Phenotypic Mutation 'Sun_island'

• Allele: Sun_island
• Mutation Type: missense
• Chromosome: 1
• Coordinate: 132,940,389 bp (GRCm39)
• Base Change: A ⇒ T (forward strand)
• Gene: Mdm4
• Gene Name: transformed mouse 3T3 cell double minute 4
• Synonym(s): Mdmx, 4933417N07Rik
• Chromosomal Location: 132,913,843-132,958,325 bp (-) (GRCm39)
• MGI Phenotype: FUNCTION: This gene encodes a protein that has been shown to negatively regulate the activity of the tumor suppressor protein p53. Homozygous knockout mice exhibit embryonic lethality as a result of p53-dependent apoptosis and cell cycle arrest. Amplification of this gene or overexpression of the encoded protein has been linked to a range of human cancers. A pseudogene has been identified on the X chromosome. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Nov 2014] ; PHENOTYPE: Mice homozygous for a gene trap allele exhibit embryonic lethality, decreased cellular proliferation, and abnormal nervous system development. [provided by MGI curators]
• Mapped: Yes
• Amino Acid Change: Phenylalanine changed to Isoleucine
• Institutional Source: Beutler Lab
• Gene Model: predicted gene model for protein(s): [ENSMUSP00000068661] [ENSMUSP00000070411] [ENSMUSP00000140090] [ENSMUSP00000140812] [ENSMUSP00000140609] [ENSMUSP00000140284] [ENSMUSP00000140006]
• AlphaFold: O35618
• SMART Domains: Protein: ENSMUSP00000068661; Gene: ENSMUSG00000054387; AA Change: F48I

Domain	Start	End	E-Value	Type
Pfam:SWIB	26	96	3.7e-10	PFAM
low complexity region	281	295	N/A	INTRINSIC
ZnF_RBZ	302	326	1.65e-2	SMART
RING	437	477	7.26e-1	SMART

• Predicted Effect: probably damaging ; PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
  (Using ENSMUST00000067398)
• SMART Domains: Protein: ENSMUSP00000070411; Gene: ENSMUSG00000054387; AA Change: F47I

Domain	Start	End	E-Value	Type
Pfam:SWIB	26	101	2.5e-17	PFAM
low complexity region	280	294	N/A	INTRINSIC
ZnF_RBZ	301	325	1.65e-2	SMART
RING	436	476	7.26e-1	SMART

• Predicted Effect: probably damaging ; PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
  (Using ENSMUST00000067429)
• SMART Domains: Protein: ENSMUSP00000140090; Gene: ENSMUSG00000054387; AA Change: F48I

Domain	Start	End	E-Value	Type
Pfam:SWIB	27	102	1.8e-15	PFAM

• Predicted Effect: probably damaging ; PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
  (Using ENSMUST00000185398)
• SMART Domains: Protein: ENSMUSP00000140812; Gene: ENSMUSG00000054387; AA Change: F47I

Domain	Start	End	E-Value	Type
Pfam:SWIB	26	101	9.9e-15	PFAM
low complexity region	280	294	N/A	INTRINSIC

• Predicted Effect: probably damaging ; PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
  (Using ENSMUST00000186617)
• SMART Domains: Protein: ENSMUSP00000140609; Gene: ENSMUSG00000054387; AA Change: F47I

Domain	Start	End	E-Value	Type
Pfam:SWIB	26	101	2.5e-17	PFAM
low complexity region	280	294	N/A	INTRINSIC
ZnF_RBZ	301	325	1.65e-2	SMART
RING	436	476	7.26e-1	SMART

• Predicted Effect: probably damaging ; PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
  (Using ENSMUST00000188090)
• SMART Domains: Protein: ENSMUSP00000140284; Gene: ENSMUSG00000054387; AA Change: F48I

Domain	Start	End	E-Value	Type
Pfam:SWIB	27	102	9.2e-16	PFAM

• Predicted Effect: probably damaging ; PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
  (Using ENSMUST00000190807)
• SMART Domains: Protein: ENSMUSP00000140006; Gene: ENSMUSG00000054387; AA Change: F48I

Domain	Start	End	E-Value	Type
Pfam:SWIB	27	102	1.4e-15	PFAM

• Predicted Effect: probably damaging ; PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
  (Using ENSMUST00000191212)
• Meta Mutation Damage Score: 0.9530
• Is this an essential gene?: Essential (E-score: 1.000)
• Phenotypic Category: Autosomal Dominant
• Mode of Inheritance: Autosomal Dominant
• Last Updated: 2019-09-04 9:43 PM by Diantha La Vine
• Record Created: 2016-02-17 8:12 PM by Ming Zeng
• Record Posted: 2018-09-07
• Science Writers: Anne Murray
• Illustrators: Diantha La Vine
• Authors: Jin Huk Choi, Xue Zhong, Bruce Beutler

Accession Number

NCBI RefSeq: NM_001302801 (variant 1), NM_001302802 (variant 2), NM_008575 (variant 3), NM_001302803 (variant 4), NM_001302804 (variant 5); MGI:107934

Alleles Listed at MGI

All Mutations and Alleles(331) : Chemically induced (other)(2) Gene trapped(313) Radiation induced(1) Targeted(11) Transgenic(4)

Phenotypic Description

Figure 1. Sun_island mice exhibit increased CD4 to CD8 T cell ratios. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Raw data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 2. Sun_island mice exhibit increased frequencies of CD4+ T cells in CD3+ T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Raw data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 3. Sun_island mice exhibit reduced frequencies of CD8+ T cells in CD3+ T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Raw data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The Sun_island phenotype was identified among N-ethyl-N-nitrosourea (ENU)-mutagenized G3 mice of the pedigree R2061, some of which showed an increase in the CD4 to CD8 T cell ratio (Figure 1) due to increased frequencies of CD4+ T cells in CD3+ T cells (Figure 2) with concomitant reduced frequencies of CD8+ T cells in CD3+ T cells (Figure 3) in the peripheral blood.

Nature of Mutation

Figure 4. Linkage mapping of the increased CD4 to CD8 T cell ratio using a dominant model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 134 mutations (X-axis) identified in the G1 male of pedigree R2061. Normalized phenotype data are shown for single locus linkage analysis without consideration of G2 dam identity. Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Figure 5. CRISPR -Mdm4 knockout mice exhibit reduced frequencies of CD8+ T cells in CD3+ T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Raw data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 6. CRISPR -Mdm4 knockout mice exhibit increased CD4 to CD8 T cell ratios. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Raw data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 7. CRISPR -Mdm4 knockout mice exhibit increased frequencies of CD4+ T cells in CD3+ T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Raw data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Whole exome HiSeq sequencing of the G1 grandsire identified 134 mutations. All of the above anomalies were linked by continuous variable mapping to two mutations on chromosome 1: Lemd1 and Mdm4. The mutation in Mdm4 was presumed to be causative, and is a T to A transversion at base pair 133,012,651 (v38) on chromosome 1, or base pair 17,937 in the GenBank genomic region NC_000067 encoding Mdm4. The strongest association was found with a dominant/additive model of inheritance to the increased CD4 to CD8 T cell ratio, wherein eight heterozygous mice departed phenotypically from nine homozygous reference mice with a P value of 1.796 x 10^-11 (Figure 4); no homozygous variant mice were observed in the R2061 pedigree.  

The mutation corresponds to residue 416 in the mRNA sequence NM_008575 within exon 4 of 12 total exons.

401 GCGCAGGGGGAAGTATTCACCATGAAAGAGGTA 42  -A--Q--G--E--V--F--T--M--K--E--V-

The mutated nucleotide is indicated in red. The mutation results in a phenylalanine to isoleucine substitution at amino acid 47 (F47I) in the MDM4 protein, and is strongly predicted by PolyPhen-2 to be damaging (score = 1.000).

The causative mutation for the T cell phenotypes was validated to be in Mdm4 by CRISPR-mediated knockout of Mdm4 (Figure 5, [CD8+ T cells in CD3+ T cells, 1.924 x 10^-10]; Figure 6, [CD4:CD8, 8.7 x 10^-5]; Figure 7, [CD4+ T cells in CD3+ T cells, 0.001758]).

Protein Prediction

Figure 8. Domain organization of MDM4. The sun_island mutation results in a phenylalanine to isoleucine substitution at amino acid 47 within the p53-binding domain. Abbreviations: p53 BD, p53 binding domain; WWW, WWW element; ZF, zinc finger. This image is interactive. Other mutations found in MDM4 are noted in red. Click on each mutation for more information.

Mdm4 encodes mouse double minute-4 (MDM4; alternatively, MDMX or HDMX). MDM4 shares structural similarities with MDM2 (see the record for Xi-an), another member of the MDM family (1). MDM4 has a p53-binding (alternatively, SWIB/MDM2) domain, a WWW element, an acidic domain, a RANBP2-type zinc finger, a nuclear localization sequence, and a RING-type zinc finger (Figure 8) (1).

The p53-binding domain region of MDM4 mediates p53 and p73 binding (2-4). The WWW element is an auto-inhibitory sequence that has high binding affinity for the p53 transactivation domain (5). The MDM4 acidic and RANBP2-type zinc finger domains are putative binding sites for several regulatory proteins, including p300 (6), YY1 (7;8), ARF (alternatively, Cdkn2a [cyclin-dependent kinase inhibitor 2a]) (9;10), and PML [promyelocytic leukemia] (11). The acidic and RANBP2-type zinc finger domains also putatively interact with ribosomal proteins. The MDM4 RING-type zinc finger has a C₂H₂C₄ structure and coordinates binding of two zincs. The RING-type zinc finger mediates interaction with MDM2 to reverse MDM2-associated p53 degradation. The interaction between MDM4 and MDM2 promotes the ubiquitin ligase activity of MDM2 by forming an interaction domain for the E2 ubiquitin-conjugating enzyme (12;13).

MDM4 is ubiquitinated by MDM2, resulting in MDM4 degradation and activation of p53 in response to cytotoxic stress (14;15). MDM4 is phosphorylated at Ser403 by Atm in response to DNA damage (14) and at serines 342 and 367 by CHEK1 (checkpoint kinase 1) and CHEK2 (16). CHEK-mediated phosphorylation promotes MDM2-mediated ubiquitination of MDM4 (17), inhibits deubiquitination by HAUSP (alternatively, USP7) ((18;19), and permits interaction with 14-3-3γ and subsequent ubiquitination and degradation (20). CK1α (casein kinase 1-α)-mediated phosphorylation of MDM4 at Ser289 is required for MDM4 interaction with p53 (21). MDM4 is also phosphorylated by c-Abl, which inhibits the MDM4-p53 interaction (22). AKT-mediated phosphorylation of Ser367 stabilizes MDM4 and promotes 14-3-3 binding (23). CDK1-mediated phosphorylation of MDM4 results in nuclear export of MDM4 (24).

The sun_island mutation results in a phenylalanine to isoleucine substitution at amino acid 47 (F47I); Phe47 is within the p53-binding domain.

Expression/Localization

MDM4 is highly expressed in the thymus and at lower levels in all other tissues tested (1).

MDM4 localizes to the cytoplasm. DNA damage promotes the phosphorylation of MDM4, promoting its nuclear localization. MDM4 can heterodimerize with MDM2, which allows for nuclear transport of MDM4 (25).

MDM4 is overexpressed in several human cancers, including retinoblastomas, testicular cancers, leukemias, and melanomas (26-29).

Background

Figure 9. MDM2 and MDM4 regulate p53. In nonstressed conditions, p53 levels remain low through its ubiquitination (Ub) by MDM2 and MDM4 , both of which bind p53. Under stressed conditions, upstream signaling to p53 increases its levels and activities and the function of the MDM2-MDM4 complex is blocked. p53 then transactivates and represses a number of target genes that function in apoptosis, cell cycle, and DNA repair.

MDM2 and MDM4 regulate p53 in a non-overlapping manner (30). MDM2 ubiquitinates p53 and subsequently promotes the proteasome-mediated degradation of p53. MDM4 does not degrade p53, but inhibits p53 by binding to its transcriptional activation domain (1;31). MDM4 also stabilizes MDM2; the formation of a MDM2/MDM4 heterodimer causes increased stimulation of p53 ubiquitination, controlling p53 activity (12;32-36).

MDM4 interacts with several proteins in addition to p53. (i) MDM4 interacts with p21, an inhibitor of cyclin dependent kinases. MDM4 targets p21 for proteasomal degradation in an ubiquitin-independent manner at the G1 and early S phases of the cell cycle (37). MDM4-mediated p21 degradation results in abrogation of G1 cell cycle arrest (37). (ii) MDM4 represses E2F1 transactivation through an unclear mechanism (38;39). MDM4 putatively disrupts E2F1-DNA binding (38) or alters the localization of the E2F1 transcription complex (39). (iii) MDM4 stabilizes retinoblastoma (RB) protein by competing with MDM2 binding (40) as well as promotes RB degradation in a MDM2-dependent manner (41). (iv) After lethal DNA damage, MDM4 dissociates from MDM2. MDM4 then promotes the stabilization of HIPK2 (homeodomain-interacting protein kinase 2) and the phosphorylation of p53, subsequently leading to reduced transcription of p53/HIPK2 targets (42). (v) Increased levels of MDM4 inhibit DNA break repair in a p53- and MDM2-independent manner (43). MDM4 associates with NBS1 at chromatin after DNA damage, delaying the DNA damage signaling response. NBS1 is a component of the MRN [MRE11 (meiotic recombination 11)–Rad50–NBS1 (Nijmegen breakage syndrome 1)] complex. The MRN complex and the PIKKs ATM, ATM, Rad3-related (ATR), and DNA-PK (DNA-dependent protein kinase; see the record for clover) are involved in early DNA DSB-induced signaling. (vi) MDM4 binds and inhibits mTOR after nutrient deprivation in a p53-independent manner, resulting in impaired mTORC1 activity (44).

The rs1380576 C>G polymorphism in MDM4 was a protective factor for breast cancer in a southeast Iranian population sample (45). The rs1380576 C>G variant was also associated with reduced gastric cancer risk in an eastern Chinese population (46). The rs4245739 A>C polymorphism is a putative protective factor against cancer in Chinese (47) and Asian populations (48). The rs4245739 A>C polymorphism is associated with reduced risk of breast cancer (but not lung, colon, or prostate cancer) in Norway (49). The rs4245739 A>C polymorphism is also associated with increased risk of serous ovarian cancer, but not endometrial cancer (50).

Mdm4-deficient mice exhibit embryonic lethality between E9.5 and E12.5 (51-53). When the Mdm4-deficient mice were crossed to p53-deficient mice, the Mdm4-deficient embryonic lethality was rescued (53). The Mdm4-deficient embryos are reduced in size at E9.5 as well as exhibit improper neural tube closer, dilated lateral ventricle, telencephalon hypoplasia, and cell death in the developing central nervous system (51). Mice expressing a mutant Mdm4 (Ser341/367/402Ala) showed reduced mortality compared to wild-type mice, thymocyte apoptosis, moderate anemia, and moderate leucopenia after irradiation (54). Another mouse model expressing a mutant Mdm4 (Cys462Ala) exhibited embryonic lethality between E9.5 and E13.5; the embryos exhibited reduced sizes, abnormal heart development, reduced cell proliferation, and increased embryonic tissue apoptosis (36). Mice expressing a MDM4 with the RING-type zinc finger deleted (Mdm4^delRING) showed embryonic lethality and increased p53 activity (35).

Putative Mechanism

The phenotype of the sun_island mice indicates loss of MDM4-associated function, putatively in its regulation of the mTORC1 signaling pathway. The mTOR-associated signaling pathway regulates cell growth, size, metabolism, and growth factor signaling by stimulating protein synthesis. When there are sufficient nutrients, mTOR signaling is active allowing for protein synthesis and an increase in cell size. In contrast, when nutrient levels decrease or in conditions of cell stress, protein synthesis is inhibited with a concomitant decrease in cell size and cell proliferation. When mTORC1 is activated upon raptor binding to mTOR, it phosphorylates several targets, including S6 kinase 1 (S6K1) and 4E-binding protein 1 (4E-BP1). mTOR signaling regulates the differentiation, activation, and function of several immune cell types including mast cells, neutrophils, natural killer cells, γδ T cells, macrophages, dendritic cells (DCs), T cells and B cells. For more information about the mTORC1 signaling pathway, please see the record for hamel.

Primers

PCR Primer
Sun_island_pcr_F: CCCAGGTCAATGAATCTGTGG
Sun_island_pcr_R: CACCTCCCCAGAAATCAATCTAATTG

Sequencing Primer
Sun_island_seq_F: GTCAATGAATCTGTGGATGACC
Sun_island_seq_R: TCAGGCCCTTTAGGTGAA

Genotyping

PCR program

1) 94°C 2:00
2) 94°C 0:30
3) 55°C 0:30
4) 72°C 1:00
5) repeat steps (2-4) 40x
6) 72°C 10:00
7) 4°C hold

The following sequence of 440 nucleotides is amplified (chromosome 1, - strand):

1   cacctcccca gaaatcaatc taattgaaat gtaaataaat agctttgtgc tgggtttgtg
61  caggatccag agttcaaggt cagcctttac tacatagtaa gttcaggccc tttaggtgaa
121 tggaagttct gtcttaatgt tttacgttta tagcaggtgc ggccaaaact gcagcttttg
181 aagattttgc atgcagcagg tgcgcagggg gaagtattca ccatgaaaga ggtgagccgg
241 cagggactgt tcccagtttt aagatcagtc aaatagaggc tgtcatgtgc acagttctga
301 aacctgggcc aaagaggaag ttgtactact gaaaggacag tttttcatct tgtaagggcc
361 gccttgtgaa tttcctgttt cctccacact tcctttgaag tccctatata tgtggtcatc
421 cacagattca ttgacctggg 

Primer binding sites are underlined and the sequencing primers are highlighted; the mutated nucleotide is shown in red.

References

  1. Shvarts, A., Bazuine, M., Dekker, P., Ramos, Y. F., Steegenga, W. T., Merckx, G., van Ham, R. C., van der Houven van Oordt,W., van der Eb, A. J., and Jochemsen, A. G. (1997) Isolation and Identification of the Human Homolog of a New p53-Binding Protein, Mdmx. Genomics. 43, 34-42.

  2. Shvarts, A., Steegenga, W. T., Riteco, N., van Laar, T., Dekker, P., Bazuine, M., van Ham, R. C., van der Houven van Oordt,W., Hateboer, G., van der Eb, A. J., and Jochemsen, A. G. (1996) MDMX: A Novel p53-Binding Protein with some Functional Properties of MDM2. EMBO J. 15, 5349-5357.

  3. Ongkeko, W. M., Wang, X. Q., Siu, W. Y., Lau, A. W., Yamashita, K., Harris, A. L., Cox, L. S., and Poon, R. Y. (1999) MDM2 and MDMX Bind and Stabilize the p53-Related Protein p73. Curr Biol. 9, 829-832.

  4. Zdzalik, M., Pustelny, K., Kedracka-Krok, S., Huben, K., Pecak, A., Wladyka, B., Jankowski, S., Dubin, A., Potempa, J., and Dubin, G. (2010) Interaction of Regulators Mdm2 and Mdmx with Transcription Factors p53, p63 and p73. Cell Cycle. 9, 4584-4591.

  5. Bista, M., Petrovich, M., and Fersht, A. R. (2013) MDMX Contains an Autoinhibitory Sequence Element. Proc Natl Acad Sci U S A. 110, 17814-17819.

  6. Grossman, S. R., Perez, M., Kung, A. L., Joseph, M., Mansur, C., Xiao, Z. X., Kumar, S., Howley, P. M., and Livingston, D. M. (1998) P300/MDM2 Complexes Participate in MDM2-Mediated p53 Degradation. Mol Cell. 2, 405-415.

  7. Gronroos, E., Terentiev, A. A., Punga, T., and Ericsson, J. (2004) YY1 Inhibits the Activation of the p53 Tumor Suppressor in Response to Genotoxic Stress. Proc Natl Acad Sci U S A. 101, 12165-12170.

  8. Sui, G., Affar el, B., Shi, Y., Brignone, C., Wall, N. R., Yin, P., Donohoe, M., Luke, M. P., Calvo, D., Grossman, S. R., and Shi, Y. (2004) Yin Yang 1 is a Negative Regulator of p53. Cell. 117, 859-872.

  9. Kamijo, T., Weber, J. D., Zambetti, G., Zindy, F., Roussel, M. F., and Sherr, C. J. (1998) Functional and Physical Interactions of the ARF Tumor Suppressor with p53 and Mdm2. Proc Natl Acad Sci U S A. 95, 8292-8297.

  10. Jackson, M. W., Lindstrom, M. S., and Berberich, S. J. (2001) MdmX Binding to ARF Affects Mdm2 Protein Stability and p53 Transactivation. J Biol Chem. 276, 25336-25341.

  11. Bernardi, R., Scaglioni, P. P., Bergmann, S., Horn, H. F., Vousden, K. H., and Pandolfi, P. P. (2004) PML Regulates p53 Stability by Sequestering Mdm2 to the Nucleolus. Nat Cell Biol. 6, 665-672.

  12. Linke, K., Mace, P. D., Smith, C. A., Vaux, D. L., Silke, J., and Day, C. L. (2008) Structure of the MDM2/MDMX RING Domain Heterodimer Reveals Dimerization is Required for their Ubiquitylation in Trans. Cell Death Differ. 15, 841-848.

  13. Poyurovsky, M. V., Priest, C., Kentsis, A., Borden, K. L., Pan, Z. Q., Pavletich, N., and Prives, C. (2007) The Mdm2 RING Domain C-Terminus is Required for Supramolecular Assembly and Ubiquitin Ligase Activity. EMBO J. 26, 90-101.

  14. Pereg, Y., Shkedy, D., de Graaf, P., Meulmeester, E., Edelson-Averbukh, M., Salek, M., Biton, S., Teunisse, A. F., Lehmann, W. D., Jochemsen, A. G., and Shiloh, Y. (2005) Phosphorylation of Hdmx Mediates its Hdm2- and ATM-Dependent Degradation in Response to DNA Damage. Proc Natl Acad Sci U S A. 102, 5056-5061.

  15. Jin, Y., Dai, M. S., Lu, S. Z., Xu, Y., Luo, Z., Zhao, Y., and Lu, H. (2006) 14-3-3gamma Binds to MDMX that is Phosphorylated by UV-Activated Chk1, Resulting in p53 Activation. EMBO J. 25, 1207-1218.

  16. Chen, L., Gilkes, D. M., Pan, Y., Lane, W. S., and Chen, J. (2005) ATM and Chk2-Dependent Phosphorylation of MDMX Contribute to p53 Activation After DNA Damage. EMBO J. 24, 3411-3422.

  17. Okamoto, K., Kashima, K., Pereg, Y., Ishida, M., Yamazaki, S., Nota, A., Teunisse, A., Migliorini, D., Kitabayashi, I., Marine, J. C., Prives, C., Shiloh, Y., Jochemsen, A. G., and Taya, Y. (2005) DNA Damage-Induced Phosphorylation of MdmX at Serine 367 Activates p53 by Targeting MdmX for Mdm2-Dependent Degradation. Mol Cell Biol. 25, 9608-9620.

  18. Meulmeester, E., Maurice, M. M., Boutell, C., Teunisse, A. F., Ovaa, H., Abraham, T. E., Dirks, R. W., and Jochemsen, A. G. (2005) Loss of HAUSP-Mediated Deubiquitination Contributes to DNA Damage-Induced Destabilization of Hdmx and Hdm2. Mol Cell. 18, 565-576.

  19. Meulmeester, E., Pereg, Y., Shiloh, Y., and Jochemsen, A. G. (2005) ATM-Mediated Phosphorylations Inhibit Mdmx/Mdm2 Stabilization by HAUSP in Favor of p53 Activation. Cell Cycle. 4, 1166-1170.

  20. Pereg, Y., Lam, S., Teunisse, A., Biton, S., Meulmeester, E., Mittelman, L., Buscemi, G., Okamoto, K., Taya, Y., Shiloh, Y., and Jochemsen, A. G. (2006) Differential Roles of ATM- and Chk2-Mediated Phosphorylations of Hdmx in Response to DNA Damage. Mol Cell Biol. 26, 6819-6831.

  21. Chen, L., Li, C., Pan, Y., and Chen, J. (2005) Regulation of p53-MDMX Interaction by Casein Kinase 1 Alpha. Mol Cell Biol. 25, 6509-6520.

  22. Zuckerman, V., Lenos, K., Popowicz, G. M., Silberman, I., Grossman, T., Marine, J. C., Holak, T. A., Jochemsen, A. G., and Haupt, Y. (2009) C-Abl Phosphorylates Hdmx and Regulates its Interaction with p53. J Biol Chem. 284, 4031-4039.

  23. Lopez-Pajares, V., Kim, M. M., and Yuan, Z. M. (2008) Phosphorylation of MDMX Mediated by Akt Leads to Stabilization and Induces 14-3-3 Binding. J Biol Chem. 283, 13707-13713.

  24. Elias, B., Laine, A., and Ronai, Z. (2005) Phosphorylation of MdmX by CDK2/Cdc2(p34) is Required for Nuclear Export of Mdm2. Oncogene. 24, 2574-2579.

  25. Migliorini, D., Danovi, D., Colombo, E., Carbone, R., Pelicci, P. G., and Marine, J. C. (2002) Hdmx Recruitment into the Nucleus by Hdm2 is Essential for its Ability to Regulate p53 Stability and Transactivation. J Biol Chem. 277, 7318-7323.

  26. Laurie, N. A., Donovan, S. L., Shih, C. S., Zhang, J., Mills, N., Fuller, C., Teunisse, A., Lam, S., Ramos, Y., Mohan, A., Johnson, D., Wilson, M., Rodriguez-Galindo, C., Quarto, M., Francoz, S., Mendrysa, S. M., Guy, R. K., Marine, J. C., Jochemsen, A. G., and Dyer, M. A. (2006) Inactivation of the p53 Pathway in Retinoblastoma. Nature. 444, 61-66.

  27. Han, X., Garcia-Manero, G., McDonnell, T. J., Lozano, G., Medeiros, L. J., Xiao, L., Rosner, G., Nguyen, M., Fernandez, M., Valentin-Vega, Y. A., Barboza, J., Jones, D. M., Rassidakis, G. Z., Kantarjian, H. M., and Bueso-Ramos, C. E. (2007) HDM4 (HDMX) is Widely Expressed in Adult Pre-B Acute Lymphoblastic Leukemia and is a Potential Therapeutic Target. Mod Pathol. 20, 54-62.

  28. Koster, R., Timmer-Bosscha, H., Bischoff, R., Gietema, J. A., and de Jong, S. (2011) Disruption of the MDM2-p53 Interaction Strongly Potentiates p53-Dependent Apoptosis in Cisplatin-Resistant Human Testicular Carcinoma Cells Via the Fas/FasL Pathway. Cell Death Dis. 2, e148.

  29. Gembarska, A., Luciani, F., Fedele, C., Russell, E. A., Dewaele, M., Villar, S., Zwolinska, A., Haupt, S., de Lange, J., Yip, D., Goydos, J., Haigh, J. J., Haupt, Y., Larue, L., Jochemsen, A., Shi, H., Moriceau, G., Lo, R. S., Ghanem, G., Shackleton, M., Bernal, F., and Marine, J. C. (2012) MDM4 is a Key Therapeutic Target in Cutaneous Melanoma. Nat Med. 18, 1239-1247.

  30. Xiong, S., Van Pelt, C. S., Elizondo-Fraire, A. C., Liu, G., and Lozano, G. (2006) Synergistic Roles of Mdm2 and Mdm4 for p53 Inhibition in Central Nervous System Development. Proc Natl Acad Sci U S A. 103, 3226-3231.

  31. Finch, R. A., Donoviel, D. B., Potter, D., Shi, M., Fan, A., Freed, D. D., Wang, C. Y., Zambrowicz, B. P., Ramirez-Solis, R., Sands, A. T., and Zhang, N. (2002) Mdmx is a Negative Regulator of P53 Activity in Vivo. Cancer Res. 62, 3221-3225.

  32. Gu, J., Kawai, H., Nie, L., Kitao, H., Wiederschain, D., Jochemsen, A. G., Parant, J., Lozano, G., and Yuan, Z. M. (2002) Mutual Dependence of MDM2 and MDMX in their Functional Inactivation of p53. J Biol Chem. 277, 19251-19254.

  33. Linares, L. K., Hengstermann, A., Ciechanover, A., Muller, S., and Scheffner, M. (2003) HdmX Stimulates Hdm2-Mediated Ubiquitination and Degradation of p53. Proc Natl Acad Sci U S A. 100, 12009-12014.

  34. Okamoto, K., Taya, Y., and Nakagama, H. (2009) Mdmx Enhances p53 Ubiquitination by Altering the Substrate Preference of the Mdm2 Ubiquitin Ligase. FEBS Lett. 583, 2710-2714.

  35. Pant, V., Xiong, S., Iwakuma, T., Quintas-Cardama, A., and Lozano, G. (2011) Heterodimerization of Mdm2 and Mdm4 is Critical for Regulating p53 Activity during Embryogenesis but Dispensable for p53 and Mdm2 Stability. Proc Natl Acad Sci U S A. 108, 11995-12000.

  36. Huang, L., Yan, Z., Liao, X., Li, Y., Yang, J., Wang, Z. G., Zuo, Y., Kawai, H., Shadfan, M., Ganapathy, S., and Yuan, Z. M. (2011) The p53 Inhibitors MDM2/MDMX Complex is Required for Control of p53 Activity in Vivo. Proc Natl Acad Sci U S A. 108, 12001-12006.

  37. Jin, Y., Zeng, S. X., Sun, X. X., Lee, H., Blattner, C., Xiao, Z., and Lu, H. (2008) MDMX Promotes Proteasomal Turnover of p21 at G1 and Early S Phases Independently of, but in Cooperation with, MDM2. Mol Cell Biol. 28, 1218-1229.

  38. Strachan, G. D., Jordan-Sciutto, K. L., Rallapalli, R., Tuan, R. S., and Hall, D. J. (2003) The E2F-1 Transcription Factor is Negatively Regulated by its Interaction with the MDMX Protein. J Cell Biochem. 88, 557-568.

  39. Wunderlich, M., Ghosh, M., Weghorst, K., and Berberich, S. J. (2004) MdmX Represses E2F1 Transactivation. Cell Cycle. 3, 472-478.

  40. Uchida, C., Miwa, S., Isobe, T., Kitagawa, K., Hattori, T., Oda, T., Yasuda, H., and Kitagawa, M. (2006) Effects of MdmX on Mdm2-Mediated Downregulation of pRB. FEBS Lett. 580, 1753-1758.

  41. Zhang, H., Hu, L., Qiu, W., Deng, T., Zhang, Y., Bergholz, J., and Xiao, Z. X. (2015) MDMX Exerts its Oncogenic Activity Via Suppression of Retinoblastoma Protein. Oncogene. 34, 5560-5569.

  42. Moretti, F. (2015) Novel Insights about the MDM2/MDM4 Heterodimer. Mol Cell Oncol. 3, e1066923.

  43. Carrillo, A. M., Bouska, A., Arrate, M. P., and Eischen, C. M. (2015) Mdmx Promotes Genomic Instability Independent of p53 and Mdm2. Oncogene. 34, 846-856.

  44. Mancini, F., Teveroni, E., Di Conza, G., Monteleone, V., Arisi, I., Pellegrino, M., Buttarelli, M., Pieroni, L., D'Onofrio, M., Urbani, A., Pontecorvi, A., Mazzone, M., and Moretti, F. (2017) MDM4 Actively Restrains Cytoplasmic mTORC1 by Sensing Nutrient Availability. Mol Cancer. 16, 55-017-0626-7.

  45. Hashemi, M., Sanaei, S., Hashemi, S. M., Eskandari, E., and Bahari, G. (2018) Association of Single Nucleotide Polymorphisms of the MDM4 Gene with the Susceptibility to Breast Cancer in a Southeast Iranian Population Sample. Clin Breast Cancer. .

  46. Wang, M. Y., Jia, M., He, J., Zhou, F., Qiu, L. X., Sun, M. H., Yang, Y. J., Wang, J. C., Jin, L., Wang, Y. N., and Wei, Q. Y. (2017) MDM4 Genetic Variants and Risk of Gastric Cancer in an Eastern Chinese Population. Oncotarget. 8, 19547-19555.

  47. Jin, X., Zhao, W., Zheng, M., Zhou, P., and Niu, T. (2017) The Role of MDM4 SNP34091 A>C Polymorphism in Cancer: A Meta-Analysis on 19,328 Patients and 51,058 Controls. Int J Biol Markers. 32, e62-e67.

  48. Wang, M. J., Luo, Y. J., Shi, Z. Y., Xu, X. L., Yao, G. L., Liu, R. P., and Zhao, H. (2016) The Associations between MDM4 Gene Polymorphisms and Cancer Risk. Oncotarget. 7, 55611-55623.

  49. Gansmo, L. B., Romundstad, P., Birkeland, E., Hveem, K., Vatten, L., Knappskog, S., and Lonning, P. E. (2015) MDM4 SNP34091 (rs4245739) and its Effect on Breast-, Colon-, Lung-, and Prostate Cancer Risk. Cancer Med. 4, 1901-1907.

  50. Gansmo, L. B., Bjornslett, M., Halle, M. K., Salvesen, H. B., Dorum, A., Birkeland, E., Hveem, K., Romundstad, P., Vatten, L., Lonning, P. E., and Knappskog, S. (2016) The MDM4 SNP34091 (rs4245739) C-Allele is Associated with Increased Risk of Ovarian-but Not Endometrial Cancer. Tumour Biol. 37, 10697-10702.

  51. Migliorini, D., Lazzerini Denchi, E., Danovi, D., Jochemsen, A., Capillo, M., Gobbi, A., Helin, K., Pelicci, P. G., and Marine, J. C. (2002) Mdm4 (Mdmx) Regulates p53-Induced Growth Arrest and Neuronal Cell Death during Early Embryonic Mouse Development. Mol Cell Biol. 22, 5527-5538.

  52. Slee, E. A., Benassi, B., Goldin, R., Zhong, S., Ratnayaka, I., Blandino, G., and Lu, X. (2010) Phosphorylation of Ser312 Contributes to Tumor Suppression by p53 in Vivo. Proc Natl Acad Sci U S A. 107, 19479-19484.

  53. Parant, J., Chavez-Reyes, A., Little, N. A., Yan, W., Reinke, V., Jochemsen, A. G., and Lozano, G. (2001) Rescue of Embryonic Lethality in Mdm4-Null Mice by Loss of Trp53 Suggests a Nonoverlapping Pathway with MDM2 to Regulate p53. Nat Genet. 29, 92-95.

  54. Wang, Y. V., Leblanc, M., Wade, M., Jochemsen, A. G., and Wahl, G. M. (2009) Increased Radioresistance and Accelerated B Cell Lymphomas in Mice with Mdmx Mutations that Prevent Modifications by DNA-Damage-Activated Kinases. Cancer Cell. 16, 33-43.