Allele | anubis | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Mutation Type | nonsense | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Chromosome | 13 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Coordinate | 101,702,776 bp (GRCm38) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Base Change | A ⇒ T (forward strand) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Gene | Pik3r1 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Gene Name | phosphoinositide-3-kinase regulatory subunit 1 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Synonym(s) | p55alpha, p85alpha, PI3K, p50alpha | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Chromosomal Location | 101,680,563-101,768,217 bp (-) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
MGI Phenotype |
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Phosphatidylinositol 3-kinase phosphorylates the inositol ring of phosphatidylinositol at the 3-prime position. The enzyme comprises a 110 kD catalytic subunit and a regulatory subunit of either 85, 55, or 50 kD. This gene encodes the 85 kD regulatory subunit. Phosphatidylinositol 3-kinase plays an important role in the metabolic actions of insulin, and a mutation in this gene has been associated with insulin resistance. Alternative splicing of this gene results in four transcript variants encoding different isoforms. [provided by RefSeq, Jun 2011] PHENOTYPE: Homozygotes for a targeted null mutation exhibit perinatal lethality associated with hepatic necrosis, chylous ascites, enlarged muscle fibers, calcification of cardiac tissue, and hypoglycemia. Mutants lacking only the major isoform are immunodeficient. [provided by MGI curators] |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Accession Number | NCBI RefSeq: NM_001024955 (variant 1), NM_001077495 (variant 2); MGI:97583 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mapped | Yes | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Amino Acid Change | Tyrosine changed to Stop codon | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Institutional Source | Beutler Lab | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Gene Model | predicted gene model for protein(s): [ENSMUSP00000056774] | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
AlphaFold | P26450 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
SMART Domains |
Protein: ENSMUSP00000056774 Gene: ENSMUSG00000041417 AA Change: Y189*
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Predicted Effect | probably null | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Meta Mutation Damage Score | 0.9755 ![]() |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Is this an essential gene? | Non Essential (E-score: 0.000) ![]() |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Phenotypic Category | Autosomal Recessive | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Candidate Explorer Status | CE: excellent candidate; Verification probability: 0.977; ML prob: 0.9952; human score: -0.5 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Single pedigree Linkage Analysis Data |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Penetrance | 1/1 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Alleles Listed at MGI | All Mutations and Alleles(28) : Gene trapped(20) Targeted(8) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Lab Alleles |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mode of Inheritance | Autosomal Recessive | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Local Stock | Sperm, gDNA | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Repository | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Last Updated | 2020-02-14 3:19 PM by External Program | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Record Created | 2016-02-28 5:35 PM | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Record Posted | 2019-02-05 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Phenotypic Description |
The anubis phenotype was identified among G3 mice of the pedigree R2474, some of which showed a decrease in the B to T cell ratio (Figure 1) due to a decrease in the frequency of total B cells (Figure 2), B1a cells in B1 cells (Figure 3), IgD+ B cells (Figure 4), and IgM+ B cells (Figure 5) with a concomitant increase in the frequency of total T cells (Figure 6), including CD4+ T cells (Figure 7) and CD8+ T cells (Figure 8), all in the peripheral blood. |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Nature of Mutation |
Whole exome HiSeq sequencing of the G1 grandsire identified 31 mutations. All of the above anomalies were linked by continuous variable mapping to two mutations on chromosome 13 in genes Pik3r1 and Parp8. The mutation in Pik3r1 is presumed to be causative as mutations in Pik3r1 cause immunodeficiency in the mouse [see MGI for a list of Pik3r1 alleles; (1;2)]. The Pik3r1 mutation is a T to A transversion at base pair 101,702,776 (v38) on chromosome 13, or base pair 65,442 in the GenBank genomic region NC_000079 encoding Pik3r1. The strongest association was found with a recessive model of linkage to the normalized frequency of total T cells in the peripheral blood, wherein one variant homozygote departed phenotypically from four homozygous reference mice and seven heterozygous mice with a P value of 2.379 x 10-7 (Figure 9).
The mutation corresponds to residue 1,188 in the mRNA sequence NM_001077495 within exon 5 of 16 total exons.
The mutated nucleotide is indicated in red. The mutation results in a substitution of tyrosine 189 to a premature stop codon (Y189*) in the p85α protein; p55α and p50α are not affected. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Illustration of Mutations in Gene & Protein |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Protein Prediction |
Pik3r1 encodes p85α, a regulatory subunit of class IA phosphatidylinositol 3-kinases (PI3Ks). To form a functional class I PI3K, a p110 catalytic subunit forms a heterodimer with a p85 regulatory subunit (3;4). There are three class IA p110 subunits (p110α, p110β, and p110δ [see the record for stinger]) encoded by Pik3ca, Pik3cb, and Pik3cd, respectively, and one class IB p110 subunit, p110γ (encoded by Pik3cg). Five class IA regulatory subunits are encoded by three distinct genes (Pik3r1 (p85α, p55α, p50α), Pik3r2 (p85β) and Pik3r3 (p55γ); p85α, p55α, and p50α are splice variants of Pik3r1 (Figure 10) (5-7). In activated cells, the p85 subunit recruits the p110 subunit to the plasma membrane and activates it (7-9). Conversely, the p85 subunit also inhibits the enzymatic activity of the p110 subunit in quiescent cells (10). The p85 subunits also mediate the interactions of the PI3Ks with the cytoplasmic domains of receptors as well as with adaptor proteins (11). p85α has several binding partners that mediate several functions, including PI3K activation, cell signaling, and cell adhesion. For a comprehensive list of p85α binding partners see Table 1 in (12).
The p55α and p50α isoforms have two SH2 (Src homology 2) domains [nSH2 (N-terminal SH2 domain) and cSH2 (C-terminal SH2 domain)] and a p110-binding domain [iSH2 (inter SH2 domain)]. The splicing of the two variants is the same, but the p55α isoform is two amino acids longer than p50α (13). The nSH2 and cSH2 domains bind to pYxxM motifs (where pY is phosphorylated tyrosine) on several proteins namely activated receptor tyrosine kinases (e.g., PDGFR and EGFR) and adaptor proteins (e.g., (e.g. IRS-1 (14), Grb2, Gab1/2 (GRB2-associated binding protein 2) (15), Shc (16), Crk-L (17) and β-catenin (18)). The interactions between p85α and these proteins derepresses p110 activity and promtes the localization of p85—p110 to the plasma membrane. In addition to binding the p110 subunit, the iSH2 domain binds α/β- and γ-tubulins, which function in vesicle trafficking (α/β-tubulin) and in the microtubule-organizing center in centrosomes (γ-tubulin) (19). The interaction between p85α and the tubulins is proposed to regulate budding or vesicle fusion.
The p85α isoform has the nSH2, cSH2, and iSH2 domains, but also has a SH3 domain at the N-terminus (amino acids 6-78) and a RhoGAP domain (amino acids 126-298). Between the SH3 and RhoGAP domain and between the RhoGAP and nSH2 domain are proline-rich regions. The SH3 domain binds proline-rich target sequences (e.g., PxxP motifs). p85α can interact with other p85α proteins through the SH3 domains to form homodimers (20). The formation of p85α homodimers is proposed to mask the SH3, proline-rich, and RhoGAP domains until the dimer is disrupted. The interaction between the p85α SH3 domain and its target proteins regulates PI3K activity (21;22), and can also couple CD28 receptor endocytosis with actin polymerization (23). The p85α proline-rich regions bind to the SH3 domains of several target proteins, including Grb2 (24), Crk (25), α-actinin (26), Abl, and the Src family kinases (27-29). The RhoGAP domain shares homology with GAP domains in the Rac/Rho/Cdc42 family of GTPases, which regulate actin dynamics in cell migration, cytokinesis, and vesicle trafficking (30). GAP proteins stimulate GTP hydrolysis of G proteins to switch them from an active GTP-bound conformation to an inactive GDP-bound state. p85α binds to the GTP forms of Rac1 and Cdc42, leading to PI3K activation, but p85α does not exert GAP activity at physiological levels in the cell (31;32). p85α has GAP activity towards Rab4 and Rab5 (33;34); Rab4 and Rab5 are GTPases that regulate receptor tyrosine kinase trafficking (35). The RhoGAP domain of p85α binds and positively regulates PTEN, a phosphatase that negatively regulates PI3K activity (36). PTEN dephosphorylates PtdIns(3,4,5)P3 lipids at the 3-position to prevent further activation of downstream Akt signaling.
p85α undergoes several posttranslational modifications including phosphorylation. The p110 subunit can phosphorylate p85α on Ser608, subsequently reducing p85-p110 activity (37). p85α is also phosphorylated on Ser83 by protein kinase A (PKA), leading to increased PI3K-mediated Ras binding and PI3K activation (38). Tyr688 is phosphorylated by Abl and Src family tyrosine kinases, which putatively alters the SH2 binding properties of p85α and reduces the inhibition of p85α on p110, subsequently resulting in PI3K activation (39;39;40;40). Tyr508 is phosphorylated by the PDGFR (41) and in response to IL-8 and/or GM-CSF. The affect of Tyr508 phosphorylation is unknown. p85α is dephosphorylated by SHP-1 and CD148 (39;42). p85α can be ubiquitinated by Cbl-b. p85α ubiquitination does not induce p85α degradation, but prevents p85α recruitment to the T cell receptor co-receptor, CD28 (43). The anubis mutation results in a substitution of tyrosine 189 to a premature stop codon (Y189*) within the RhoGAP domain. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Expression/Localization | Pik3r1 is ubiquitously expressed in the mouse (BioGPS). The p85α and p50α mRNAs are most abundant in the liver, and the p85α, p55α, and p50α mRNAs is also highly expressed in the brain and kidney (13). The p85α protein was highly expressed in every rat tissue examined (6;13). The p55α and p50α proteins were highly expressed in the brain, liver, and kidney; p55α, and p50α were expressed at low levels in fat and muscle (13). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Background |
PI3Ks are highly conserved lipid signaling kinases. The PI3Ks are divided into class I, II, or III based on their molecular structure, regulation, and in vivo substrate specificities [reviewed in (11;44)]. Class I PI3Ks include class IA and class IB PI3K subclasses; class IA PI3Ks are typically activated downstream of tyrosine kinase-linked receptors, while class IB PI3Ks are activated downstream of G protein-coupled receptors [reviewed in (11)].
After cell stimulation by growth factors, hormones, cytokines, or antigens, the PI3Ks are recruited to the inner face of the plasma membrane where they phosphorylate phosphatidylinositol (PtdIns), PtdIns 4-phosphate, and/or PtdIns-4,5-bisphosphate (PtdIns(4,5)P2; PIP2) at the D3 position of the inositol ring, generating their respective D3’ phosphorylated derivatives [e.g., PIP2 phosphorylation generates the second messenger phosphatidylinositol-3,4,5-trisphosphate (PtdIns(3,4,5)P3; PIP3); (4;45); reviewed in (11;44); Figure 11]. PIP3 recruits downstream signaling proteins to the plasma membrane including the serine-threonine kinases Akt (alternatively, protein kinase B [PKB]) and phosphoinositide-dependent kinase 1 (PDK1) as well as Tec family tyrosine kinases and exchange factors that regulate heterotrimeric guanosine triphosphate (GTP)-binding proteins such as Vav, PLCγ1, and PLCγ2 (see the record for queen) [(4); reviewed in (11;44)]. Subsequently, activation of downstream targets (e.g., Rac1, p21-activated kinase 1 [PAK1], MEK, ERK1, and ERK2) mediates several cellular processes including growth, proliferation, differentiation, survival, apoptosis, adhesion, and migration [(46); reviewed in (44)]. PI3K-associated signaling can be antagonized by PTEN (phosphatase and tensin homologue deleted on chromosome 10) and SHIP (SH2-containing inositol phosphatase), lipid phosphatases that dephosphorylate PIP3 on the D3 and D5 positions, respectively [reviewed in (47)]. For more information on the PI3K signaling pathway, please see the record for sothe and stinger.
PIK3R1 mutations are linked to immunodeficiency-36 (IMD36; OMIM: #616005; (48)), agammalobulinemia-7 (AGM7; OMIM: #615214; (49)), and SHORT (Short stature, Hyperextensible joints, Ocular depression, Rieger anomaly, and Teeth delay) syndrome (OMIM: #269880; (50;51)). Patients with IMD36 exhibited recurrent respiratory infections and bacterial infections (48). None of the patients had symptoms of allergy, autoimmunity, splenomegaly, or lymphadenopathy (48). The patients had decreased numbers of naïve CD4+ and CD8+ T cells; one patient had decreased numbers of memory B cells (48). All IMD36 patients exhibited impaired B cell function with hypogammaglobulinemia (48). A patient with AGM7 exhibited defects in early B cell development and developed juvenile idiopathic arthritis, erythema nodosum, and inflammatory bowel disease (49). Patients with SHORT syndrome exhibit a range of clinical phenotypes (see the description of the acryonym). PIK3R1 mutations are observed at high frequency (20%) in endometrial cancer (52).
Pik3r1-deficient (Pik3r1-/-) mice exhibit perinatal lethality by postnatal day 7 (53;54). The Pik3r1-/- mice had hepatocyte necrosis, chylous ascites, enlarged skeletal muscle fibers, brown fat necrosis, and cardiac tissue calcification. Mice with selective deletion of p85α (p85α-/-) are viable (55). The p85α-/- mice have increased expression of the p55α and p50α isoforms. In the p85α-/- mice, the p50α can bind p110 to partially compensate for the loss of p85α (55). The Pik3r1-/- and p85α-/- mice have increased glucose uptake and insulin sensitivity (53;55). Mice with selective deletion of the p55α and p50α isoforms (p55α/p50α-/-) are viable and maintain normal blood glucose levels, but have lower fasting insulin levels (56). The p55α/p50α-/- mice exhibited increased insulin sensitivity and increased insulin-stimulated glucose transport in extensor digitorum longus muscle tissues and adipocytes. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Putative Mechanism | Pik3r1-/- chimeric mice (using a Rag2-deficient blastocyst complementation system) had reduced numbers of peripheral blood mature B cells and reduced serum levels of IgM, IgG1, IgG2a, IgG3, and IgA (54). The remaining B cells exhibited reduced proliferative responses after exposure to anti-IgM, anti-CD40, and lipopolysaccharide; T cell development and proliferative responses were normal. The anubis mice exhibited defects in T cell development similar to patients with IMD36 (48), but in contrast to the Pik3r1-/- chimeric mice (54). The immune phenotypes in the anubis mice indicate that p85αanubis exhibits loss-of-function. Some PI3K function may be rescued by the expression of intact p55α and p50α in the anubis mice. Intact p55 and p50 should be present precluding the presence of metabolic effects described previously. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Primers |
PCR Primer anubis_pcr_F: TTCTCACTTGGGCAGGCTTC anubis_pcr_R: GTCAGTGTGCCATGCTTCTG Sequencing Primer anubis_seq_F: CAATAGGGTGTCTTCTATCAGATGC anubis_seq_R: CAGTGTGCCATGCTTCTGTTCTG |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Genotyping | PCR program 1) 94°C 2:00 The following sequence of 461 nucleotides is amplified (chromosome 13, - strand): 1 gtcagtgtgc catgcttctg ttctgcatcg ctcccttccc tgtgtctcgt ttaagtccca Primer binding sites are underlined and the sequencing primers are highlighted; the mutated nucleotide is shown in red. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
References | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Science Writers | Anne Murray | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Illustrators | Peter Jurek, Katherine Timer | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Authors | Jeff SoRelle, Tao Yue, Ming Zeng, Xue Zhong, Bruce Beutler |