within the colloid. Uptake in the cell is followed by proteolysis, converting the MID and DIT to T3 and T4, respectively. The T3 and T4 diffuse into the capillaries. See the text for more details.

Within the thyroid gland, epithelial cells synthesize thyroid hormones and are arranged as thyroid follicles. Between the thyroid follicles are parafollicular (alternatively, C cells), which secrete the hormone calcitonin. Tg is secreted by the thyroid cell into the follicular lumen by regulated (nonconstitutive), merocrine secretion (14;15). Upon stimulation by thyroid-stimulating hormone (TSH), Tg is reabsorbed by endocytosis/pinocytosis or phagocytosis (rodents only) to form endocytic/pinocytic vesicles or phagosomes, respectively (16;17). Thyroid hormone synthesis is regulated by the hypothalamic-pituitary-thyroid axis (HPT) negative feedback system, which involves interactions between the thyroid gland and circulating hormones. In the HPT, thyroid hormone synthesis is induced by TSH, which is secreted from anterior pituitary endocrine cells called thyrotropes. Increased thyroid hormone levels suppress further TSH secretion by acting on the hypothalamus, subsequently inhibiting the release of TSH-releasing hormone (TRH). TSH binding to the TSHR at the basal membrane of the thyroid follicle stimulates Tg expression via an increase in the intracellular level of cyclic adenosine monophosphate (cAMP) as well as the stimulation of thyroid peroxidase (TPO) and the sodium/iodide symporter (NIS) (18). After synthesis, Tg is transported to the apical membrane whereby it is released into the follicular lumen. At the apical membrane TPO and H2O2 catalyze the iodination of tyrosine residues on Tg to produce mono- (MIT) and di-iodotyrosines (DIT). Subsequent coupling of MIT and DIT catalyzes the production of T3 and T4. The iodinated Tg is pinocytosed through the apical membrane and into lysosomes where it undergoes proteolysis to release T3 and T4 through the basal membrane into the blood for action at peripheral target tissues whereby they control metabolism (19).

 

In rat thyroid FRTL-5 cells, Tg (at physiologic concentrations) suppresses the mRNA expression levels of several genes involved in TH synthesis, including Tg, Tpo, and Slc5a5 (NIS) (20-22). Tg is proposed to regulate cell growth and gene transcription by mimicking transforming growth factor (TGF)-β in certain cell types (23;24). Tg binds several proteins on the surface of thyroid cells (e.g., asialoglycoprotein receptor (ASGPR; (25)), megalin (gp300; (26)), and an N-acetylglucosamine receptor (27)), but none are significantly associated with intracellular signaling. These Tg-binding proteins are not specific to Tg, and are able to bind other large glycoproteins.

 

Mutations in TG have been linked to congenital goiter with hypothyroidism (euthyroidism) (OMIM: #274700) (28-30) as well as endemic and euthyroid nonendemic simple goiter (31-33). Most known pathogenic Tg mutations occur within region I and the AChE-like domain (18). Congenital hypothyroidism is the most frequent endocrine disease in infants with a prevalence of 1:2000-1:4000 in newborns (34;35). Congenital hypothyroidism is an autosomal recessive trait and is characterized by increased levels of TSH due to reduced thyroid function. Congenital hypothyroidism patients that are left untreated can exhibit abnormal growth and development as well as mental retardation. Early treatment with L-thyroxine results in normal development. Simple goiter is an enlargement of the thyroid gland that is not caused by an inflammatory or neoplastic process. TG is also a susceptibility gene for familial autoimmune thyroid disease (AITD) (36). Tg is an autoantigen in immune diseases of the thyroid [(21;22); reviewed in (13)]. The 8q24 locus, which contains TG, is linked to autoimmune thyroid disease (AITD) including Graves’ disease and Hashimoto’s thyroiditis. TG is an AITD susceptibility gene in both humans and mice (37) (OMIM: #608175). Graves’ disease is characterized by the production of TSHR-stimulating antibodies subsequently leading to hyperthyroidism. Hashimoto’s is characterized by apoptosis of thyrocytes leading to hypothyroidism. Both Graves’ and Hashimoto’s share many features including T cell infiltration of the thyroid and antithyroid autoantibody (anti-Tg and -TPO antibodies) production.

Putative Mechanism

The cog/cog (Tgcog; MGI:1856829) mouse model has a point mutation in Tg that causes a Leu to Pro substitution at amino acid 2,263 (38;39). The cog/cog mouse exhibits congenital hypothyroidism with goiter as well as abnormal growth, mild anemia, and defects in central nervous system development (e.g., microcephalic cerebrum with hypomyelination) (40;41)Tg expression is normal in the cog/cog mice, but the Tg protein exhibits increased proteolysis (42;43). Furthermore, the Tgcog/cog protein exhibited abnormal folding, dimerization, and export. The cog/cog mouse also had increased levels of several ER molecular chaperones. Taken together, the phenotypes of the cog/cog mouse are indicative of an ER storage defect (15). As a result, the levels of total serum T4 and T3 are low with a concomitant increase in serum TSH levels (41). A second mouse model has an ENU-induced mutation in Tg (TgR1471X; MGI:5694939). The TgR1471X mice exhibited stunted growth (44). The ito phenotype is similar to that of these two mouse models indicating that Tg function is impaired. Expression and localization of Tgito has not been examined.

Primers PCR Primer
ito(F):5'- GCCATAGACATGCTGCTACTC -3'
ito(R):5'- ACAAAGGGAGCTCAGTGTCC -3'

Sequencing Primer
ito_seq(F):5'- AATGACCTGGAGCTTCCTCAGTG -3'
ito_seq(R):5'- CAGTGTCCCTAAGGATAATACTGTGG -3'
References
  20. Sellitti, D. F., and Suzuki, K. (2014) Intrinsic Regulation of Thyroid Function by Thyroglobulin. Thyroid. 24, 625-638.
Science Writers Anne Murray
Illustrators Peter Jurek
AuthorsEmre Turer and Bruce Beutler
List |< first << previous [record 82 of 132] next >> last >|