Phenotypic Mutation 'vulpix'

• Allele: vulpix
• Mutation Type: splice site
• Chromosome: 13
• Coordinate: 13,696,794 bp (GRCm38)
• Base Change: T ⇒ C (forward strand)
• Gene: Lyst
• Gene Name: lysosomal trafficking regulator
• Synonym(s): D13Sfk13
• Chromosomal Location: 13,590,397-13,778,803 bp (+)
• MGI Phenotype: Strain: 1855968; FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that regulates intracellular protein trafficking in endosomes, and may be involved in pigmentation. Mutations in this gene are associated with Chediak-Higashi syndrome, a lysosomal storage disorder. Alternative splicing results in multiple transcript variants, though the full-length nature of some of these variants has not been determined. [provided by RefSeq, Apr 2013] ; PHENOTYPE: Homozygous mice have a phenotype similar to human Chediak-Higashi syndrome patients, exhibiting lysosomal dysfunction with resultant protein storage; diluted coat color; abnormal melanogenesis; immune cell dysfunction resulting in increased susceptibility to bacterial, viral, and parasitic infections and decreased cytotoxic activity against tumor cells. [provided by MGI curators]
• Mapped: Yes
• Institutional Source: Beutler Lab
• Gene Model: predicted gene model for protein(s): [ENSMUSP00000106188 ^†] † probably from a misspliced transcript
• AlphaFold: no structure available at present
• SMART Domains: Protein: ENSMUSP00000106188; Gene: ENSMUSG00000019726

Domain	Start	End	E-Value	Type
low complexity region	26	36	N/A	INTRINSIC
low complexity region	72	82	N/A	INTRINSIC
low complexity region	399	412	N/A	INTRINSIC
low complexity region	1333	1344	N/A	INTRINSIC
low complexity region	2295	2307	N/A	INTRINSIC
low complexity region	2427	2445	N/A	INTRINSIC
low complexity region	2534	2546	N/A	INTRINSIC
Pfam:PH_BEACH	3006	3101	5.8e-25	PFAM
Beach	3118	3408	1.25e-193	SMART
Blast:Beach	3441	3478	9e-13	BLAST
WD40	3539	3579	5.75e-1	SMART
WD40	3591	3630	2.89e-5	SMART
WD40	3633	3676	1.38e0	SMART
WD40	3724	3765	1.27e-1	SMART

• Predicted Effect: probably null
• Meta Mutation Damage Score: 0.9755
• Is this an essential gene?: Possibly nonessential (E-score: 0.298)
• Phenotypic Category: Autosomal Recessive
• Mode of Inheritance: Autosomal Recessive
• Local Stock: Live Mice
• Last Updated: 2019-09-04 9:43 PM by Diantha La Vine
• Record Created: 2016-02-18 10:51 AM by Carlos Reyna
• Record Posted: 2016-04-28
• Science Writers: Anne Murray
• Illustrators: Katherine Timer
• Authors: Carlos Reyna, Jamie Russell, and Bruce Beutler

Accession Number

NCBI RefSeq: NM_010748.2; MGI:107448

Alleles Listed at MGI

All Mutations and Alleles(57) : Chemically induced (ENU)(9) Gene trapped(34) Radiation induced(1) Spontaneous(9) Targeted(4)

Phenotypic Description

Figure 1. The vulpix mice exhibit hypopigmentation of the fur. In the bottom picture, a wild-type (C57BL/6J) littermate is shown (top) with the vulpix mouse (bottom).

The vulpix phenotype was identified among G3 mice of the pedigree R4638, some of which exhibited hypopigmentation of the fur (Figure 1).

Nature of Mutation

Whole exome HiSeq sequencing of the G1 grandsire identified 40 mutations. Among these, only one affected a gene with known effects on fur pigmentation, Lyst. The mutation in Lyst was presumed to be causative because the vulpix hypopigmentation phenotype mimics other known alleles of Lyst (see MGI for a list of Lyst alleles as well as the entry for souris). The Lyst mutation is a T to C transition at base pair 13,696,794 (v38) on chromosome 13, or base pair 106,456 in the GenBank genomic region NC_000079 for the Lyst gene. The effect of the mutation at the cDNA and protein level have not examined, but the mutation is predicted to result in skipping of the 179-nucleotide exon 30 (out of 53 total exons), resulting in an in-frame deletion of 59 amino acids after amino acid 2,643 of the protein.

<--exon 29        <--exon 30 intron 30-->           exon 31-->         <--exon 53 97457 ……AGGATTATTTACCAAG ……TTCAAAGTGTGTATT gtaagtaaattaatgacttg…… GGTTCAAGTAAA…… ……GCAGCTGGATGA…… 2639  ……-R--I--I--Y--Q-- ……-F--K--V--C--I-                        -G--S--S--K-…… ……-A--A--G--*-       correct deleted correct

The donor splice site of intron 30, which is predicted to be destroyed by the vulpix mutation, is indicated in blue lettering and the mutated nucleotide is indicated in red. 

Protein Prediction

Figure 5. Domain structure of the Lyst protein. The Lyst protein is a 3788-amino acid protein whose biochemical functions remain unknown. The N-terminal portion of the protein contains approximately twenty repeats with homology to ARM and HEAT repeat motifs and a perilipin domain (PD). The C-terminal portion of Lyst contains a BEACH domain and seven WD40 motifs. The vulpix mutation occurs in intron 30. This image is interactive.This image is interactive. Click on the mutations (red) for more specific information.

The Lyst gene encodes the protein Lyst (also CHS/Beige), a 3788-amino acid protein whose biochemical functions remain unknown (Figure 3). A large N-terminal portion of the protein (amino acids 1-3132) contains approximately twenty repeats with homology to ARM (Armadillo) and HEAT (huntingtin, elongation factor 3, A subunit of protein phosphatase A, target of rapamycin) repeat motifs (1;2). ARM and HEAT motifs are α-helical domains of about 50 amino acids that pack together to form elongated “solenoids” (3); evidence suggests they mediate protein associations at the membrane (4), and vesicle transport (5), respectively. The C-terminus of Lyst contains two distinct domains, a BEACH (beige and chediak) domain (amino acids 3132-3472) and seven WD40 motifs (1). The BEACH domain is a 345-amino acid region of unknown function (1), and WD40 motifs are protein interaction motifs that typically form β sheets arranged in a 7-bladed β propeller fold (6).The vulpix mutation is predicted to affect the ARM/HEAT domain.

Please see the record for souris for information about Lyst.

Putative Mechanism

In humans, mutations in the LYST gene cause Chediak-Higashi Syndrome (CHS, OMIM #214500), a rare autosomal recessive disorder characterized by oculocutaneous albinism, severe immune deficiency, bleeding tendency, recurrent pyogenic infection, progressive neurologic defects and a lymphoproliferative syndrome [(7;8); reviewed in (2)]. These defects are caused by the aberrant formation of giant granules within a variety of cell types, and disrupted intracellular protein trafficking (2;9;10). The enlarged granules consist of organelles such as lysosomes, melanosomes, cytolytic granules and platelet dense bodies, and it is thought that the increased size of these organelles inhibits their migration and fusion at the cell surface and/or organelle-organelle fusion. There is no clear understanding of the molecular mechanisms of Lyst protein function, or how its loss leads to the formation of enlarged lysosomes and lysosome-related organelles. In mice, mutations in Lyst cause the beige phenotype (7;8). As in humans, beige mice exhibit hypopigmentation, bleeding tendency, and defective immune cell function resulting from the formation of giant granules in melanosomes, lymphocytes, neutrophils, and other cell types (10-12). Beige mice have defective NK cell (13) and cytotoxic T lymphocyte function (14), and increased susceptibility to infections including MCMV (15;16). However, beige mice do not develop lymphoproliferative disorder, even after challenge with infection (15). The vulpix hypopigmentation phenotype mimics other known alleles of Lyst (see MGI for a list of Lyst alleles as well as the Beutler alleles souris and charlotte_gray) indicating that there is loss of function in the Lyst^vulpix protein.

Primers

PCR Primer
vulpix_pcr_F: TGTCAGATGTCCTCAGTGTTAC
vulpix_pcr_R: TTTTGTAACAGGTTAGCCAAGC

Sequencing Primer
vulpix_seq_F: GTCAGATGTCCTCAGTGTTACTTATC
vulpix_seq_R: TGAGTTCAAAGTCAACCTAGGC

Genotyping

PCR program

1) 94°C 2:00
2) 94°C 0:30
3) 55°C 0:30
4) 72°C 1:00
5) repeat steps (2-4) 40x
6) 72°C 10:00
7) 4°C hold

The following sequence of 615 nucleotides is amplified (chromosome 13, + strand):

1   tgtcagatgt cctcagtgtt acttatccca cctcttgagt attttcacca acatcattac
61  catacatagt agatacctat caatgagtta acttattttt attaaattct tttttaattc
121 aaagagttga attcagatat tattgacatt ttgagaactc cagaaaatac atcccaaagc
181 aagacctcag tttctcagac tgaaatttct gaagaagaca tgcatcatga gcaaccttct
241 gtatataatc catttcaaaa agaaatgtta acctatctgt tggatggctt caaagtgtgt
301 attgtaagta aattaatgac ttgaaaatgt gcatttacac aaaaggagta gagatctata
361 tatgtgaact ctgggtttct aaatttatat ttctttgtgc tttgtacctg aaacaattta
421 aattcgtttt tctgttgggg taaggtcatt gttttgtttt gaagtaagga ttcactatgt
481 agcctaggtt gactttgaac tcatatttct catttctcag tctcatgcta attgacattg
541 caggtgtgtg ccattatgcc taacggggtt ttaataatag agtgatatat tttgcttggc
601 taacctgtta caaaa

Primer binding sites are underlined and the sequencing primers are highlighted; the mutated nucleotide is shown in red.

References

1. Nagle, D. L., Karim, M. A., Woolf, E. A., Holmgren, L., Bork, P., Misumi, D. J., McGrail, S. H., Dussault, B. J.,Jr, Perou, C. M., Boissy, R. E., Duyk, G. M., Spritz, R. A., and Moore, K. J. (1996) Identification and Mutation Analysis of the Complete Gene for Chediak-Higashi Syndrome. Nat Genet. 14, 307-311.

  2. Shiflett, S. L., Kaplan, J., and Ward, D. M. (2002) Chediak-Higashi Syndrome: A Rare Disorder of Lysosomes and Lysosome Related Organelles. Pigment Cell Res. 15, 251-257.

  3. Andrade, M. A., Petosa, C., O'Donoghue, S. I., Muller, C. W., and Bork, P. (2001) Comparison of ARM and HEAT Protein Repeats. J Mol Biol. 309, 1-18.

  4. Peifer, M., Berg, S., and Reynolds, A. B. (1994) A Repeating Amino Acid Motif Shared by Proteins with Diverse Cellular Roles. Cell. 76, 789-791.

  5. Andrade, M. A., and Bork, P. (1995) HEAT Repeats in the Huntington's Disease Protein. Nat Genet. 11, 115-116.

  6. Sondek, J., Bohm, A., Lambright, D. G., Hamm, H. E., and Sigler, P. B. (1996) Crystal Structure of a G-Protein Beta Gamma Dimer at 2.1A Resolution. Nature. 379, 369-374.

  7. Barbosa, M. D., Nguyen, Q. A., Tchernev, V. T., Ashley, J. A., Detter, J. C., Blaydes, S. M., Brandt, S. J., Chotai, D., Hodgman, C., Solari, R. C., Lovett, M., and Kingsmore, S. F. (1996) Identification of the Homologous Beige and Chediak-Higashi Syndrome Genes. Nature. 382, 262-265.

  8. Perou, C. M., Moore, K. J., Nagle, D. L., Misumi, D. J., Woolf, E. A., McGrail, S. H., Holmgren, L., Brody, T. H., Dussault, B. J.,Jr., Monroe, C. A., Duyk, G. M., Pryor, R. J., Li, L., Justice, M. J., and Kaplan, J. (1996) Identification of the Murine Beige Gene by YAC Complementation and Positional Cloning. Nat Genet. 13, 303-308.

  9. Faigle, W., Raposo, G., Tenza, D., Pinet, V., Vogt, A. B., Kropshofer, H., Fischer, A., de Saint-Basile, G., and Amigorena, S. (1998) Deficient Peptide Loading and MHC Class II Endosomal Sorting in a Human Genetic Immunodeficiency Disease: The Chediak-Higashi Syndrome. J Cell Biol. 141, 1121-1134.

  10. Burkhardt, J. K., Wiebel, F. A., Hester, S., and Argon, Y. (1993) The Giant Organelles in Beige and Chediak-Higashi Fibroblasts are Derived from Late Endosomes and Mature Lysosomes. J Exp Med. 178, 1845-1856.

  11. Kelly, E. M. (1957) Beige, Bg. Mouse News Lett. 16, 36-36.

  12. Lutzner, M. A., Lowrie, C. T., and Jordan, H. W. (1967) Giant Granules in Leukocytes of the Beige Mouse. J Hered. 58, 299-300.

  13. Roder, J. C. (1979) The Beige Mutation in the Mouse. I. A Stem Cell Predetermined Impairment in Natural Killer Cell Function. J Immunol. 123, 2168-2173.

  14. Saxena, R. K., Saxena, Q. B., and Adler, W. H. (1982) Defective T-Cell Response in Beige Mutant Mice. Nature. 295, 240-241.

  15. Shellam, G. R., Allan, J. E., Papadimitriou, J. M., and Bancroft, G. J. (1981) Increased Susceptibility to Cytomegalovirus Infection in Beige Mutant Mice 3. Proc Natl Acad Sci U S A. 78, 5104-5108.

  16. Kirkpatrick, C. E., and Farrell, J. P. (1982) Leishmaniasis in Beige Mice. Infect Immun. 38, 1208-1216.