Phenotypic Mutation 'lomax' (pdf version)
Allelelomax
Mutation Type missense
Chromosome17
Coordinate57,402,811 bp (GRCm38)
Base Change A ⇒ G (forward strand)
Gene Adgre1
Gene Name adhesion G protein-coupled receptor E1
Synonym(s) Emr1, EGF-TM7, F4/80, DD7A5-7, TM7LN3, Ly71
Chromosomal Location 57,358,686-57,483,529 bp (+)
MGI Phenotype Strain: 3582333
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that has a domain resembling seven transmembrane G protein-coupled hormone receptors (7TM receptors) at its C-terminus. The N-terminus of the encoded protein has six EGF-like modules, separated from the transmembrane segments by a serine/threonine-rich domain, a feature reminiscent of mucin-like, single-span, integral membrane glycoproteins with adhesive properties. Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2012]
PHENOTYPE: Homozygous null mice fail to develop peripheral tolerance after inoculation with antigen because of a lack of efferent regulatory T cell development. [provided by MGI curators]
Accession Number

NCBI RefSeq: NM_010130; MGI:106912

MappedYes 
Amino Acid Change Tyrosine changed to Cysteine
Institutional SourceBeutler Lab
Gene Model predicted gene model for protein(s): [ENSMUSP00000004850] [ENSMUSP00000083971]
AlphaFold Q61549
SMART Domains Protein: ENSMUSP00000004850
Gene: ENSMUSG00000004730
AA Change: Y156C

DomainStartEndE-ValueType
low complexity region 19 32 N/A INTRINSIC
EGF 35 80 1.43e-1 SMART
EGF_CA 81 122 3.59e-7 SMART
EGF_CA 133 172 4.56e-9 SMART
EGF_CA 173 221 1.29e-8 SMART
EGF_CA 222 271 2.31e-10 SMART
EGF_CA 272 318 1.06e-9 SMART
EGF_CA 319 367 1.18e-7 SMART
GPS 591 641 2.57e-19 SMART
Pfam:7tm_2 644 885 2.1e-63 PFAM
Predicted Effect unknown
SMART Domains Protein: ENSMUSP00000083971
Gene: ENSMUSG00000004730
AA Change: Y156C

DomainStartEndE-ValueType
low complexity region 19 32 N/A INTRINSIC
EGF 35 80 1.43e-1 SMART
EGF_CA 81 122 3.59e-7 SMART
EGF_CA 133 172 4.56e-9 SMART
EGF_CA 173 221 1.29e-8 SMART
EGF_CA 222 271 2.31e-10 SMART
EGF_CA 272 318 1.06e-9 SMART
EGF_CA 319 367 1.18e-7 SMART
GPS 591 641 2.57e-19 SMART
Pfam:7tm_2 644 885 2.1e-63 PFAM
Predicted Effect unknown
Meta Mutation Damage Score 0.4177 question?
Is this an essential gene? Probably nonessential (E-score: 0.158) question?
Phenotypic Category
Phenotype question? Literature verified References
FACS macrophages - decreased
Candidate Explorer Status CE: excellent candidate; Verification probability: 0.438; ML prob: 0.438; human score: 2.5
Single pedigree
Linkage Analysis Data
Penetrance  
Alleles Listed at MGI

All Mutations and Alleles(5) : Chemically induced (ENU)(2) Targeted(3)

Lab Alleles
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00090:Adgre1 APN 17 57450055 missense probably benign 0.00
IGL00966:Adgre1 APN 17 57419335 missense probably benign 0.04
IGL01680:Adgre1 APN 17 57402620 missense unknown
IGL01724:Adgre1 APN 17 57444064 nonsense probably null
IGL02172:Adgre1 APN 17 57478879 missense probably damaging 1.00
IGL02260:Adgre1 APN 17 57447891 missense probably benign 0.01
IGL02272:Adgre1 APN 17 57450021 nonsense probably null
IGL02336:Adgre1 APN 17 57411024 nonsense probably null
IGL02346:Adgre1 APN 17 57443919 missense probably benign 0.15
IGL02398:Adgre1 APN 17 57402824 nonsense probably null
IGL02618:Adgre1 APN 17 57444021 missense possibly damaging 0.66
IGL02690:Adgre1 APN 17 57480921 missense probably damaging 1.00
IGL02936:Adgre1 APN 17 57478833 missense probably benign 0.26
IGL03112:Adgre1 APN 17 57448029 splice site probably null
IGL03350:Adgre1 APN 17 57401908 missense probably benign 0.16
F480 UTSW 17 57444063 missense probably damaging 1.00
Onion UTSW 17 57402841 nonsense probably null
Scallion UTSW 17 57401977 missense possibly damaging 0.90
R0049:Adgre1 UTSW 17 57402841 nonsense probably null
R0153:Adgre1 UTSW 17 57443939 missense possibly damaging 0.92
R0277:Adgre1 UTSW 17 57444060 missense probably benign 0.00
R0278:Adgre1 UTSW 17 57447872 missense probably benign 0.07
R0323:Adgre1 UTSW 17 57444060 missense probably benign 0.00
R0389:Adgre1 UTSW 17 57406839 missense possibly damaging 0.80
R0492:Adgre1 UTSW 17 57402742 missense unknown
R0621:Adgre1 UTSW 17 57441359 missense probably damaging 0.98
R0647:Adgre1 UTSW 17 57411003 missense probably damaging 1.00
R1310:Adgre1 UTSW 17 57447936 missense probably benign 0.00
R1601:Adgre1 UTSW 17 57441353 missense probably benign 0.01
R1689:Adgre1 UTSW 17 57449921 missense probably benign 0.31
R1708:Adgre1 UTSW 17 57401974 missense possibly damaging 0.93
R1796:Adgre1 UTSW 17 57441350 missense probably benign 0.43
R1839:Adgre1 UTSW 17 57441299 missense probably benign 0.00
R1860:Adgre1 UTSW 17 57441363 missense probably benign 0.00
R2165:Adgre1 UTSW 17 57419338 missense probably damaging 0.97
R2219:Adgre1 UTSW 17 57401912 missense possibly damaging 0.92
R2519:Adgre1 UTSW 17 57410956 missense probably damaging 1.00
R3874:Adgre1 UTSW 17 57401925 missense probably benign 0.08
R3911:Adgre1 UTSW 17 57447860 missense probably damaging 1.00
R4190:Adgre1 UTSW 17 57402811 missense unknown
R4439:Adgre1 UTSW 17 57447954 missense probably damaging 1.00
R4513:Adgre1 UTSW 17 57410947 missense probably benign 0.34
R4529:Adgre1 UTSW 17 57420519 missense possibly damaging 0.92
R4543:Adgre1 UTSW 17 57406874 missense probably benign 0.07
R4610:Adgre1 UTSW 17 57450073 missense possibly damaging 0.50
R4665:Adgre1 UTSW 17 57480947 missense probably benign 0.20
R4911:Adgre1 UTSW 17 57447832 missense possibly damaging 0.57
R4928:Adgre1 UTSW 17 57444064 nonsense probably null
R4942:Adgre1 UTSW 17 57406903 missense probably damaging 1.00
R4946:Adgre1 UTSW 17 57443918 missense probably benign 0.33
R4953:Adgre1 UTSW 17 57441321 missense probably damaging 0.99
R5107:Adgre1 UTSW 17 57401977 missense possibly damaging 0.90
R5366:Adgre1 UTSW 17 57402817 missense probably benign 0.39
R5590:Adgre1 UTSW 17 57445034 missense probably damaging 1.00
R5619:Adgre1 UTSW 17 57420437 missense probably benign 0.15
R5699:Adgre1 UTSW 17 57481007 missense probably benign 0.43
R5734:Adgre1 UTSW 17 57443990 missense probably benign 0.00
R5860:Adgre1 UTSW 17 57445034 missense probably damaging 1.00
R6039:Adgre1 UTSW 17 57406859 missense probably benign 0.28
R6039:Adgre1 UTSW 17 57406859 missense probably benign 0.28
R6149:Adgre1 UTSW 17 57445018 missense probably benign 0.08
R6478:Adgre1 UTSW 17 57401955 missense possibly damaging 0.81
R6709:Adgre1 UTSW 17 57406917 missense probably benign 0.10
R6864:Adgre1 UTSW 17 57478879 missense probably damaging 1.00
R6945:Adgre1 UTSW 17 57410844 missense probably benign 0.01
R6945:Adgre1 UTSW 17 57420399 missense probably benign 0.39
R6988:Adgre1 UTSW 17 57408445 missense probably benign 0.00
R7019:Adgre1 UTSW 17 57410945 missense probably damaging 0.98
R7154:Adgre1 UTSW 17 57444087 splice site probably null
R7347:Adgre1 UTSW 17 57420441 missense probably damaging 1.00
R7459:Adgre1 UTSW 17 57449933 missense probably damaging 1.00
R7709:Adgre1 UTSW 17 57402519 missense unknown
R7939:Adgre1 UTSW 17 57449938 missense probably damaging 0.98
R7977:Adgre1 UTSW 17 57447987 missense possibly damaging 0.54
R7987:Adgre1 UTSW 17 57447987 missense possibly damaging 0.54
R8187:Adgre1 UTSW 17 57420349 missense probably benign 0.00
R8210:Adgre1 UTSW 17 57445061 missense possibly damaging 0.94
R8223:Adgre1 UTSW 17 57361692 missense probably damaging 0.99
R8344:Adgre1 UTSW 17 57408459 missense probably benign 0.12
R8698:Adgre1 UTSW 17 57402003 missense probably benign 0.05
Z1176:Adgre1 UTSW 17 57361729 missense possibly damaging 0.76
Z1177:Adgre1 UTSW 17 57419374 missense probably damaging 0.96
Mode of Inheritance Autosomal Recessive
Local Stock
Repository
Last Updated 2021-11-01 7:45 AM by Diantha La Vine
Record Created 2016-02-28 10:07 AM by Bruce Beutler
Record Posted 2016-04-28
Phenotypic Description

Figure 1. Lomax mice exhibited decreased frequencies of peripheral macrophages. Flow cytometric analysis of peripheral blood was utilized to determine macrophage frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The lomax phenotype was initially identified among G3 mice of the pedigree R4190, some of which showed a reduction in the frequency of F4/80+ macrophages in the peripheral blood (Figure 1).

Nature of Mutation

Figure 2. Linkage mapping of the reduced frequency of peripheral macrophages using a recessive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 47 mutations (X-axis) identified in the G1 male of pedigree R4190. Normalized phenotype data are shown for single locus linkage analysis with consideration of G2 dam identity.  Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 47 mutations. The reduction in frequency of F4/80+ macrophages was linked by continuous variable mapping to a mutation in Emr1 (alternatively, Adgre1):  an A to G transition at base pair 57,402,811 (v38) on chromosome 17, or base pair 44,161 in the GenBank genomic region NC_000083 encoding Emr1. Linkage was found with a recessive model of inheritance (P = 1.284 x 10-6), wherein 4 variant homozygous departed phenotypically from 16 homozygous reference mice and 20 heterozygous mice (Figure 2).

 

The mutation corresponds to residue 507 in the mRNA sequence NM_010130 within exon 5 of 22 total exons.

 

491 AACTCTGTGGGAAGCTACAGCTGTACCTGTCAA

151 -N--S--V--G--S--Y--S--C--T--C--Q-

 

The mutated nucleotide is indicated in red.  The mutation results in a tyrosine (Y) to cysteine (C) substitution at position 156 (Y156C) in the F4/80 protein.

Illustration of Mutations in
Gene & Protein
Protein Prediction

Emr1 encodes the F4/80 glycoprotein, which is a cell surface receptor that contains seven transmembrane (TM7) domains (Figure 3). F4/80 is a member of the B2 class of TM7 receptors, which are characterized by a long N-terminal extracellular region. Following a signal peptide, the extracellular N-terminal third of F4/80 (amino acids 32-367) contains seven tandem EGF-like domains (1), approximately 50 amino acids in length and characterized by the presence of six cysteine residues positioned to form three disulfide bonds within each domain. The EGF-like domains mediate protein-protein interactions. Five of the seven EGF-like domains of F4/80 contain consensus Ca2+-binding motifs. The C-terminal third of F4/80 (amino acids ~645-931) contains seven transmembrane segments, three extracellular loops, and three intracellular loops, with the C-terminus of the protein located intracellularly. Between the EGF-like domains at the N-terminus and the TM7 structure at the C-terminus, the middle third, or stalk region, of F4/80 has no significant similarity to other known protein domains. This portion of the protein (amino acids ~399-642) contains 4 potential N-glycosylation sites and 47 potential O-glycosylation sites (i.e. approximately 20% serine/threonine content). The lomax mutation results in substitution of tyrosine 156 to a cysteine; amino acid 156 is within the extracellular N-terminal tail of F4/80 (amino acids 32-367), more specifically within the third EGF-like domain (amino acids 133-172).

 

Please see the record for F4/80 for more information about Emr1.

Putative Mechanism

F4/80 is best known as a macrophage-specific marker. The physiological function of F4/80 has only begun to be investigated, and evidence of its function remains sparse. F4/80-/- mice are healthy and fertile, and display no gross abnormalities or phenotypes (2;3). Histological analysis showed that immune tissues appear normal, and flow cytometric analysis demonstrated normal populations of B and T cells. Furthermore, F4/80-/- macrophage development, as determined by examination of expression profiles of several macrophage-restricted cell surface proteins, is comparable to that of wild type mice. F4/80-/- macrophages phagocytose target cells normally, and produce normal levels of nitric oxide and cytokines stimulated by lipopolysaccharide (LPS) or IFN-γ (2).  F4/80-/- mice (and the ENU-induced Emr1F4/80/F4/80 mutants) also display normal resistance to infection by Listeria monocytogenes (3). This finding contrasts with previous work demonstrating that treatment with anti-F4/80 mAb impairs splenic macrophage production of tumor necrosis factor (TNF)-α and interleukin (IL)-12 induced by exposure to heat-killed Listeria (4). However, whether Listeria infection modulates the expression of F4/80 is unknown, as is the molecular effect of anti-F4/80 mAb treatment on cells. F4/80 protein and mRNA expression have not been examined in lomax mice; however, the lomax mutation is proposed to alter the protein-protein interactions between F4/80 and an unidentified protein, subsequently leading to the phenotype observed in the FACS screen.

Primers PCR Primer
lomax_pcr_F: AGTTTGGATAATTTTCTCTGCGCAG
lomax_pcr_R: GTGATACACAAGTTGGGCCTC

Sequencing Primer
lomax_seq_F: TGCGCAGGTAATATCCTCAG
lomax_seq_R: TCCTCAGAGGAGAAGATGGTG
Genotyping

PCR program

1) 94°C 2:00
2) 94°C 0:30
3) 55°C 0:30
4) 72°C 1:00
5) repeat steps (2-4) 40x
6) 72°C 10:00
7) 4°C hold

 

The following sequence of 435 nucleotides is amplified (chromosome 17, + strand):

 

 

1   agtttggata attttctctg cgcaggtaat atcctcaggc tctctgccac aggtctttgg
61  tggtcagcac acagcacata gttcactcac tctcttttac tgccctgcag atgttgatga
121 gtgtctgaca attgggatct gccctaagta ttccaactgc tctaactctg tgggaagcta
181 cagctgtacc tgtcaaccag gctttgtctt gaatggctcc atttgtgaag gtttgcaaca
241 cctggtcctt gcaatttttc tttttttttc ttatttattt atttatttat ttatttattt
301 atttatttat ttatttattc tatttatatc ccaatatcag ttcctctatt ccccccagtc
361 attctcttac acagctcctc cctctattcc accatcttct cctctgagga ggcagaggcc
421 caacttgtgt atcac

 

 

Primer binding sites are underlined and the sequencing primers are highlighted; the mutated nucleotide is shown in red.

References
Science Writers Anne Murray
Illustrators Peter Jurek
AuthorsXue Zhong, Ming Zeng, and Bruce Beutler