Phenotypic Mutation 'sparse'

• Allele: sparse
• Mutation Type: critical splice donor site
• Chromosome: 8
• Coordinate: 112,082,030 bp (GRCm39)
• Base Change: A ⇒ G (forward strand)
• Gene: Fa2h
• Gene Name: fatty acid 2-hydroxylase
• Synonym(s): G630055L08Rik, Faxdc1
• Chromosomal Location: 112,071,770-112,120,453 bp (-) (GRCm39)
• MGI Phenotype: FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that catalyzes the synthesis of 2-hydroxysphingolipids, a subset of sphingolipids that contain 2-hydroxy fatty acids. Sphingolipids play roles in many cellular processes and their structural diversity arises from modification of the hydrophobic ceramide moiety, such as by 2-hydroxylation of the N-acyl chain, and the existence of many different head groups. Mutations in this gene have been associated with leukodystrophy dysmyelinating with spastic paraparesis with or without dystonia.[provided by RefSeq, Mar 2010] ; PHENOTYPE: Homozygotes for a null allele show demyelination, axonal loss, and cerebellar dysfunction. Homozygotes for a different null allele show late onset axon and myelin sheath degeneration, delayed fur emergence, altered sebum composition, sebocyte hyperproliferation, and cyclic alopecia. [provided by MGI curators]
• Mapped: Yes
• Institutional Source: Beutler Lab
• Gene Model: predicted gene model for protein(s): [ENSMUSP00000043597 ^†] † probably from a misspliced transcript
• AlphaFold: Q5MPP0
• SMART Domains: Protein: ENSMUSP00000043597; Gene: ENSMUSG00000033579

Domain	Start	End	E-Value	Type
low complexity region	2	9	N/A	INTRINSIC
Cyt-b5	11	86	2.85e-15	SMART
low complexity region	115	126	N/A	INTRINSIC
transmembrane domain	169	191	N/A	INTRINSIC
Pfam:FA_hydroxylase	219	361	4.4e-21	PFAM

• Predicted Effect: probably null
• Meta Mutation Damage Score: 0.9584
• Is this an essential gene?: Possibly nonessential (E-score: 0.331)
• Phenotypic Category: Autosomal Recessive
• Penetrance: 2/2
• Mode of Inheritance: Autosomal Recessive
• Local Stock: Live Mice, gDNA
• Last Updated: 2019-09-04 9:43 PM by Anne Murray
• Record Created: 2016-02-02 12:23 PM by Jeff SoRelle
• Record Posted: 2018-09-19
• Science Writers: Anne Murray
• Illustrators: Diantha La Vine
• Authors: Jeff SoRelle and Bruce Beutler

Accession Number

NCBI RefSeq: NM_178086; MGI:2443327

Alleles Listed at MGI

All Mutations and Alleles(8) : Targeted(8)

Phenotypic Description

Figure 1. The sparse mice exhibit alopecia. Two sparse mice are shown (left and middle) along with a wild type littermate (right) for reference.

The sparse phenotype was identified among G3 mice of the pedigree R3803, some of which showed hair loss from the trunk (Figure 1).

The 2 index mice were identified among G3 mice to have alopecia (photo pending). The hair was present on all the body but less densely on the torso. This visible phenotype was consistent with what was described previously in the literature: Maier H, et al. Normal fur development and sebum production depends on fatty acid 2-hydroxylase expression in sebaceous glands. J Biol Chem. 2011 286 (29): 25922-34. While other null mutations had neurologic phenotypes described (Zoller et al 2008), these defects were not seen; this is likely becuse the myelin sheath degradation was seen at 18 month old mice.

Pictures from the Maier et al report are consistent with what we observed. However, we have not observed the mice long enough to observe the cyclic hair loss phenotype described.

Nature of Mutation

Figure 2. Linkage mapping of the alopecia phenotype using a recessive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 76 mutations (X-axis) identified in the G1 male of pedigree R3803. Binary phenotype data are shown for single locus linkage analysis with consideration of G2 dam identity. Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 76 mutations. The alopecia phenotype was linked to a mutation in Fa2h: a T to C transition at base pair 111,355,398 (v38) on chromosome 8, or base pair 38,424 in the GenBank genomic region NC_000074 encoding the Fa2h gene, within the donor splice site of intron 4. Linkage was found with a recessive model of inheritance (P = 2.73 x 10^-4), wherein two affected mice were homozygous for the variant allele, and 46 unaffected mice were either heterozygous (N = 28) or homozygous for the reference allele (N = 18) (Figure 2).

The effect of the mutation at the cDNA and protein level have not examined, but the mutation is predicted to result in skipping of the 107-base pair exon 4 (out of 7 total exons), resulting in a frame-shift after amino acid 168 of the encoded protein, and premature termination after the inclusion of 0 aberrant amino acids.

C57BL/6J: <--exon 3         <--exon 4 intron 4-->            exon 5--> 37731 ……TCCAAGACTGTCTG ……GCATCACTCACAAGAG gtaataccacaacgggcttc…… AGTATTCAATGATG…… 44459 165   ……-S--K--T--V--W ……-A--S--L--T--R--                        E--Y--S--M--M-…… 209                                       correct sparse:              <--exon 3 37731 ……TCCAAGACTGTCTG 165   ……-S--K--T--V--*           aberrant

 

The donor splice site of intron 4, which is destroyed by the sparse mutation, is indicated in blue lettering and the mutated nucleotide is indicated in red. 

Protein Prediction

Figure 3. Domain organization of FA2H. The location of the sparse mutation is indicated. Domain information is from SMART and UniProt. See the text for more details. Abbreviations: Cyt-b5, cytochrome b 5 domain; TM, transmembrane domain

Fa2h encodes fatty acid 2-hydroxylase (FA2H), an integral membrane protein with an N-terminal cytoplasmic cytochrome b₅ domain and a C-terminal catalytic domain (Figure 3) (1). The cytochrome b₅ domain contains a conserved heme-binding domain (His-Pro-Gly-Gly) (1).The cytochrome b₅ domain is required for optimal FA2H activity, and is proposed to provide electrons to the catalytic di-iron (1). The FA2H catalytic domain has four putative transmembrane domains; the C-terminal tail is cytoplasmic. The catalytic site of FA2H has a histidine motif between transmembrane domains 2 and 3 that is similar to other membrane-bound monoxygenases: HX_(3–4)H X_(7–41) HX_(2–3)HH X_(61–189) (H/Q)X_(2–3)HH] [(1); reviewed in (2)]. The histidine residues in the motif are proposed to coordinate the non-heme di-iron cluster at the active site (1). In FA2H, histidines 234, 239, 257, 260, 261, 336, 339, and 340 are predicted to coordinate the binding of di-iron.

The sparse mutation is predicted to result in skipping of the 107-base pair exon 4 (out of 7 total exons), resulting in a frame-shift after amino acid 168 of the encoded protein, and premature termination after the inclusion of 0 aberrant amino acids. Exon 4 encodes the first transmembrane domain.

Expression/Localization

FA2H expression is high in the sebaceous glands of the skin and is upregulated in human keratinocyte differentiation (3-5). FA2H is also highly expressed in the brain and colon (1). FA2H is expressed in myelinating cells of the nervous system, and is upregulated during brain development (6). FA2H is expressed at lower levels in the testis, prostate, pancreas, and kidney (1).

FA2H is localized to the endoplasmic reticulum (1;3).

Background

Figure 4. Biosynthesis of hFA-sphingolipids. FA2H is a NAD(P)H-dependent monooxygenase that coverts fatty acid to hFA. See the text for more details about this pathway. Abbreviations: DHC, dihydroceramide; CerS, dihydroceramide synthase; Cer, ceramide; SMS, sphingomyelin synthase; CGT, UDP-galactose: ceramide galactosyltransferase; GCS, UDP-glucose:ceramide glucosyltransferase; GSL, glycosphingolipids. Figure and legend adapted from Hama (2010) .

2-hydroxy fatty acids (hFA) are components of a subset of mammalian sphingolipids. Sphingolipids are eukaryotic membrane lipids with many distinct headgroups attached to different ceramides. The alkyl chain length, hydryoxylation, desaturation of the sphingoid base, and the N-acyl chain of ceramide can vary (7). hFA-sphingolipids are localized in many mammalian tissues and tumors, but are highly enriched in the nervous system (8), skin (9), testis (10), and to a smaller amount in the spleen, kidney, lung, and plasma (11).

FA2H is a NAD(P)H-dependent monooxygenase that coverts fatty acid to hFA, which can then be incorporated in the hFA-ceramide and complex hFA-sphingolipids [Figure 4; reviewed in (2)]. A second fatty acid 2-hydroxylase encoded by the Phyh (phytanoyl-CoA hydroxylase) gene is an α-ketoglutarate-dependent monooxygenase. The main function of PHYH is the degradation of branched-chain fatty acids and catalyzing 2-hydroxylation of straight-chain acyl-CoA in vitro (12;13). At least one other 2-hydroxylase exists (14), but the identity of the enzyme is unknown and the substrate for the 2-hydroxylation has not been determined.

After 2-hydroxylation, hFAs are activated to CoA ester by acyl-CoA sythetases. Next, the 2-hydroxy acyl group is transferred to the primary amine of dihydrosphingosine by dihydroceramide synthase (CerS), which synthesizes hFA-dihydroceramide (4). Dihydroceramide desaturases converts the hFA-dihydroceramide to hFA-ceramide, a common precursor of all complex hFA-sphingolipids. Ceramide is converted to sphingomyelin (SM), glucosylceramide (GlcCer), and GalCer, by the addition of phosphocholine, glucose, or galactose, respectively, at the C-1 hydroxyl group of ceramide.

Nervous system/myelin

Myelin is a lipid-rich membrane that wraps around oligodendrocytes and Schwann cells, facilitating nerve conduction and protecting the axon from damage. Galactosylceramide (GalCer) and sulfatide constitute approximately 30% of total myelin lipids; approximately half of these galactolipids contain hFAs as their N-acyl chains [reviewed in (2)]. hFAs are essential for the onset of myelination. In the absence of hFA-galactolipids, myelin is unstable and begins to disintegrate before the completion of myelination. Myelin-forming cells exclusively depend on FA2H for the production of 2′-hydroxy GalCer (15;16).

Mutations in FA2H are linked to leukodystrophy (15) and autosomal recessive spastic paraplegia 35 [SPG35; OMIM: #612319; (15;17). Patients with SPG35 exhibit normal early development, but by 4 to 6 years of age display gait disturbance. Some patients only exhibited gait disturbance with no cognitive or speech impairment. In other patients, SPG35 progressed rapidly so that the patients required walking aids by 7 years of age and exhibited spasticity in the upper limbs as well as dystonia in the trunk, limbs, and face, upper-motor neuron deficits, reduced cognitive abilities, and cerebellar dysfunction [reviewed in (2)]. The patients exhibited progressive white matter degeneration. The development of the progressive spasticity results in the eventual loss in the ability to move and communicate, and eventually leading to the death of the patient. Mutations in FA2H are also linked to neurodegeneration with brain iron accumulation (NBIA) in humans (18-20). In NBIA, patients also exhibit variable phenotypes varying from infantile neurodegeneration and death in childhood to adult-onset parkinsonism-dystonia. Mutations in FA2H were identified in two siblings who shared autism symptoms and cognitive impairment, but FA2H is not predicted to have a major role in autism spectrum disorders (21).

Fa2h knockout (Fa2h^-/-) mice were overtly normal, but did not have 2′-hydroxy GalCer in the brain and peripheral nerves (6). The levels of nonhydroxy fatty acid-GalCer was upregulated, but the levels did not compensate for the loss of 2′-hydroxy GalCer (6). Oligodendrocyte differentiation was normal in the Fa2h^-/- mice (6). The myelin in the Fa2h^-/- mice was morphologically and functionally similar to the myelin in wild-type mice. However, it was not stabile long-term, leading to demyelination (6;22). Fa2h^-/-  mice exhibited axonal degeneration and loss of myelin the central and peripheral nervous systems with age, indicating that hFA-sphinoglipids are dispensible for development myelination in mice, but are required for long-term stability of axons and myelin. The Fa2h^-/- mice also exhibited defects in spatial learning and memory. Oligodendroycte and Schwann cell-specific Fa2h knockout (Fa2h^flox/flox Cnp1-Cre) mice exhibited central nervous system demyelination and neuronal cell loss (22).

Adipocytes

Fa2h expression increased along with other genes involved in adipogenesis during hormone-induced differentiation of 3T3-L1 adipocytes (23). Knockdown of Fa2h expression resulted in reduced expression of adipocyte markers and blockade of triacylglycerol accumulation. Fa2h knockdown in mature adipocytes resulted in inhibition of basal and insulin-stimulated glucose uptake and lipogenesis partly due to increased mobility of raft-associated lipids in the plasma membrane.

Putative Mechanism

Figure 5. FA2H generates the precursor hFA for the synthesis of epidermal hFA-ceramides. hFA-ceramides, cholesterol, and free fatty acids are essential in maintaining the permeability barrier of the skin. The cornified envelope consists of covalently crosslinked proteins (10 nm thick) and an outer coating of covalently linked lipids (5 nm thick), and endows the skin with impermeability to many substances including, importantly, water. Tgm1- and Tgm5-mediated crosslinking of envoplakin and periplakin beneath the plasma membrane likely initiates cornified envelope formation in the spinous layer.  Involucrin is also deposited to form a scaffold early in cornified envelope development. Tgm3 first crosslinks loricrin and small proline-rich proteins (SPRs) together to form small interchain oligomers, which are then permanently crosslinked to the developing cornified envelope by Tgm1. In the cornified layer, extruded long-chain ω-hydoxyceramides are crosslinked to involucrin by Tgm1, and to other previously crosslinked proteins such as envoplakin and periplakin. This image is interactive; click on the other mutation (Tgm3) to view more information.

The epidermis is comprised of several layers, with the outermost layer being the stratum corneum layer (Figure 5). The epidermis, and particularly the stratum corneum layer constitute a defensive barrier against water loss, xenobiotics, and harmful pathogens. Corneocytes are embedded in an extracellular lipid matrix of hydrophobic lipids. Approximately half of the lipids in the stratum corneum layer of the epidermis are mixtures of ceramides; 40% of these lipids contain hFAs (24). hFA-ceramides, cholesterol, and free fatty acids are essential in maintaining the permeability barrier of the skin (25). FA2H generates the precursor hFA for the synthesis of epidermal hFA-ceramides (26). Silencing of F2AH in cultured human keratinocytes resulted in defects in the formation of the extracellular lipid matrix with a concomitant reduction in the formation and secretion of lamellar bodies (26). In addition, extracellular lipid layers were not formed. FA2H deficiency in both mouse and humans does not result in obvious skin permeability barrier dysfunction due to a proposed second fatty acid 2-hydroxylase that promotes differentiation and formation of a functional stratum corneum.

FA2H expression in the sebaceous gland is required for normal fur development and sebum production in the mouse (5). Fa2h^-/- mice showed hyperproliferation of sebocytes and enlarged sebaceous glands during hair follicle morphogenesis and the anagen phase in adult mice (5). However, FA2H deficiency in humans does not result in obvious skin abnormalities, indicating that a second epidermal enzyme in humans (e.g., PHYH) could compensate for loss of FA2H expression and function in fatty acid 2-hydroxylation.

The phenotype of the sparse mice indicates loss of FA2H-associated function in the skin. Overt neurological phenotypes were not observed in the sparse mice, but myelination was not examined.

Primers

PCR Primer
sparse_pcr_F: TGTGCACCACCACCATTTTG
sparse_pcr_R: AGTTAAAACGTATGCTTCAGGGCAG

Sequencing Primer
sparse_seq_F: TAGTTTCTGCTCATATGATGCTCG
sparse_seq_R: TTCAGGGCAGCTGGATCATGAC

Genotyping

PCR program

1) 94°C 2:00
2) 94°C 0:30
3) 55°C 0:30
4) 72°C 1:00
5) repeat steps (2-4) 40x
6) 72°C 10:00
7) 4°C hold

The following sequence of 403 nucleotides is amplified (chromosome 8, - strand):

1   agttaaaacg tatgcttcag ggcagctgga tcatgacgtc tcccctcccc tctctgtgta
61  tatctctctc accccgatgg ccctcctgca ggtatagtgt ccccatcatc tgggtgcccc
121 tggtgctgta cctcagctgg tcctactacc gaaccctcac ccaggacaac atccggctct
181 tcgcatcact cacaagaggt aataccacaa cgggcttctc cctaacttgt ttccatgggt
241 gttgaaggca ggaaactgtg ttgagtttct atgggcatag aaaaccacat cacaaacgct
301 tcaaagtaca gcccagcaca gagaagagtc atcctcccaa acccgtggat acaaaaacga
361 gcatcatatg agcagaaact aaacaaaatg gtggtggtgc aca

Primer binding sites are underlined and the sequencing primers are highlighted; the mutated nucleotide is shown in red.

References

  1. Alderson, N. L., Rembiesa, B. M., Walla, M. D., Bielawska, A., Bielawski, J., and Hama, H. (2004) The Human FA2H Gene Encodes a Fatty Acid 2-Hydroxylase. J Biol Chem. 279, 48562-48568.

  2. Hama, H. (2010) Fatty Acid 2-Hydroxylation in Mammalian Sphingolipid Biology. Biochim Biophys Acta. 1801, 405-414.

  3. Eckhardt, M., Yaghootfam, A., Fewou, S. N., Zoller, I., and Gieselmann, V. (2005) A Mammalian Fatty Acid Hydroxylase Responsible for the Formation of Alpha-Hydroxylated Galactosylceramide in Myelin. Biochem J. 388, 245-254.

  4. Mizutani, Y., Kihara, A., Chiba, H., Tojo, H., and Igarashi, Y. (2008) 2-Hydroxy-Ceramide Synthesis by Ceramide Synthase Family: Enzymatic Basis for the Preference of FA Chain Length. J Lipid Res. 49, 2356-2364.

  5. Maier, H., Meixner, M., Hartmann, D., Sandhoff, R., Wang-Eckhardt, L., Zoller, I., Gieselmann, V., and Eckhardt, M. (2011) Normal Fur Development and Sebum Production Depends on Fatty Acid 2-Hydroxylase Expression in Sebaceous Glands. J Biol Chem. 286, 25922-25934.

  6. Zoller, I., Meixner, M., Hartmann, D., Bussow, H., Meyer, R., Gieselmann, V., and Eckhardt, M. (2008) Absence of 2-Hydroxylated Sphingolipids is Compatible with Normal Neural Development but Causes Late-Onset Axon and Myelin Sheath Degeneration. J Neurosci. 28, 9741-9754.

  7. Pruett, S. T., Bushnev, A., Hagedorn, K., Adiga, M., Haynes, C. A., Sullards, M. C., Liotta, D. C., and Merrill, A. H.,Jr. (2008) Biodiversity of Sphingoid Bases ("Sphingosines") and Related Amino Alcohols. J Lipid Res. 49, 1621-1639.

  8. DeVries, G. H., and Norton, W. T. (1974) The Fatty Acid Composition of Sphingolipids from Bovine CNS Axons and Myelin. J Neurochem. 22, 251-257.

  9. Wertz, P. W., Swartzendruber, D. C., Madison, K. C., and Downing, D. T. (1987) Composition and Morphology of Epidermal Cyst Lipids. J Invest Dermatol. 89, 419-425.

  10. Sandhoff, R., Geyer, R., Jennemann, R., Paret, C., Kiss, E., Yamashita, T., Gorgas, K., Sijmonsma, T. P., Iwamori, M., Finaz, C., Proia, R. L., Wiegandt, H., and Grone, H. J. (2005) Novel Class of Glycosphingolipids Involved in Male Fertility. J Biol Chem. 280, 27310-27318.

  11. KISHIMOTO, Y., and RADIN, N. S. (1963) Occurrence of 2-Hydroxy Fatty Acids in Animal Tissues. J Lipid Res. 4, 139-143.

  12. Searls, T., Butler, D., Chien, W., Mukherji, M., Lloyd, M. D., and Schofield, C. J. (2005) Studies on the Specificity of Unprocessed and Mature Forms of Phytanoyl-CoA 2-Hydroxylase and Mutation of the Iron Binding Ligands. J Lipid Res. 46, 1660-1667.

  13. Mukherji, M., Kershaw, N. J., Schofield, C. J., Wierzbicki, A. S., and Lloyd, M. D. (2002) Utilization of Sterol Carrier Protein-2 by Phytanoyl-CoA 2-Hydroxylase in the Peroxisomal Alpha Oxidation of Phytanic Acid. Chem Biol. 9, 597-605.

  14. Dan, P., Edvardson, S., Bielawski, J., Hama, H., and Saada, A. (2011) 2-Hydroxylated Sphingomyelin Profiles in Cells from Patients with Mutated Fatty Acid 2-Hydroxylase. Lipids Health Dis. 10, 84-511X-10-84.

  15. Edvardson, S., Hama, H., Shaag, A., Gomori, J. M., Berger, I., Soffer, D., Korman, S. H., Taustein, I., Saada, A., and Elpeleg, O. (2008) Mutations in the Fatty Acid 2-Hydroxylase Gene are Associated with Leukodystrophy with Spastic Paraparesis and Dystonia. Am J Hum Genet. 83, 643-648.

  16. Maldonado, E. N., Alderson, N. L., Monje, P. V., Wood, P. M., and Hama, H. (2008) FA2H is Responsible for the Formation of 2-Hydroxy Galactolipids in Peripheral Nervous System Myelin. J Lipid Res. 49, 153-161.

  17. Dick, K. J., Eckhardt, M., Paisan-Ruiz, C., Alshehhi, A. A., Proukakis, C., Sibtain, N. A., Maier, H., Sharifi, R., Patton, M. A., Bashir, W., Koul, R., Raeburn, S., Gieselmann, V., Houlden, H., and Crosby, A. H. (2010) Mutation of FA2H Underlies a Complicated Form of Hereditary Spastic Paraplegia (SPG35). Hum Mutat. 31, E1251-60.

  18. Kruer, M. C., Paisan-Ruiz, C., Boddaert, N., Yoon, M. Y., Hama, H., Gregory, A., Malandrini, A., Woltjer, R. L., Munnich, A., Gobin, S., Polster, B. J., Palmeri, S., Edvardson, S., Hardy, J., Houlden, H., and Hayflick, S. J. (2010) Defective FA2H Leads to a Novel Form of Neurodegeneration with Brain Iron Accumulation (NBIA). Ann Neurol. 68, 611-618.

  19. Pierson, T. M., Simeonov, D. R., Sincan, M., Adams, D. A., Markello, T., Golas, G., Fuentes-Fajardo, K., Hansen, N. F., Cherukuri, P. F., Cruz, P., Mullikin, J. C., Blackstone, C., Tifft, C., Boerkoel, C. F., Gahl, W. A., and NISC Comparative Sequencing Program. (2012) Exome Sequencing and SNP Analysis Detect Novel Compound Heterozygosity in Fatty Acid Hydroxylase-Associated Neurodegeneration. Eur J Hum Genet. 20, 476-479.

  20. Rupps, R., Hukin, J., Balicki, M., Mercimek-Mahmutoglu, S., Rolfs, A., and Dias, C. (2013) Novel Mutations in FA2H-Associated Neurodegeneration: An Underrecognized Condition? J Child Neurol. 28, 1500-1504.

  21. Scheid, I., Maruani, A., Huguet, G., Leblond, C. S., Nygren, G., Anckarsater, H., Beggiato, A., Rastam, M., Amsellem, F., Gillberg, I. C., Elmaleh, M., Leboyer, M., Gillberg, C., Betancur, C., Coleman, M., Hama, H., Cook, E. H., Bourgeron, T., and Delorme, R. (2013) Heterozygous FA2H Mutations in Autism Spectrum Disorders. BMC Med Genet. 14, 124-2350-14-124.

  22. Potter, K. A., Kern, M. J., Fullbright, G., Bielawski, J., Scherer, S. S., Yum, S. W., Li, J. J., Cheng, H., Han, X., Venkata, J. K., Khan, P. A., Rohrer, B., and Hama, H. (2011) Central Nervous System Dysfunction in a Mouse Model of FA2H Deficiency. Glia. 59, 1009-1021.

  23. Guo, L., Zhou, D., Pryse, K. M., Okunade, A. L., and Su, X. (2010) Fatty Acid 2-Hydroxylase Mediates Diffusional Mobility of Raft-Associated Lipids, GLUT4 Level, and Lipogenesis in 3T3-L1 Adipocytes. J Biol Chem. 285, 25438-25447.

  24. Downing, D. T. (1992) Lipid and Protein Structures in the Permeability Barrier of Mammalian Epidermis. J Lipid Res. 33, 301-313.

  25. Holleran, W. M., Takagi, Y., and Uchida, Y. (2006) Epidermal Sphingolipids: Metabolism, Function, and Roles in Skin Disorders. FEBS Lett. 580, 5456-5466.

  26. Uchida, Y., Hama, H., Alderson, N. L., Douangpanya, S., Wang, Y., Crumrine, D. A., Elias, P. M., and Holleran, W. M. (2007) Fatty Acid 2-Hydroxylase, Encoded by FA2H, Accounts for Differentiation-Associated Increase in 2-OH Ceramides during Keratinocyte Differentiation. J Biol Chem. 282, 13211-13219.