Allele | Horus | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Mutation Type | critical splice donor site | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Chromosome | 11 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Coordinate | 23,703,215 bp (GRCm39) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Base Change | A ⇒ C (forward strand) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Gene | Rel | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Gene Name | reticuloendotheliosis oncogene | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Synonym(s) | c-Rel | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Chromosomal Location | 23,686,847-23,720,969 bp (-) (GRCm39) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
MGI Phenotype |
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to the Rel homology domain/immunoglobulin-like fold, plexin, transcription factor (RHD/IPT) family. Members of this family regulate genes involved in apoptosis, inflammation, the immune response, and oncogenic processes. This proto-oncogene plays a role in the survival and proliferation of B lymphocytes. Mutation or amplification of this gene is associated with B-cell lymphomas, including Hodgkin's lymphoma. Single nucleotide polymorphisms in this gene are associated with susceptibility to ulcerative colitis and rheumatoid arthritis. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Apr 2014] PHENOTYPE: Homozygous inactivation of this gene causes defects in lymphocyte proliferation, humoral immunity and cytokine production, and may lead to impaired Th1 responses and resistance to autoimmune disease. Mice lacking only the COOH-terminal region show severehemopoietic defects and lymphoid hyperplasia. [provided by MGI curators] |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Accession Number | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mapped | Yes | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Limits of the Critical Region | 23741514 - 23770970 bp | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Amino Acid Change | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Institutional Source | Beutler Lab | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Gene Model | predicted gene model for protein(s): [ENSMUSP00000099928 †] † probably from a misspliced transcript | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
AlphaFold | no structure available at present | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
SMART Domains |
Protein: ENSMUSP00000099928 Gene: ENSMUSG00000020275
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Predicted Effect | probably null | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Meta Mutation Damage Score | 0.9495 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Is this an essential gene? | Non Essential (E-score: 0.000) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Phenotypic Category | Autosomal Semidominant | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Candidate Explorer Status | loading ... | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Single pedigree Linkage Analysis Data |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Penetrance | 1/1 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Alleles Listed at MGI | All Mutations and Alleles(7) : Chemically induced (other)(1) Targeted(6) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Lab Alleles |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mode of Inheritance | Autosomal Semidominant | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Local Stock | Sperm, gDNA | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Repository | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Last Updated | 2019-10-23 1:57 PM by Diantha La Vine | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Record Created | 2016-02-25 1:20 PM by Jeff SoRelle | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Record Posted | 2016-10-31 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Phenotypic Description |
The Horus phenotype was identified among G3 mice of the pedigree R4067, some of which showed an increased ratio of OVA-specific IgE/total IgE (Figure 1), increased frequencies of T cells (Figure 2), CD4+ T cells (Figure 3), effector memory CD4+ T cells in CD4+ T cells (Figure 4), CD44+ T cells (Figure 5), CD44+ CD4+ T cells (Figure 6), and effector memory CD8+ T cells in CD8+ T cells (Figure 6) as well as an increased mean fluorescence of CD44 on T cells (Figure 7), all in the peripheral blood. Some mice also exhibited diminished frequencies of naïve CD4+ T cells in CD4+ T cells (Figure 8), naïve CD8+ T cells in CD8+ T cells (Figure 9), and B1 cells (Figure 10), all in the peripheral blood. The T-dependent antibody responses to ovalbumin administered with aluminum hydroxide (Figure 11) and recombinant Semliki Forest virus (rSFV)-encoded β-galactosidase (rSFV-β-gal) (Figure 12) as well as the T-independent antibody response to 4-hydroxy-3-nitrophenylacetyl-Ficoll (NP-Ficoll) (Figure 13) were diminished. |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Nature of Mutation |
Whole exome HiSeq sequencing of the G1 grandsire identified 62 mutations. All of the above anomalies were linked by continuous variable mapping to a mutation in Rel: a T to G transversion at base pair 23,753,215 (v38) on chromosome 11, or base pair 17,756 in the GenBank genomic region NC_000077 within the splice donor site of intron 4 of Rel. The strongest association was found with an additive model of linkage to the normalized T-dependent antibody response to ovalbumin administered with aluminum hydroxide, wherein one variant homozygote and five heterozygotes departed phenotypically from four homozygous reference mice with a P value of 1.941 x 10-5 (Figure 15). A substantial semidominant effect was observed in most of the assays but the mutation is preponderantly recessive, and in no assay was a purely dominant effect observed. The effect of the mutation at the cDNA and protein level have not examined, but the mutation is predicted to result in the use of cryptic splice site in exon 4 (out of 10 total exons) and the subsequent deletion of 71 base pair in exon 4. As a result of the deletion, there would be an in-frame deletion of 24 amino acids beginning after amino acid 108 of the encoded protein, and termination after the inclusion of two aberrant amino acids.
Genomic numbering corresponds to NC_000077. The donor splice site of intron 4, which is destroyed by the Horus mutation, is indicated in blue lettering and the mutated nucleotide is indicated in red. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Illustration of Mutations in Gene & Protein |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Protein Prediction |
Rel encodes c-Rel, a member of the NF-κB family of transcription factors, which also includes RelA (p65), RelB, NF-κB1 (p105/p50; see the record for Finlay), and NF-κB2 (p100/p52; see the record for xander). In contrast to the p50 and p52 subunits, which are encoded as the precursor proteins p105 and p100, respectively, RelA, RelB, and c-Rel are synthesized in an active form. The NF-κB protein family members are characterized by the presence of an N-terminal Rel homology domain (RHD) (Figure 16). The RHD (amino acids 8-297, UniProt) is comprised of the N-terminal domain, the dimerization domain (DimD), and a nuclear localization sequence (amino acids 291-296) that mediate sequence-specific DNA binding, nuclear localization, interaction with IκB, and homo- and heterodimerization [reviewed in (1)]. Ser267 is within a protein kinase A (PKA) consensus sequence (RRPS; amino acids 264-267 in mouse c-Rel). Phosphorylation of c-Rel affects DNA binding (2) as well as its C-terminal transactivation activity (3). Mutation of Ser267, and subsequent loss of PKA-mediated c-Rel phosphorylation results in reduced c-Rel dimerization and DNA binding (4). RelA, RelB, and c-Rel have a transactivation domain (TAD; amino acids 424-588 in c-Rel) that allows for direct control of transcription (5). Within the TAD are subdomains I and II at amino acids 424-490 and 518-587, respectively. Both subdomains exhibit basal activity, but subdomain I also exhibits increased activation in response to TNFα (6;7). c-Rel can function as both a homodimer and as a heterodimer with p50. However, c-Rel may also form dimers with other NF-κB family members including p65 (8). NF-κB dimers bind to DNA sequences known as κB sites. Most κB sites are 10 base pairs (bp) in length with the consensus sequence 5‘-GGRNNWYYCC-3' (where R= purine, N= any base, W= adenine or thymine and Y = pyrimidine). c-Rel binds to the DNA consensus sequence 5’-GGGCTTTCC-3’ (9). c-Rel turnover is regulated by the E3 ubiquitin ligase Peli1, which mediates polyubiquitination of c-Rel and its subsequent degradation by the 26S proteasome (10). Peli1-associated ubiquitination of c-Rel prevents aberrant accumulation of c-Rel during T-cell activation. Peli1-deficient mice exhibit nuclear accumulation of c-Rel, T-cell hyperactivation, and spontaneous development of autoimmunity (11). Calmodulin (CaM), a calcium-dependent mediator of intracellular calcium signals, interacts directly with c-Rel upon cell stimulation via a sequence near the nuclear localization signal of c-Rel (12). The CaM—c-Rel interaction is increased after cell stimulation, but the increased interaction can be blocked by IκBα (12). Mutation of the CaM binding site does not alter c-Rel DNA binding, dimerization, or IκB binding (12). CaM is proposed to inhibit nuclear transport of c-Rel to the nucleus, subsequently regulating the activation of NF-κB/Rel proteins after cell stimulation (12). c-Rel that is unable to bind CaM displays increased nuclear accumulation and transcriptional activity of the GM-CSF and IL-2 promoters after stimulation with calcium compared to wild-type c-Rel (12). The effect of the Horus mutation on the c-Rel protein is unknown, but is predicted to result in truncation of the protein after amino acid 110. Amino acid 110 is within the RHD. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Expression/Localization | In the mouse embryo, c-Rel expression was not detected until embryonic day (E) 13.5 and was restricted to hematopoietic organs (13). In the adult mouse (and other vertebrates), c-Rel is mostly restricted to hematopoietic organs, with highest expression in B and T lymphocytes and lower expression in dendritic cells, neutrophils, and macrophages (14;15). C-Rel is expressed at all stages of B cell development, and is expressed at the highest levels in mature B cells (16;17). c-Rel is cytoplasmic until cell stimulation promotes IκB phosphorylation and degradation, which allows c-Rel to translocate to the nucleus. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Background |
NF-κB controls the proliferation, differentiation and survival of B and T cells by activating the transcription of target genes, including various cytokines. A variety of stimuli (e.g., cytokines [e.g., IL-1 and TNFα], ultraviolet irradiation, viral products, and bacterial products [e.g., LPS]) activate NF-κB complexes and the translocation of the activated complexes to the nucleus (Figure 17). In unstimulated cells, NF-κB is sequestered in the cytoplasm by the inhibitory protein IκB, which binds to NF-κB and prevents its translocation to the nucleus. Stimulation of B cell receptors (BCR) or T cell receptors (TCR) together with costimulatory molecules leads to the activation of IκB kinase (IKK) to phosphorylate IκB, triggering the ubiquitination and degradation of IκB, ultimately resulting in activation of NF-κB (the p50:p65 or c-Rel:p50 heterodimers) by releasing it for translocation to the nucleus. BCR or TCR engagement results in the formation of a lipid raft-associated multiprotein complex (called the “immunological synapse” in T cells) at the site of cell-cell contact that controls the events leading to activation of NF-κB (18). Upon T cell activation by TCR and costimulatory molecule engagement, CARMA1 (see the record for king) associates with a complex containing Bcl10 and MALT1 (Mucosa-Associated Lymphoid tissue lymphoma Translocation-associated gene 1; also known as MLT or Paracaspase) and recruits these proteins to lipid rafts of the immunological synapse, where they activate the IKK complex, leading to degradation of IκB and subsequent activation of NF-κB (19-22). The CARMA1/Bcl10/MALT1 complex functions similarly in B cells to activate NF-κB in response to BCR engagement (23). In addition to the CARMA1/Bcl10/MALT1 complex, protein kinase C (PKC) is a critical component of the immunological synapse required for the activation of NF-κB. The PKC isoform PKCβ operates specifically in BCR-dependent NF-κB signaling (24), while PKCθ functions specifically in TCR-dependent NF-κB signaling (25;26). In the nucleus, NF-κB acts as a transcription factor that regulates the expression of genes encoding a variety of immune response genes including pro-inflammatory cytokines (e.g., TNFα (see the record for PanR1), IL-1, and IL-6), chemokines [e.g., MIP-1α (macrophage inflammatory protein-1α), and RANTES (regulated upon activation, normal T-cell expressed and secreted)], cell adhesion molecules [e.g., E-selectin and VCAM-1 (vascular cell adhesion molecule-1)], effector molecules [e.g., defensins], enzymes [e.g., inducible nitric oxide synthase], and growth factors to regulate the recruitment of immune cells to the site of infection [(27;28); reviewed in (29)]. Inhibition of NF-κB leads to apoptosis [through the misregulation of anti-apoptotic proteins (e.g., c-IAP-1/2, AI, Bcl-2 and Bcl-XL)], delayed cell growth, reduced cell proliferation [through negative regulation of cell cycle regulator cyclin D1 (30)] and incorrect immune cell development [reviewed in (31-33)]. c-Rel is essential for normal B and T cell activation and proliferation and for the prevention of autoimmunity. Outside of the immune system, c-Rel maintains organ homeostasis and the cell cycle under conditions of stress or damage. In addition, it is essential for long-term memory consolidation and promotes neuronal survival upon hypoxic stress. Several downstream c-Rel-specific targets are listed in Table 1. Table 1. Select c-Rel targets (adapted from (34))
c-Rel and B cells In pre-B cells the major NF-κB complex is the p50/p65 heterodimer, while in mature B cells the complex is p50/c-Rel (16;17). c-Rel is required for BCR-mediated proliferation and cell cycle progression (37). c-Rel is essential for germinal center and memory B cell differentiation as well as for anti-IgM- and LPS-induced survival and cell cycle progression (58). Rel deficient (Rel-/-) mice exhibit normal early lymphocyte development, but have fewer memory (IgM / IgD−) B cells (58). B cells from Rel-/- mice exhibited impaired proliferation in response to antigen receptor cross-linking and mitogenic activation (e.g., lipopolysaccharide (LPS), anti-IgM, antigen, or CD40) (41;59;60). Although the Rel-/- B cells exhibited normal CD40-associated cell survival, the Rel-/- B cells were unable to receive anti-IgM- or LPS-generated survival signals (58). B cells from the Rel-/- mice were more susceptible to apoptotic stimuli (40;46;58). In resting Rel-/- B cells, BCR stimulation did not induce proper cyclin D3 and cyclin E expression, subsequently negatively regulating G1 cyclin-dependent kinase activity. The Rel-/- B cells were able to exit the G0 phase and enter the G1 phase after stimulation with anti-IgM or LPS, but transition from the G1 to S phase was impaired (42;58). In addition, the proliferation defects in the Rel-/- B cells were attributed to a loss of c-Rel binding to the pro-proliferative protein IRF-4 (61). C-Rel was also found to control the expression of the anti-apoptotic protein, Bcl-2, and of A1, a homolog of Bcl-2, leading to increased rates of apoptosis in the Rel-/- B cells (40;42). Rel-/- mice have irregular germinal centers (GCs) and a reduced frequency of marginal zone B cells (62;63). The Rel-/- mice establish fewer B cells with a germinal center (PNAhi) phenotype after immunization (58). Mice with conditional knockout of Rel in GC B cells (Relfl/flCγ1-Cre) exhibited a reduced frequency of CD95hiPNAhi GC B cells 14 days after immunization with the T cell–dependent antigen sheep RBCs (SRBCs) (63). In addition, BCL6+ GCs in the spleen were fewer and smaller in the Relfl/flCγ1-Cre mice compared to that in wild-type mice (63). In the Relfl/flCγ1-Cre mice, GC formation was normal 7 days after SRBC immunization, indicating that defects in GC formation occur after dark and light zones in the GCs have been fully established (63). The percentage of splenic GC B cells (B220+CD38loCD95hi) cells gradually decreased in the Relfl/flCγ1-Cre mice between days 8 and 10 after SRBC immunization (63). Mice that expressed a c-Rel that lacks the C-terminal region containing the transactivation domain (Δc-Rel) exhibited enlarged spleens due to lymphoid hyperplasia, extramedullary hematopoiesis, and bone marrow hypoplasia (64). With age, the lymphoid hyperplasia was also detected in lymph nodes, liver, lung, and stomach (64). B cells from the Δc-Rel mice exhibited loss of class switching to IgG3 or IgG1 due to reduced expression of CHγ3 and CHγ1, respectively. The Δc-Rel B cells had normal levels of CHε, CHα, CHγ2b, and CHγ2a. Class switching to IgA was normal in the Δc-Rel B cells, but the B cells did not switch to IgE. c-Rel and T cells c-Rel mediates the proliferation, differentiation, and cytokine production of stimulated T cells (47). c-Rel is required for antigen-induced activation of mature T cells (65). However, c-Rel is not required for positive selection during T cell development or for apoptosis of T lymphocytes. c-Rel is essential for sufficient IL-2 production and CD25 expression in T cells (59;66). T cells start producing IL-2 in response to antigens, and IL-2-associated signaling is essential for T cell activation and expansion. In activated naïve T cells, c-Rel signaling downstream of the TCR and CD28 may also be essential for secretion of other IL-2-dependent cytokines. IL-2 is necessary for optimal IL-4 and IFN-γ expression by T-helper cells and for expression of granzyme and perforin (see the record for prime) by cytotoxic T lymphocytes (CTL) (47;67). c-Rel controls the differentiation of Treg cells in the thymus by assisting the formation of a complex containing p65, Smad3, NFATc2, and CREB (51;68). c-Rel maintains the balance between Th1, Th17, and Treg cells to regulate innate immune responses (68-71). During natural Foxp3+ CD4 Treg (nTregs) development, c-Rel is required for the initial antigen dependent generation of CD25+GITRhiFoxp3−CD4+ nTreg precursors followed by the cytokine induction of Foxp3 (69). c-Rel binds to the Foxp3 promoter and subsequently initiates the formation of a transcriptional complex containing RelA, NFAT, Smad, and CREB (51). Rel-/- mice have reduced CD4+CD25+Foxp3+ and CD4+CD25−Foxp3+ Treg cell numbers (68;70;71); however, Treg cells from the mice can inhibit T cell proliferation (68). Rel-/- mice infected with Leishmania major exhibited exacerbated leishmaniasis and increased parasite burdens as well as reduced IFN-γ and IL-17 production than wild-type mice (72). T cells from the Rel-/- mice mounted normal Th1 responses to L. major infection and were able to contain the infection. In addition, Th1 differentiation of naïve CD4+ cells was normal. Dendritic cells from the Rel-/- mice exhibited diminished IL-12 and IL-23 production compared to that in wild-type mice. c-Rel and macrophages c-Rel is both a positive and negative regulation of transcription in macrophages and exhibits unique roles in different macrophage populations (73). Stimulated peritoneal macrophages from Rel-/- mice exhibited high levels of granulocyte-macrophage colony-stimulating factor (GM-CSF), granulocyte colony-stimulating factor (G-CSF), and IL-6 than wild-type macrophages (73). Upon IFN-γ and/or LPS stimulation, peritoneal macrophages from the Rel-/- mice produced diminished amounts of IL-6, IL-12p40, TNF-α, and nitric oxide than control cells. Granulocytes and macrophages, but not DCs, from the Rel-/- mice exhibited increased rates of cell death after IL-4 and GM-CSF withdrawal compared to wild-type cells. Resident macrophages from Rel-/- mice exhibited defects in cytotoxic killing, nitric oxide production, and certain cytokine expression; elicited peritoneal macrophages did not exhibit these defects. The steady-state frequency of the macrophage populations was comparable between Rel-/- and wild-type mice. Activated resident macrophages from the Rel-/- mice exhibited defects in the ability to kill P815 tumor cells in vitro after LPS plus IFNγ stimulation; elicited macrophages from the Rel-/- mice were comparable to wild-type. After LPS treatment, the levels of GM-CSF and G-CSF were increased 10- and 5-fold in the Rel-/- mice compared to that in wild-type stimulated resident macrophages. IL-6 production was elevated in both macrophage populations from the Rel-/- mice compared to that in wild-type mice. TNF-α and IL-1β were not changed upon macrophage stimulation in the Rel-/- mice. c-Rel and inflammatory diseases The Rel-/- mice were protected from inflammatory bowel disease, collagen-induced arthritis, ovalbumin-induced pulmonary inflammation, resistance to streptozotocin-induced diabetes. c-Rel is required for the development of colitis and experimental autoimmune encephalomyelitis (EAE), an inflammatory disease of the central nervous system (48;55); EAE is an animal model for human multiple sclerosis. c-Rel-associated regulation of IL-23 within antigen presenting cells (APCs) is crucial to mediate chronic intestinal inflammation. Rel-/- mice were resistant to EAE, and Rel-/- mice are defective in Th1, but not Th2, responses; the Th2 responses were increased compared to that in wild-type mice (48). In Rel-/- mice, Th1 and Th17 development was impaired with a concomitant protection from EAE (48;55). Microbe-mediated activation of c-Rel in DCs causes the induction of IL-23 and IL-12 expression. IL-23 increases production of IL-17 by CD4+ T cells. The defect in Th1 responses in the Rel-/- mice was due to a blockade of IL-12 production by APCs as well as loss of IFN-γ expression in c-Rel–deficient T cells. Loss of c-Rel expression did not alter the expression of the Th1-specific transcription factor T-bet, indicating that c-Rel acts downstream of T-bet during Th1 cell differentiation. Rel-/- mice exhibited impaired Th17 effector cell development (55). TCR signaling activates c-Rel during early stages of Th17 development. C-Rel regulates the expression of Rorc, which encodes RORγt, a Th17 transcription factor (see the record for chestnut) (55;74). C-Rel also regulates CD28-mediated repression of Th17 development indicating a dual role of c-Rel in Th17 development (55). c-Rel is proposed to promote allergic pulmonary inflammation. Rel-/- mice exposed to allergen challenge did not exhibit increased pulmonary inflammation, bronchoalveolar lavage fluid eosinophilia, or total serum IgE (75). The level of monocyte chemoattractant protein-1 was reduced in allergen-treated Rel-/- mice compared to wild-type mice (75). c-Rel regulates the development of streptozotocin (STZ)-induced diabetes by acting on macrophages, DCs, and T cells (76). Splenocytes from Rel-/- mice produced reduced levels of IFN-γ and IL-2 as well as exhibited less proliferation than that of wild-type mice. The levels of IL-4 and IL-10 were increased in T cell cultures from Rel-/- mice. Taken together, c-Rel may inhibit Th1 responses, but promote Th2 responses. Dendritic cells from the Rel-/- mice produced reduced levels of IL-12p40 and TNF-α than control cells. The reduced expression of IL-12, which is required for Th1 cell differentiation, may lead to the defective Th1 responses in the Rel-/- mice. Non-immune functions of c-Rel Rel-/- mice exhibit reduced capacity for learning and less liver fibrosis when subjected to liver injury, but impaired liver regeneration after partial hepatectomy. The Rel-/- mice were protected from angiotensin-induced hypertrophy and fibrosis. C-Rel stimulates cardiac hypertrophy and fibrosis (57). At birth and through adulthood, Rel-/- mice have smaller hearts. Rel deficiency protects from the development of cardiac hypertrophy and fibrosis after chronic angiotensin infusion. c-Rel is essential for long-term synaptic potentiation and hippocampus-dependent memory formation (77). Rel-/- mice had defective hippocampus-dependent memory formation (77). Rel-/- mice exhibited defects in freezing behavior after training for contextual fear conditioning, but normal freezing behavior in cued fear conditioning and in short-term contextual fear conditioning. During a novel object recognition test, the Rel-/- mice did not exhibit a preference for a novel object, while wild-type mice did. Rel-/- mice exhibited normal baseline synaptic transmission, but less long-term potentiation at Schaffer collateral synapses than wild-type mice. c-Rel and lymphoma The REL gene is often amplified in Hodgkin’s lymphomas (40-50%) and diffuse large B-cell lymphomas (15-20%; (78;79)) as well as follicular and mediastinal B-cell lymphomas (15-20%; (80)). Although REL gene duplication is observed in these lymphomas, a concomitant change in the level of protein expression is not often observed. Some studies have observed increased c-Rel nuclear staining in REL gene duplication samples compared to that in normal samples (81). However, another study did not observe a correlation between the nuclear c-Rel expression and REL gene duplication (78). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Putative Mechanism | Rel-/- mice are overtly normal and have a structurally normal immune system (47;58). However, the Rel-/- mice exhibited immunological defects including reduced lymphocyte proliferation and activation (59). Rel-/- mice did not exhibit defects in the maturation of hematopoietic precursors, including B and T lymphocytes, macrophages, and neutrophils (59). The frequency of monocyte cells was normal (73). Rel-/- mice display reduced expression of IL-2, IL-3, IL-6, IL-10, IL-13, IL-15, IL-21, IFNγ, MIP1α, and GM-CSF (47;73). C-Rel is required for optimal development of humoral immunity (60). After influenza virus infection, Rel-/- mice exhibited normal levels of virus-specific cytotoxic T cells. However, they exhibited reduced T cell proliferative responses to the virus as well as diminished local and systemic influenza virus-specific antibody responses. Vaccinated mice were unable to acquire antibody-dependent protective immunity to reinfection. The quantities of immune cells in the peripheral blood from the Horus mice indicate that c-RelHorus exhibits loss of function. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Primers |
PCR Primer Horus_pcr_F: ACACTTGGAGAAGGTTTCAGTTTTG Horus_pcr_R: AGAGAGCTGACTTTCTGAGTATG Sequencing Primer Horus_seq_F: AGTTCATGGCCAATCTGGAGTAC Horus_seq_R: GGGTATTCGGTGTGTAAAGAA |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Genotyping | PCR program 1) 94°C 2:00 The following sequence of 480 nucleotides is amplified (chromosome 11, - strand): 1 agagagctga ctttctgagt atgtttgatt tttgtcatac ttttgtttaa ctatgatgtg Primer binding sites are underlined and the sequencing primers are highlighted; the mutated nucleotide is shown in red. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
References | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Science Writers | Anne Murray | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Illustrators | Katherine Timer | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Authors | Jeff SoRelle, Ming Zeng, Xue Zhong, Jin Huk Choi, James Butler, Tao Yue, Bruce Beutler |