Phenotypic Mutation 'jello'

• Allele: jello
• Mutation Type: missense
• Chromosome: 11
• Coordinate: 75,332,638 bp (GRCm39)
• Base Change: A ⇒ G (forward strand)
• Gene: Wdr81
• Gene Name: WD repeat domain 81
• Synonym(s): shakey 5, nur5, MGC32441
• Chromosomal Location: 75,331,770-75,345,543 bp (-) (GRCm39)
• MGI Phenotype: FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a multi-domain transmembrane protein, which is predominantly expressed in the brain. Mutations in this gene are associated with autosomal recessive cerebellar ataxia, mental retardation, and dysequilibrium syndrome-2. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jun 2012] ; PHENOTYPE: Mice homozygous for an ENU-induced mutation exhibit weight loss, tremors, ataxia and an abnormal gait, as well as abnormal mitochondria in Purkinje cell dendrites, Purkinje cell degeneration, photoreceptor cell loss, and decreased total retina thickness. [provided by MGI curators]
• Mapped: Yes
• Amino Acid Change: Leucine changed to Proline
• Institutional Source: Beutler Lab
• Gene Model: predicted gene model for protein(s): [ENSMUSP00000134266]
• AlphaFold: Q5ND34
• SMART Domains: Protein: ENSMUSP00000113939; Gene: ENSMUSG00000045374; AA Change: L1920P

Domain	Start	End	E-Value	Type
Beach	347	589	2.52e-98	SMART
low complexity region	673	704	N/A	INTRINSIC
low complexity region	848	874	N/A	INTRINSIC
low complexity region	1141	1165	N/A	INTRINSIC
low complexity region	1196	1210	N/A	INTRINSIC
low complexity region	1566	1587	N/A	INTRINSIC
WD40	1630	1669	3.19e-7	SMART
WD40	1679	1716	1.18e2	SMART
WD40	1719	1761	7.36e1	SMART
WD40	1764	1807	3.3e1	SMART
WD40	1810	1848	3.58e-1	SMART
WD40	1893	1934	4.26e1	SMART

• Predicted Effect: unknown
• SMART Domains: Protein: ENSMUSP00000120605; Gene: ENSMUSG00000045374; AA Change: L742P

Domain	Start	End	E-Value	Type
low complexity region	1	7	N/A	INTRINSIC
low complexity region	23	47	N/A	INTRINSIC
low complexity region	78	92	N/A	INTRINSIC
low complexity region	448	469	N/A	INTRINSIC
WD40	512	551	3.19e-7	SMART
WD40	561	598	1.18e2	SMART
WD40	601	670	3.55e1	SMART
Blast:WD40	673	710	3e-14	BLAST
WD40	715	756	4.26e1	SMART

• Predicted Effect: unknown
• SMART Domains: Protein: ENSMUSP00000134266; Gene: ENSMUSG00000045374; AA Change: L1921P

Domain	Start	End	E-Value	Type
Beach	347	589	2.52e-98	SMART
low complexity region	673	704	N/A	INTRINSIC
low complexity region	848	874	N/A	INTRINSIC
low complexity region	1141	1165	N/A	INTRINSIC
low complexity region	1196	1210	N/A	INTRINSIC
low complexity region	1566	1587	N/A	INTRINSIC
WD40	1630	1669	3.19e-7	SMART
WD40	1679	1716	1.18e2	SMART
WD40	1719	1761	7.36e1	SMART
WD40	1764	1807	3.3e1	SMART
WD40	1810	1848	3.58e-1	SMART
WD40	1893	1934	4.26e1	SMART

• Predicted Effect: probably damaging ; PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
  (Using ENSMUST00000173320)
• Meta Mutation Damage Score: 0.9400
• Is this an essential gene?: Essential (E-score: 1.000)
• Phenotypic Category: Autosomal Recessive
• Mode of Inheritance: Autosomal Recessive
• Local Stock: Live Mice
• Last Updated: 2022-04-12 3:40 PM by External Program
• Record Created: 2016-02-19 1:39 PM by Jamie Russell
• Record Posted: 2018-12-18
• Science Writers: Anne Murray
• Illustrators: Diantha La Vine
• Authors: James Butler, Sara Ludwig, Lauren Prince, Jamie Russell, Bruce Beutler, Zhao Zhang

Accession Number

NCBI RefSeq: NM_138950; MGI:2681828

Alleles Listed at MGI

All Mutations and Alleles(8) : Chemically induced(ENU)(1) Chemically induced(other)(1) Endonuclease-mediated(1) Gene trapped(4) Targeted(1)

Phenotypic Description

Figure 1. Jello mice exhibit reduced body weights compared to wild-type littermates. Scaled weight data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 2. Jello mice exhibit ataxia.

The jello phenotype was identified among N-ethyl-N-nitrosourea (ENU)-mutagenized G3 mice of the pedigree R4351, some of which showed reduced body weights compared to wild-type littermates (Figure 1) and ataxia (Figure 2).

Nature of Mutation

Figure 3. Linkage mapping of the reduced body weight phenotype using a recessive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 40 mutations (X-axis) identified in the G1 male of pedigree R4351. Weight data are shown for single locus linkage analysis without consideration of G2 dam identity. Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 40 mutations. Both of the above anomalies were linked to a mutation in Wdr81: a T to C transition at base pair 75,441,812 (v38) on chromosome 11, or base pair 12,906 in the GenBank genomic region NC_000077 encoding Wdr81. The strongest association was found with a recessive model of inheritance to the body weight phenotype, wherein three variant homozygotes departed phenotypically from six homozygous reference mice and 14 heterozygous mice with a P value of 6.295 x 10^-6 (Figure 3).  

The mutation corresponds to residue 6,040 in the mRNA sequence NM_138950 within exon 10 of 10 total exons.

6025 CCACGAAACGCCACCTCCTGCTGGGCTCGGAC 1916 P--T--K--R--H--L--L--L--G--S--D-

The mutated nucleotide is indicated in red.  The mutation results in a leucine (L) to proline (P) substitution at position 1,921 (L1921P) in the WDR81 protein, and is strongly predicted by PolyPhen-2 to be damaging (score = 1.000).

Protein Prediction

Figure 4. Domain organization of WDR81. The location of the jello mutation is indicated. Domain information is from SMART and UniProt. Abbreviations: BEACH, Beige and Chediak-Higashi; MFS, major facilitator superfamily

Wdr81 encodes the 1,934-amino acid WD repeat-containing protein 81 (WDR81). WDR81 is a member of the WD repeat protein family. The protein contains an N-terminal BEACH (Beige and Chediak-Higashi) domain (amino acids 335-612), a MFS (major facilitator superfamily) domain, and six C-terminal WD repeats (Figure 4). The function of the BEACH domain is unknown (1). WD repeats are minimally conserved regions of approximately 40 amino acids typically bracketed by Gly-His and Trp-Asp (GH-WD), which may facilitate formation of heterotrimeric or multiprotein complexes. WD repeats typically form β-sheets arranged in a seven-bladed β-propeller fold (2). Amino acids 1 to 63 are predicted to form a mitochondrion transit peptide (UniProt). In addition, amino acids 1146 to 1210 are predicted to be a Glu-rich region.

The jello mutation results in a leucine to proline substitution at amino acid 1,921, which is located within the sixth WD repeat.

Expression/Localization

WDR81 is highly expressed in Purkinje cells of the cerebellum, retinal photoreceptor cells, brain, and spinal cord (3). WDR81 is also expressed in the liver, spleen, kidney, heart, eye, sciatic nerve, and testis (3;4).

Background

Figure 5. WDR81 is involved in autophagy (left) and endocytosis (right). (left) Schematic showing phagophore and autophagosome formation during autophagy. At the nucleation step, proteins and lipids are recruited to the phagophore. The cargo for selective autophagy is recruited to the inner, concave, surface of the growing phagophore by autophagy receptors that are associated both with the cargo and with lipidated ATG8/LC3 (LC3 II). WDR81 interacts with p62, which interacts with ubiquitin chains attached to cargo as well as to LC3 II attached to inner membrane surface. The phagophore expands and encloses its cargo to form the double-membrane autophagosome. The class III phosphatidylinositol 3-kinase (PI3K) complex with the catalytic subunit Vps34 and the regulatory subunit beclin-1 generates PIP 3 at the phagophore. PIP 3 is required for the recruitment of WDR81. Fusion of autophagosomes with late endosomes or lysosomes forms autolysosomes where the enclosed cargo is degraded (not shown). (right) WDR81/91 binds Beclin1 to inhibit the VPS34/CORVET/HOPS/PI3K complex, subsequently reducing the levels of PIP3 on the endosomal membrane. PIP3 is required for endosomal maturation.

Members of the WD repeat protein family are involved in a variety of cellular processes, including cell cycle progression, signal transduction, apoptosis, and gene regulation. WDR81 functions in endosome maturation and autophagy.

Autophagy is a method of degradation that is involved in cellular maintenance and development. In canonical autophagy, a portion of the cytoplasm is sequestered within double-membrane vesicles known as autophagosomes and delivered to the lysosome whereby the contents are degraded. LC3 (microtubule-associated proteins 1A/1B light chain 3) proteins are structural proteins of autophagosomal membranes that function in the formation of the autophagosome. Phosphatidylethanolamine is covalently bound to LC3-I at the forming autophagosomse to generate LC3-II. WDR81 interacts with LC3C (microtubule-associated proteins 1A/1B light chain 3C), subsequently promoting LC3C recruitment to ubiquitinated proteins (5). WDR81 also facilitates the recognition of ubiquitinated proteins by the autophagy cargo receptor p62 (Figure 5, left) (6); loss of WDR81 expression resulted in accumulation of ubiquitinated proteins and p62 (5).

WDR81 promotes endosome maturation by interacting with WDR91 and Beclin1 in a complex that inhibits PI3K (see the record for anubis), permitting loss of phosphatidylinositol 3-phosphate and of early to late endosome conversion (Figure 5, right) (6;6;7). WDR81 cooperates with WDR91 to promote the degradation of epidermal growth factor receptor (EGFR; see the record for Velvet) as well as for trafficking and degradation of the viral restriction factor tetherin (BST2/CD317) (7). Tetherin anchors enveloped viruses to host cells and limits viral spread. Loss of WDR81 expression results in tetherin accumulation in enlarged endocytic vesicles, delayed delivery of endocytosed fluid phase cargo to lysosome, and inhibited degradation of EGFR.

Mutations in human WDR81 are associated with cerebellar ataxia, mental retardation, and dysequilibrium syndrome-2 (CAMRQ2; OMIM: #610185) (4;8-10). CAMRQ2 patients typically exhibit cerebellar ataxia, intellectual disability, sensorineural hearing loss, and mild cerebellar atrophy (11). A patient with two WDR81 nonsense mutations exhibited microcephaly, respiratory distress, lissencephaly, neonatal seizures, and bilateral ocular proptosis secondary to congenital glaucoma and facial dysmorphisms (12). Fibroblasts from the patients showed increased mitotic index and delayed prometaphase/metaphase transition (13).

Homozygous mice for an ENU-induced Wdr81 allele (Wdr81^nur5/nur5) exhibited ataxia, tremors, impaired coordination, abnormal gaits, and reduced body weights compared to wild-type controls (3;14). The Wdr81^nur5/nur5 mice showed loss of cerebellar granule cells, Purkinje cells, and retinal photoreceptor cells (3).

Putative Mechanism

The neurological phenotypes observed in both humans and mice with WDR81 mutations are putatively caused by defects in mitosis, neuronal proliferation, and/or neuronal survival (3;13;15).

Primers

PCR Primer
jello_pcr_F: TCTCCCGAGTTTCATGAAGCC
jello_pcr_R: AATCCACACCTTTGACCTGTAC

Sequencing Primer
jello_seq_F: ATTCAGGAGCTGTGCAATCC
jello_seq_R: ACACCTTTGACCTGTACGGCAG

Genotyping

Genotyping is performed by amplifying the region containing the mutation using PCR, followed by sequencing of the amplified region to detect the mutation.

PCR Primers

ICSI-R4351-jello_PCR_F: 5’- TCTCCCGAGTTTCATGAAGCC-3’

ICSI-R4351-jello_PCR_R: 5’- AATCCACACCTTTGACCTGTAC-3’

Sequencing Primers

ICSI-R4351-jello_SEQ_F: 5’- ATTCAGGAGCTGTGCAATCC-3’
 

ICSI-R4351-jello_SEQ_R: 5’- ACACCTTTGACCTGTACGGCAG-3’
 

PCR program

1) 94°C             2:00

2) 94°C             0:30

3) 55°C             0:30

4) 72°C             1:00

5) repeat steps (2-4) 40X

6) 72°C             10:00

7) 4°C               hold

The following sequence of 401 nucleotides is amplified (NCBI RefSeq: NC_000077, chromosome 11:75441582-75441982):

tctcccgagt ttcatgaagc cacttcaagg ctttggagat tcaggagctg tgcaatccca       

gacagcaggc catgtgggta gccagagcct ggggcttgcc tagaagaatc ggcttcgaga      

tcaagaatga ggagcgggcc ctgagagatg tcatctcgcc ctgccctcag ccaactcctg      

gctggcccta tgccaggagg cggatgatgc cattgtccga gcccagcagg aggtggcgtt      

tcgtgggcag caaagccaga ctagtgagcg tgccacggaa gttctcggaa ctgagctttg      

tggtggcctg agagggtggc tcaagcaggg aacagacacc aatcttgttg gctacagtgc      

cggtgaccac ctcgctgccg tacaggtcaa aggtgtggat t

Primer binding sites are underlined and the sequencing primer is highlighted; the mutated nucleotide is shown in red text (Chr. (+) = A>G).

References

  1. Nagle, D. L., Karim, M. A., Woolf, E. A., Holmgren, L., Bork, P., Misumi, D. J., McGrail, S. H., Dussault, B. J.,Jr, Perou, C. M., Boissy, R. E., Duyk, G. M., Spritz, R. A., and Moore, K. J. (1996) Identification and Mutation Analysis of the Complete Gene for Chediak-Higashi Syndrome. Nat Genet. 14, 307-311.

  2. Sondek, J., Bohm, A., Lambright, D. G., Hamm, H. E., and Sigler, P. B. (1996) Crystal Structure of a G-Protein Beta Gamma Dimer at 2.1A Resolution. Nature. 379, 369-374.

  3. Traka, M., Millen, K. J., Collins, D., Elbaz, B., Kidd, G. J., Gomez, C. M., and Popko, B. (2013) WDR81 is Necessary for Purkinje and Photoreceptor Cell Survival. J Neurosci. 33, 6834-6844.

  4. Gulsuner, S., Tekinay, A. B., Doerschner, K., Boyaci, H., Bilguvar, K., Unal, H., Ors, A., Onat, O. E., Atalar, E., Basak, A. N., Topaloglu, H., Kansu, T., Tan, M., Tan, U., Gunel, M., and Ozcelik, T. (2011) Homozygosity Mapping and Targeted Genomic Sequencing Reveal the Gene Responsible for Cerebellar Hypoplasia and Quadrupedal Locomotion in a Consanguineous Kindred. Genome Res. 21, 1995-2003.

  5. Liu, K., Jian, Y., Sun, X., Yang, C., Gao, Z., Zhang, Z., Liu, X., Li, Y., Xu, J., Jing, Y., Mitani, S., He, S., and Yang, C. (2016) Negative Regulation of Phosphatidylinositol 3-Phosphate Levels in Early-to-Late Endosome Conversion. J Cell Biol. 212, 181-198.

  6. Rapiteanu, R., Davis, L. J., Williamson, J. C., Timms, R. T., Paul Luzio, J., and Lehner, P. J. (2016) A Genetic Screen Identifies a Critical Role for the WDR81-WDR91 Complex in the Trafficking and Degradation of Tetherin. Traffic. 17, 940-958.

  7. Liu, X., Li, Y., Wang, X., Xing, R., Liu, K., Gan, Q., Tang, C., Gao, Z., Jian, Y., Luo, S., Guo, W., and Yang, C. (2017) The BEACH-Containing Protein WDR81 Coordinates p62 and LC3C to Promote Aggrephagy. J Cell Biol. 216, 1301-1320.

  8. Turkmen, S., Demirhan, O., Hoffmann, K., Diers, A., Zimmer, C., Sperling, K., and Mundlos, S. (2006) Cerebellar Hypoplasia and Quadrupedal Locomotion in Humans as a Recessive Trait Mapping to Chromosome 17p. J Med Genet. 43, 461-464.

  9. Garcias Gde, L., and Roth Mda, G. (2007) A Brazilian Family with Quadrupedal Gait, Severe Mental Retardation, Coarse Facial Characteristics, and Hirsutism. Int J Neurosci. 117, 927-933.

  10. Alazami, A. M., Patel, N., Shamseldin, H. E., Anazi, S., Al-Dosari, M. S., Alzahrani, F., Hijazi, H., Alshammari, M., Aldahmesh, M. A., Salih, M. A., Faqeih, E., Alhashem, A., Bashiri, F. A., Al-Owain, M., Kentab, A. Y., Sogaty, S., Al Tala, S., Temsah, M. H., Tulbah, M., Aljelaify, R. F., Alshahwan, S. A., Seidahmed, M. Z., Alhadid, A. A., Aldhalaan, H., AlQallaf, F., Kurdi, W., Alfadhel, M., Babay, Z., Alsogheer, M., Kaya, N., Al-Hassnan, Z. N., Abdel-Salam, G. M., Al-Sannaa, N., Al Mutairi, F., El Khashab, H. Y., Bohlega, S., Jia, X., Nguyen, H. C., Hammami, R., Adly, N., Mohamed, J. Y., Abdulwahab, F., Ibrahim, N., Naim, E. A., Al-Younes, B., Meyer, B. F., Hashem, M., Shaheen, R., Xiong, Y., Abouelhoda, M., Aldeeri, A. A., Monies, D. M., and Alkuraya, F. S. (2015) Accelerating Novel Candidate Gene Discovery in Neurogenetic Disorders Via Whole-Exome Sequencing of Prescreened Multiplex Consanguineous Families. Cell Rep. 10, 148-161.

  11. Komara, M., John, A., Suleiman, J., Ali, B. R., and Al-Gazali, L. (2016) Clinical and Molecular Delineation of Dysequilibrium Syndrome Type 2 and Profound Sensorineural Hearing Loss in an Inbred Arab Family. Am J Med Genet A. 170A, 540-543.

  12. Cappuccio, G., Pinelli, M., Torella, A., Vitiello, G., D'Amico, A., Alagia, M., Del Giudice, E., Nigro, V., TUDP, and Brunetti-Pierri, N. (2017) An Extremely Severe Phenotype Attributed to WDR81 Nonsense Mutations. Ann Neurol. 82, 650-651.

  13. Cavallin, M., Rujano, M. A., Bednarek, N., Medina-Cano, D., Bernabe Gelot, A., Drunat, S., Maillard, C., Garfa-Traore, M., Bole, C., Nitschke, P., Beneteau, C., Besnard, T., Cogne, B., Eveillard, M., Kuster, A., Poirier, K., Verloes, A., Martinovic, J., Bidat, L., Rio, M., Lyonnet, S., Reilly, M. L., Boddaert, N., Jenneson-Liver, M., Motte, J., Doco-Fenzy, M., Chelly, J., Attie-Bitach, T., Simons, M., Cantagrel, V., Passemard, S., Baffet, A., Thomas, S., and Bahi-Buisson, N. (2017) WDR81 Mutations Cause Extreme Microcephaly and Impair Mitotic Progression in Human Fibroblasts and Drosophila Neural Stem Cells. Brain. 140, 2597-2609.

  14. Kile, B. T., Hentges, K. E., Clark, A. T., Nakamura, H., Salinger, A. P., Liu, B., Box, N., Stockton, D. W., Johnson, R. L., Behringer, R. R., Bradley, A., and Justice, M. J. (2003) Functional Genetic Analysis of Mouse Chromosome 11. Nature. 425, 81-86.

  15. Doldur-Balli, F., Ozel, M. N., Gulsuner, S., Tekinay, A. B., Ozcelik, T., Konu, O., and Adams, M. M. (2015) Characterization of a Novel Zebrafish (Danio Rerio) Gene, wdr81, Associated with Cerebellar Ataxia, Mental Retardation and Dysequilibrium Syndrome (CAMRQ). BMC Neurosci. 16, 96-015-0229-4.