Phenotypic Mutation 'Sun_island' (pdf version)
List |< first << previous [record 15 of 132] next >> last >|
AlleleSun_island
Mutation Type nonsense
Chromosome1
Coordinate133,012,651 bp (GRCm38)
Base Change A ⇒ T (forward strand)
Gene Mdm4
Gene Name transformed mouse 3T3 cell double minute 4
Synonym(s) 4933417N07Rik, Mdmx
Chromosomal Location 132,959,484-133,030,561 bp (-)
MGI Phenotype FUNCTION: This gene encodes a protein that has been shown to negatively regulate the activity of the tumor suppressor protein p53. Homozygous knockout mice exhibit embryonic lethality as a result of p53-dependent apoptosis and cell cycle arrest. Amplification of this gene or overexpression of the encoded protein has been linked to a range of human cancers. A pseudogene has been identified on the X chromosome. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Nov 2014]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit embryonic lethality, decreased cellular proliferation, and abnormal nervous system development. [provided by MGI curators]
Accession Number

NCBI RefSeq: NM_001302801 (variant 1), NM_001302802 (variant 2), NM_008575 (variant 3), NM_001302803 (variant 4), NM_001302804 (variant 5); MGI:107934

Mapped Yes 
Amino Acid Change Tyrosine changed to Stop codon
Institutional SourceBeutler Lab
Gene Model predicted gene model for protein(s): [ENSMUSP00000068661] [ENSMUSP00000070411] [ENSMUSP00000140090] [ENSMUSP00000140812] [ENSMUSP00000140609] [ENSMUSP00000140284] [ENSMUSP00000140006]
SMART Domains Protein: ENSMUSP00000068661
Gene: ENSMUSG00000054387
AA Change: F48I

DomainStartEndE-ValueType
Pfam:SWIB 26 96 3.7e-10 PFAM
low complexity region 281 295 N/A INTRINSIC
ZnF_RBZ 302 326 1.65e-2 SMART
RING 437 477 7.26e-1 SMART
Predicted Effect probably damaging

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
(Using ENSMUST00000067398)
SMART Domains Protein: ENSMUSP00000070411
Gene: ENSMUSG00000054387
AA Change: F47I

DomainStartEndE-ValueType
Pfam:SWIB 26 101 2.5e-17 PFAM
low complexity region 280 294 N/A INTRINSIC
ZnF_RBZ 301 325 1.65e-2 SMART
RING 436 476 7.26e-1 SMART
Predicted Effect probably damaging

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
(Using ENSMUST00000067429)
SMART Domains Protein: ENSMUSP00000140090
Gene: ENSMUSG00000054387
AA Change: F48I

DomainStartEndE-ValueType
Pfam:SWIB 27 102 1.8e-15 PFAM
Predicted Effect probably damaging

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
(Using ENSMUST00000185398)
SMART Domains Protein: ENSMUSP00000140812
Gene: ENSMUSG00000054387
AA Change: F47I

DomainStartEndE-ValueType
Pfam:SWIB 26 101 9.9e-15 PFAM
low complexity region 280 294 N/A INTRINSIC
Predicted Effect probably damaging

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
(Using ENSMUST00000186617)
SMART Domains Protein: ENSMUSP00000140609
Gene: ENSMUSG00000054387
AA Change: F47I

DomainStartEndE-ValueType
Pfam:SWIB 26 101 2.5e-17 PFAM
low complexity region 280 294 N/A INTRINSIC
ZnF_RBZ 301 325 1.65e-2 SMART
RING 436 476 7.26e-1 SMART
Predicted Effect probably damaging

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
(Using ENSMUST00000188090)
SMART Domains Protein: ENSMUSP00000140284
Gene: ENSMUSG00000054387
AA Change: F48I

DomainStartEndE-ValueType
Pfam:SWIB 27 102 9.2e-16 PFAM
Predicted Effect probably damaging

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
(Using ENSMUST00000190807)
SMART Domains Protein: ENSMUSP00000140006
Gene: ENSMUSG00000054387
AA Change: F48I

DomainStartEndE-ValueType
Pfam:SWIB 27 102 1.4e-15 PFAM
Predicted Effect probably damaging

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
(Using ENSMUST00000191212)
Phenotypic Category
Phenotypequestion? Literature verified References
FACS CD4:CD8 - increased
FACS CD4+ T cells in CD3+ T cells - increased
FACS CD8+ T cells - decreased
FACS CD8+ T cells in CD3+ T cells - decreased
post-MCMV FACS CD4:CD8 - increased
post-MCMV FACS CD4+ T cells in CD3+ T cells - increased
post-MCMV FACS CD8+ T cells in CD3+ T cells - decreased
Penetrance  
Alleles Listed at MGI

All Mutations and Alleles(331) : Chemically induced (other)(2) Gene trapped(313) Radiation induced(1) Targeted(11) Transgenic(4)

Lab Alleles
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01778:Mdm4 APN 1 132994547 missense probably benign 0.02
IGL03034:Mdm4 APN 1 133011071 missense probably damaging 1.00
IGL03099:Mdm4 APN 1 132992209 missense probably damaging 1.00
R0630:Mdm4 UTSW 1 132991753 missense possibly damaging 0.47
R1170:Mdm4 UTSW 1 132991820 missense probably damaging 1.00
R1170:Mdm4 UTSW 1 133012692 missense probably damaging 1.00
R1774:Mdm4 UTSW 1 132996646 missense probably damaging 0.99
R1920:Mdm4 UTSW 1 133003800 missense probably benign 0.06
R2061:Mdm4 UTSW 1 133012651 missense probably damaging 1.00
R2212:Mdm4 UTSW 1 132994522 missense probably damaging 1.00
R3695:Mdm4 UTSW 1 132991993 missense probably benign 0.00
R3919:Mdm4 UTSW 1 132994568 missense possibly damaging 0.94
R5273:Mdm4 UTSW 1 132994582 missense probably benign
R5360:Mdm4 UTSW 1 132991658 makesense probably null
R6125:Mdm4 UTSW 1 132994510 missense possibly damaging 0.95
R6153:Mdm4 UTSW 1 132992107 missense probably damaging 1.00
Z1088:Mdm4 UTSW 1 132994547 missense probably benign 0.02
Mode of Inheritance Autosomal Dominant
Local Stock
Repository
Last Updated 2018-10-25 12:06 PM by Anne Murray
Record Created 2016-02-17 8:12 PM by Ming Zeng
Record Posted 2018-09-07
Phenotypic Description

Figure 1. Sun_island mice exhibit increased CD4 to CD8 T cell ratios. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Raw data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 2. Sun_island mice exhibit increased frequencies of CD4+ T cells in CD3+ T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Raw data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 3. Sun_island mice exhibit reduced frequencies of CD8+ T cells in CD3+ T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Raw data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The Sun_island phenotype was identified among N-ethyl-N-nitrosourea (ENU)-mutagenized G3 mice of the pedigree R2061, some of which showed an increase in the CD4 to CD8 T cell ratio (Figure 1) due to increased frequencies of CD4+ T cells in CD3+ T cells (Figure 2) with concomitant reduced frequencies of CD8+ T cells in CD3+ T cells (Figure 3) in the peripheral blood.

Nature of Mutation

Figure 4. Linkage mapping of the increased CD4 to CD8 T cell ratio using a dominant model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 134 mutations (X-axis) identified in the G1 male of pedigree R2061. Normalized phenotype data are shown for single locus linkage analysis without consideration of G2 dam identity. Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Figure 5. CRISPR-Mdm4 knockout mice exhibit reduced frequencies of CD8+ T cells in CD3+ T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Raw data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 6. CRISPR-Mdm4 knockout mice exhibit increased CD4 to CD8 T cell ratios. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Raw data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 7. CRISPR-Mdm4 knockout mice exhibit increased frequencies of CD4+ T cells in CD3+ T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Raw data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Whole exome HiSeq sequencing of the G1 grandsire identified 134 mutations. All of the above anomalies were linked by continuous variable mapping to two mutations on chromosome 1: Lemd1 and Mdm4. The mutation in Mdm4 was presumed to be causative, and is a T to A transversion at base pair 133,012,651 (v38) on chromosome 1, or base pair 17,937 in the GenBank genomic region NC_000067 encoding Mdm4. The strongest association was found with a dominant/additive model of inheritance to the increased CD4 to CD8 T cell ratio, wherein eight heterozygous mice departed phenotypically from nine homozygous reference mice with a P value of 1.796 x 10-11 (Figure 4); no homozygous variant mice were observed in the R2061 pedigree.  

 

The mutation corresponds to residue 416 in the mRNA sequence NM_008575 within exon 4 of 12 total exons.

 

401 GCGCAGGGGGAAGTATTCACCATGAAAGAGGTA
42  -A--Q--G--E--V--F--T--M--K--E--V-

 

The mutated nucleotide is indicated in red. The mutation results in a phenylalanine to isoleucine substitution at amino acid 47 (F47I) in the MDM4 protein, and is strongly predicted by PolyPhen-2 to be damaging (score = 1.000).

 

The causative mutation for the T cell phenotypes was validated to be in Mdm4 by CRISPR-mediated knockout of Mdm4 (Figure 5, [CD8+ T cells in CD3+ T cells, 1.924 x 10-10]; Figure 6, [CD4:CD8, 8.7 x 10-5]; Figure 7, [CD4+ T cells in CD3+ T cells, 0.001758]).

Protein Prediction
Figure 8. Domain organization of MDM4. The sun_island mutation results in a phenylalanine to isoleucine substitution at amino acid 47 within the p53-binding domain. Abbreviations: p53 BD, p53 binding domain; WWW, WWW element; ZF, zinc finger

Mdm4 encodes mouse double minute-4 (MDM4; alternatively, MDMX or HDMX). MDM4 shares structural similarities with MDM2 (see the record for Xi-an), another member of the MDM family (1). MDM4 has a p53-binding (alternatively, SWIB/MDM2) domain, a WWW element, an acidic domain, a RANBP2-type zinc finger, a nuclear localization sequence, and a RING-type zinc finger (Figure 8) (1).

 

The p53-binding domain region of MDM4 mediates p53 and p73 binding (2-4). The WWW element is an auto-inhibitory sequence that has high binding affinity for the p53 transactivation domain (5). The MDM4 acidic and RANBP2-type zinc finger domains are putative binding sites for several regulatory proteins, including p300 (6), YY1 (7;8), ARF (alternatively, Cdkn2a [cyclin-dependent kinase inhibitor 2a]) (9;10), and PML [promyelocytic leukemia] (11). The acidic and RANBP2-type zinc finger domains also putatively interact with ribosomal proteins. The MDM4 RING-type zinc finger has a C2H2C4 structure and coordinates binding of two zincs. The RING-type zinc finger mediates interaction with MDM2 to reverse MDM2-associated p53 degradation. The interaction between MDM4 and MDM2 promotes the ubiquitin ligase activity of MDM2 by forming an interaction domain for the E2 ubiquitin-conjugating enzyme (12;13).

 

MDM4 is ubiquitinated by MDM2, resulting in MDM4 degradation and activation of p53 in response to cytotoxic stress (14;15). MDM4 is phosphorylated at Ser403 by Atm in response to DNA damage (14) and at serines 342 and 367 by CHEK1 (checkpoint kinase 1) and CHEK2 (16). CHEK-mediated phosphorylation promotes MDM2-mediated ubiquitination of MDM4 (17), inhibits deubiquitination by HAUSP (alternatively, USP7) ((18;19), and permits interaction with 14-3-3γ and subsequent ubiquitination and degradation (20). CK1α (casein kinase 1-α)-mediated phosphorylation of MDM4 at Ser289 is required for MDM4 interaction with p53 (21). MDM4 is also phosphorylated by c-Abl, which inhibits the MDM4-p53 interaction (22). AKT-mediated phosphorylation of Ser367 stabilizes MDM4 and promotes 14-3-3 binding (23). CDK1-mediated phosphorylation of MDM4 results in nuclear export of MDM4 (24).

 

The sun_island mutation results in a phenylalanine to isoleucine substitution at amino acid 47 (F47I); Phe47 is within the p53-binding domain.

Expression/Localization

MDM4 is highly expressed in the thymus and at lower levels in all other tissues tested (1).

 

MDM4 localizes to the cytoplasm. DNA damage promotes the phosphorylation of MDM4, promoting its nuclear localization. MDM4 can heterodimerize with MDM2, which allows for nuclear transport of MDM4 (25).

 

MDM4 is overexpressed in several human cancers, including retinoblastomas, testicular cancers, leukemias, and melanomas (26-29).

Background
Figure 9. MDM2 and MDM4 regulate p53. In nonstressed conditions, p53 levels remain low through its ubiquitination (Ub) by MDM2 and MDM4, both of which bind p53. Under stressed conditions, upstream signaling to p53 increases its levels and activities and the function of the MDM2-MDM4 complex is blocked. p53 then transactivates and represses a number of target genes that function in apoptosis, cell cycle, and DNA repair.

MDM2 and MDM4 regulate p53 in a non-overlapping manner (30). MDM2 ubiquitinates p53 and subsequently promotes the proteasome-mediated degradation of p53. MDM4 does not degrade p53, but inhibits p53 by binding to its transcriptional activation domain (1;31). MDM4 also stabilizes MDM2; the formation of a MDM2/MDM4 heterodimer causes increased stimulation of p53 ubiquitination, controlling p53 activity (12;32-36).

 

MDM4 interacts with several proteins in addition to p53. (i) MDM4 interacts with p21, an inhibitor of cyclin dependent kinases. MDM4 targets p21 for proteasomal degradation in an ubiquitin-independent manner at the G1 and early S phases of the cell cycle (37). MDM4-mediated p21 degradation results in abrogation of G1 cell cycle arrest (37). (ii) MDM4 represses E2F1 transactivation through an unclear mechanism (38;39). MDM4 putatively disrupts E2F1-DNA binding (38) or alters the localization of the E2F1 transcription complex (39). (iii) MDM4 stabilizes retinoblastoma (RB) protein by competing with MDM2 binding (40) as well as promotes RB degradation in a MDM2-dependent manner (41). (iv) After lethal DNA damage, MDM4 dissociates from MDM2. MDM4 then promotes the stabilization of HIPK2 (homeodomain-interacting protein kinase 2) and the phosphorylation of p53, subsequently leading to reduced transcription of p53/HIPK2 targets (42). (v) Increased levels of MDM4 inhibit DNA break repair in a p53- and MDM2-independent manner (43). MDM4 associates with NBS1 at chromatin after DNA damage, delaying the DNA damage signaling response. NBS1 is a component of the MRN [MRE11 (meiotic recombination 11)–Rad50–NBS1 (Nijmegen breakage syndrome 1)] complex. The MRN complex and the PIKKs ATM, ATM, Rad3-related (ATR), and DNA-PK (DNA-dependent protein kinase; see the record for clover) are involved in early DNA DSB-induced signaling. (vi) MDM4 binds and inhibits mTOR after nutrient deprivation in a p53-independent manner, resulting in impaired mTORC1 activity (44).

 

The rs1380576 C>G polymorphism in MDM4 was a protective factor for breast cancer in a southeast Iranian population sample (45). The rs1380576 C>G variant was also associated with reduced gastric cancer risk in an eastern Chinese population (46). The rs4245739 A>C polymorphism is a putative protective factor against cancer in Chinese (47) and Asian populations (48). The rs4245739 A>C polymorphism is associated with reduced risk of breast cancer (but not lung, colon, or prostate cancer) in Norway (49). The rs4245739 A>C polymorphism is also associated with increased risk of serous ovarian cancer, but not endometrial cancer (50).

 

Mdm4-deficient mice exhibit embryonic lethality between E9.5 and E12.5 (51-53). When the Mdm4-deficient mice were crossed to p53-deficient mice, the Mdm4-deficient embryonic lethality was rescued (53). The Mdm4-deficient embryos are reduced in size at E9.5 as well as exhibit improper neural tube closer, dilated lateral ventricle, telencephalon hypoplasia, and cell death in the developing central nervous system (51). Mice expressing a mutant Mdm4 (Ser341/367/402Ala) showed reduced mortality compared to wild-type mice, thymocyte apoptosis, moderate anemia, and moderate leucopenia after irradiation (54). Another mouse model expressing a mutant Mdm4 (Cys462Ala) exhibited embryonic lethality between E9.5 and E13.5; the embryos exhibited reduced sizes, abnormal heart development, reduced cell proliferation, and increased embryonic tissue apoptosis (36). Mice expressing a MDM4 with the RING-type zinc finger deleted (Mdm4delRING) showed embryonic lethality and increased p53 activity (35).

Putative Mechanism

The phenotype of the sun_island mice indicates loss of MDM4-associated function, putatively in its regulation of the mTORC1 signaling pathway. The mTOR-associated signaling pathway regulates cell growth, size, metabolism, and growth factor signaling by stimulating protein synthesis. When there are sufficient nutrients, mTOR signaling is active allowing for protein synthesis and an increase in cell size. In contrast, when nutrient levels decrease or in conditions of cell stress, protein synthesis is inhibited with a concomitant decrease in cell size and cell proliferation. When mTORC1 is activated upon raptor binding to mTOR, it phosphorylates several targets, including S6 kinase 1 (S6K1) and 4E-binding protein 1 (4E-BP1). mTOR signaling regulates the differentiation, activation, and function of several immune cell types including mast cells, neutrophils, natural killer cells, γδ T cells, macrophages, dendritic cells (DCs), T cells and B cells. For more information about the mTORC1 signaling pathway, please see the record for hamel.

Primers PCR Primer
Sun_island(F):5'- CCCAGGTCAATGAATCTGTGG -3'
Sun_island(R):5'- CACCTCCCCAGAAATCAATCTAATTG -3'

Sequencing Primer
Sun_island_seq(F):5'- GTCAATGAATCTGTGGATGACC -3'
Sun_island_seq(R):5'- TCAGGCCCTTTAGGTGAA -3'
References
Science Writers Anne Murray
Illustrators Diantha La Vine
AuthorsJin Huk Choi, Xue Zhong, Bruce Beutler
List |< first << previous [record 15 of 132] next >> last >|