Phenotypic Mutation 'Porkchop'

• Allele: Porkchop
• Mutation Type: missense
• Chromosome: 7
• Coordinate: 144,394,444 bp (GRCm39)
• Base Change: T ⇒ C (forward strand)
• Gene: Fgf3
• Gene Name: fibroblast growth factor 3
• Synonym(s): Int-2, Int-P, Fgf-3
• Chromosomal Location: 144,392,349-144,397,085 bp (+) (GRCm39)
• MGI Phenotype: FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the fibroblast growth factor (FGF) family. FGF family members possess broad mitogenic and cell survival activities and are involved in a variety of biological processes including embryonic development, cell growth, morphogenesis, tissue repair, tumor growth and invasion. This gene was identified by its similarity with mouse fgf3/int-2, a proto-oncogene activated in virally induced mammary tumors in the mouse. Frequent amplification of this gene has been found in human tumors, which may be important for neoplastic transformation and tumor progression. Studies of the similar genes in mouse and chicken suggested the role in inner ear formation. [provided by RefSeq, Jul 2008] ; PHENOTYPE: Mice homozygous for disruptions of this gene have short, thickened and curved tails. Otic vesicles are somewhat smaller than normal. Mice with some alleles apparently display more severe phenotypes. [provided by MGI curators]
• Mapped: Yes
• Amino Acid Change: Valine changed to Alanine
• Institutional Source: Beutler Lab
• Gene Model: predicted gene model for protein(s): [ENSMUSP00000101518] [ENSMUSP00000115205]
• AlphaFold: no structure available at present
• SMART Domains: Protein: ENSMUSP00000101518; Gene: ENSMUSG00000031074; AA Change: V86A

Domain	Start	End	E-Value	Type
signal peptide	1	17	N/A	INTRINSIC
FGF	42	182	1.13e-66	SMART
low complexity region	206	219	N/A	INTRINSIC

• Predicted Effect: probably damaging ; PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
  (Using ENSMUST00000105898)
• SMART Domains: Protein: ENSMUSP00000115205; Gene: ENSMUSG00000031074; AA Change: V86A

Domain	Start	End	E-Value	Type
signal peptide	1	17	N/A	INTRINSIC
FGF	42	154	3.75e-40	SMART

• Predicted Effect: probably damaging ; PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
  (Using ENSMUST00000155320)
• Meta Mutation Damage Score: 0.6412
• Is this an essential gene?: Essential (E-score: 1.000)
• Phenotypic Category: Autosomal Recessive
• Mode of Inheritance: Autosomal Recessive
• Local Stock: Live Mice
• Last Updated: 2019-09-04 9:43 PM by Anne Murray
• Record Created: 2016-03-03 10:53 AM by Jamie Russell
• Record Posted: 2018-10-25
• Science Writers: Anne Murray
• Illustrators: Diantha La Vine
• Authors: Lauren Prince, Sara Ludwig, Zhao Zhang and Jamie Russell

Accession Number

NCBI RefSeq: NM_008007; MGI:95517

Alleles Listed at MGI

All Mutations and Alleles(15) Gene trapped(1) Targeted(11) Transgenic(3)

Phenotypic Description

Figure 1. Porkchop mice exhibit curly or kinked tails.

Figure 2. Porkchop mice exhibit reduced body weights compared to wild-type littermates. Scaled body weights are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The porkchop phenotype was identified among G3 mice of the pedigree R4428, some of which showed curly or kinked tails (Figure 1). The mice also showed reduced body weights compared to wild-type littermates (Figure 2).

Nature of Mutation

Figure 3. Linkage mapping of the tail phenotype using a recessive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 45 mutations (X-axis) identified in the G1 male of pedigree R4428. Binary phenotype data are shown for single locus linkage analysis without consideration of G2 dam identity. Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 45 mutations. Both of the above anomalies were linked to a mutation in Fgf3: a T to C transition at base pair 144,840,707 (v38) on chromosome 7, or base pair 2,751 in the GenBank genomic region NC_000073 encoding Fgf3. Linkage was found with a recessive model of inheritance, wherein five variant homozygotes departed phenotypically from three homozygous reference mice and four heterozygous mice with a P value of 0.001349 (Figure 3).  

The mutation corresponds to residue 353 in the mRNA sequence NM_008007 within exon 2 of 3 total exons.

337 GTGGAAGTGGGCGTGGTGGCCATCAAAGGGCTC 81  -V--E--V--G--V--V--A--I--K--G--L-

The mutated nucleotide is indicated in red. The mutation results in a valine to alanine substitution at amino acid 86 (V86A) in the FGF3 protein (Figure 3), and is strongly predicted by PolyPhen-2 to be damaging (score = 1.000).

Protein Prediction

Figure 4. Domain organization of FGF3. The location of the Porkchop mutation is indicated. Domain information is from SMART.

Figure 5. Crystal structure of human basic fibroblast growth factor.  B-strands are numbered and shown in blue, and a-helices are shown in pink. UCSF Chimera model is based on PDB 4FGF, Eriksson, et al. Protein Sci. 2, 1274-1284 (1993). Click on the 3D structure to view it rotate.

Fgf3 (alternatively, int-2) encodes the 245-amino acid fibroblast growth factor-3 (FGF3) protein. FGF3 does not have defined structural domains, but FGF proteins share a similar internal core region containing 28 highly conserved and six invariant amino acids (Figure 4) (1). Ten of these highly conserved residues contribute to ligand-receptor specificity through contact with the FGF receptor (2).

The crystal structure of human basic FGF (alternatively, FGF2) is shown (Figure 5, PDB: #4FGF). Crystallographic studies of FGF1 and FGF2 demonstrate that these proteins contain several conserved structural motifs, including 12 antiparallel β-strands arranged in a triangular array of three four-stranded β-sheets (3;4). Within the β-strands are distinct binding sites for FGF receptors and heparin (5). Most FGFs contain an N-terminal signal peptide which mediates their secretion from cells; other FGFs are secreted using other mechanisms (1).

Four Fgf3 mRNAs in the mouse are derived from the use of two alternative transcription start sites and two alternative polyadenylation sites (6;7). All four mRNAs encode the same protein product (6).

The porkchop mutation results in a valine (V) to alanine (A) substitution at position 86 (V86A) in the FGF3 protein; Val86 is within the conserved FGF region.

Expression/Localization

FGFs are expressed throughout the body in a distinct spatiotemporal pattern, with subfamilies of FGFs generally having similar expression patterns. Fgf3 is expressed in specific tissues during gastrulation and neurulation (8). At embryonic day 6.25 to 9.5, Fgf3 is expressed in extraembryonic tissue and the parietal endoderm as well as the extraembryonic and embryonic (primitive streak) migrating mesoderm (8). Fgf3 is also detected in the hindbrain rhombomeres 5 and 6, adjacent to the primordium of the inner ear as well as in the pharyngeal pouches (8). At E10.5 to postnatal day zero, Fgf3 is expressed in the developing cerebellum, retina, teeth, and inner ear (9). In the mouse embryo, Fgf3 transcripts were detected in the rhombencephalon when the induction of the inner ear occurs. FGF3 is expressed in the hindbrain at the time of otic placode induction.

Background

Figure 6. FGF-associated signaling. The FGF3–FGFR2 complex consists of a receptor homodimer, the FGF ligand, and a heparan sulfate proteoglycan (HSPG). The HSPG stabilizes and sequesters FGFs. After ligand binding and FGFR dimerization, the kinase domains transphosphorylate each other, leading to the docking of adapter proteins and the activation of downstream pathways. Figure and legend adapted from Kelleher et al. ( 2013 ).

In both humans and mice, the FGF family consists of at least 22 members [reviewed in (1)]. FGFs play essential roles in tissue morphogenesis during embryonic development and in adulthood by regulating cell proliferation, differentiation, migration, and survival. The FGFs exert their functions by binding to and activating FGF receptors (FGFRs), receptor tyrosine kinases that exist in at least seven isoforms encoded by four alternatively spliced genes (FGFR1-4) (Figure 6) (10). FGFs also bind to heparin or heparan sulfate proteoglycans (HSPG), accessory molecules which regulate the binding of FGF to the receptor and receptor activation (11-13). Genetic studies in Drosophila support a biological role for the FGF-heparan sulfate interaction, as mutations impairing heparan sulfate biosynthesis also impair FGF signaling during embryonic development (14). Binding of FGFs to FGFRs induces receptor dimerization, promoting trans-autophosphorylation of multiple tyrosine residues on the receptor’s intracellular domain. These phosphorylated tyrosines serve as recruitment and binding sites for docking and signaling molecules, including PLCγ (phospholipase Cγ; see the record queen for information about PLC-γ2) (15), Shc, FRS2α (fibroblast growth factor receptor substrate 2α) and FRS2β (16;17). Major pathways activated by FGFRs are phosphoinositide hydrolysis, the Ras/MAPK pathway, and the PI-3 kinase pathway (10). When inappropriately activated, either by amplification of FGF expression or activating mutations in FGFRs, cells may become transformed causing tumors (18;19).

Targeted mouse mutants of FGFs display a diverse range of phenotypes from embryonic lethality to various tissue-specific phenotypes in adults (1;10). A similar range of phenotypes is observed for FGFR-deficient mice, although in general non-lethal deficiencies in FGFRs appear to cause more severe defects than non-lethal FGF deficiencies. Consistent with this, many FGFs have overlapping patterns of expression, suggesting that functional redundancy exists and that lack of one FGF may be compensated by the function of others.

FGF3-associated signaling is linked to several processes. (i) FGF3 and FGF8 mediate retinal ganglion cell differentiation (20). In zebrafish embyros that express both mutant FGF3 and FGF8, there is a complete lack of neuronal differentiation in the retina. (ii) FGF3 and FGF10 function in inner ear induction (21-23). The inner ear develops from an ectodermal placode that invaginates lateral to hindbrain rhombomeres 5-6 to form the otic vesicle. Fgf3 and Fgf10 double knockout mice do not exhibit initiation of inner ear development (24). (iii) During hindbrain development, FGF3 regulates the expression of the transcription factor Krox20 through the expression of the MAPK signaling pathway member PEA3 (25).

Fgf3-deficient (Fgf3^-/-) mice are viable, but exhibit defects in inner ear, tail, and central nervous system development. Fgf3 conditional knockout mice exhibit slight tail kinks, a milder phenotype than that observed in the Fgf3^-/- mice (24). Fgf3^neo/neo mice often did not survive to adulthood (26). Defects in tail and inner ear development become apparent around E11.5 (26). At E12.5, the mutant embryos have abnormally short, curly, or kinked tails; tail defects are not observed in heterozygous mice. At E12.5 (and after), the mutant mice were smaller than their wild-type littermates and exhibit slightly delayed development. Fgf3^neo/neo mice have defects of inner ear morphogenesis that are incompletely penetrant (26). Mutant mice exhibited variable hyperactivity, circling, and head tilt. In addition, the mice had difficulty righting themselves when placed on their backs (26). The mice did not show ear movement in response to clicking noises from behind, exhibit circling behavior, and did not exhibit a Preyer’s reflex (26). The ear defects are due to a failure of the otocyst to form an endolymphatic duct. A second Fgf3^-/- model lacking the entire FGF3 coding region did not exhibit defects in inner ear development (27). The mice were viable and did not exhibit abnormal behavior. However, the mice did exhibit shortened, thickened, and curved tails. At E10.75, the Fgf3^-/-  otic vesicles were slightly smaller than that in wild-type littermates.  FGF10 was proposed to compensate for the loss of FGF3 expression, thus preventing the severe inner ear defects. Mice that lacked both Fgf3 and Fgf10 exhibited reduced otic vesicles. A mouse expressing Fgf3 with exon 2 deleted (Fgf3^Δ2) exhibited increased rates of lethality by weaning age (21). Homozygote Fgf3^Δ2 mice exhibited loss of the endolymphatic duct and sac as well as the common crus, dilation of the remaining epithelium, and poor coiling of the cochlea (21). All of the heterozygote Fgf3^Δ2 mice exhibited comparable auditory thresholds to wild-type mice and did not exhibit abnormal behavior. In contrast, homozygous Fgf3^Δ2 mice had reduced auditory thresholds and exhibited circling as well as head tilt. Fgf3^Δ2/Δ2 mice had short, curly tails (21).

In humans, point mutations in FGFR1, FGFR2, or FGFR3 result in impaired cranial, digital and skeletal development, including craniosynostosis syndromes (premature fusion of cranial sutures), skeletal dysplasia (dwarfism), and distal limb abnormalities (i.e. syndactyly) [(28); OMIM: #136350, #176943, #134934]. Mutations in FGF3 are linked to deafness, congenital with inner ear agenesis, microtia, and microdontia; OMIM: #610706).

Putative Mechanism

The porkchop mice have curly/kinked tails similar to the Fgf3^neo/neo and Fgf3^Δ2/Δ2 mice (24;26). The tail defect is due to abnormalities of the posterior primitive streak-derived mesoderm (26). In the kinked tails of the mutant mice, normally shaped vertebrae were interspersed with abnormally shaped vertebrae. Overt circling behavior was not observed in the porkchop mice, and inner ear morphology was not examined.

Primers

PCR Primer
Porkchop_pcr_F: ATTAAGGTCTCCCGCACAGTG
Porkchop_pcr_R: TTGAGTCTGGCATGACCTG

Sequencing Primer
Porkchop_seq_F: GCACAGTGGCAGGATGC
Porkchop_seq_R: ACCTGGGGGCTAAGAAGTCTATCTC

Genotyping

PCR program

1) 94°C 2:00
2) 94°C 0:30
3) 55°C 0:30
4) 72°C 1:00
5) repeat steps (2-4) 40x
6) 72°C 10:00
7) 4°C hold

The following sequence of 406 nucleotides is amplified (chromosome 7, + strand):

1   attaaggtct cccgcacagt ggcaggatgc ccctttcctt accacctgct caatgttttc
61  ttcctaccag gacttccaac cagacctgtc ccagcttcct gagcctagag ggggaagctg
121 gctcaggctg aggttctgct taggttgaga cgttgatgga ctcttcctga ctctttccag
181 gcatcctgga gattactgcg gtggaagtgg gcgtggtggc catcaaaggg ctcttttctg
241 ggcggtacct ggccatgaac aagagaggac ggctgtatgc ttcggtgagt tccattactg
301 gtgggcaggt gctgatggaa taaccatctg gcttgagcat ctgattgggg gacagaagag
361 gacatgagag atagacttct tagcccccag gtcatgccag actcaa

Primer binding sites are underlined and the sequencing primers are highlighted; the mutated nucleotide is shown in red.

References

  1. Ornitz, D. M., and Itoh, N. (2001) Fibroblast Growth Factors. Genome Biol. 2, REVIEWS3005.

  2. Plotnikov, A. N., Hubbard, S. R., Schlessinger, J., and Mohammadi, M. (2000) Crystal Structures of Two FGF-FGFR Complexes Reveal the Determinants of Ligand-Receptor Specificity. Cell. 101, 413-424.

  3. Zhu, X., Komiya, H., Chirino, A., Faham, S., Fox, G. M., Arakawa, T., Hsu, B. T., and Rees, D. C. (1991) Three-Dimensional Structures of Acidic and Basic Fibroblast Growth Factors. Science. 251, 90-93.

  4. Eriksson, A. E., Cousens, L. S., Weaver, L. H., and Matthews, B. W. (1991) Three-Dimensional Structure of Human Basic Fibroblast Growth Factor. Proc Natl Acad Sci U S A. 88, 3441-3445.

  5. Plotnikov, A. N., Schlessinger, J., Hubbard, S. R., and Mohammadi, M. (1999) Structural Basis for FGF Receptor Dimerization and Activation. Cell. 98, 641-650.

  6. Mansour, S. L., and Martin, G. R. (1988) Four Classes of mRNA are Expressed from the Mouse Int-2 Gene, a Member of the FGF Gene Family. EMBO J. 7, 2035-2041.

  7. Smith, R., Peters, G., and Dickson, C. (1988) Multiple RNAs Expressed from the Int-2 Gene in Mouse Embryonal Carcinoma Cell Lines Encode a Protein with Homology to Fibroblast Growth Factors. EMBO J. 7, 1013-1022.

  8. Wilkinson, D. G., Peters, G., Dickson, C., and McMahon, A. P. (1988) Expression of the FGF-Related Proto-Oncogene Int-2 during Gastrulation and Neurulation in the Mouse. EMBO J. 7, 691-695.

  9. Wilkinson, D. G., Bhatt, S., and McMahon, A. P. (1989) Expression Pattern of the FGF-Related Proto-Oncogene Int-2 Suggests Multiple Roles in Fetal Development. Development. 105, 131-136.

  10. Eswarakumar, V. P., Lax, I., and Schlessinger, J. (2005) Cellular Signaling by Fibroblast Growth Factor Receptors. Cytokine Growth Factor Rev. 16, 139-149.

  11. Yayon, A., Klagsbrun, M., Esko, J. D., Leder, P., and Ornitz, D. M. (1991) Cell Surface, Heparin-Like Molecules are Required for Binding of Basic Fibroblast Growth Factor to its High Affinity Receptor. Cell. 64, 841-848.

  12. Rapraeger, A. C., Krufka, A., and Olwin, B. B. (1991) Requirement of Heparan Sulfate for bFGF-Mediated Fibroblast Growth and Myoblast Differentiation. Science. 252, 1705-1708.

  13. Ornitz, D. M., Yayon, A., Flanagan, J. G., Svahn, C. M., Levi, E., and Leder, P. (1992) Heparin is Required for Cell-Free Binding of Basic Fibroblast Growth Factor to a Soluble Receptor and for Mitogenesis in Whole Cells. Mol Cell Biol. 12, 240-247.

  14. Lin, X., Buff, E. M., Perrimon, N., and Michelson, A. M. (1999) Heparan Sulfate Proteoglycans are Essential for FGF Receptor Signaling during Drosophila Embryonic Development. Development. 126, 3715-3723.

  15. Mohammadi, M., Honegger, A. M., Rotin, D., Fischer, R., Bellot, F., Li, W., Dionne, C. A., Jaye, M., Rubinstein, M., and Schlessinger, J. (1991) A Tyrosine-Phosphorylated Carboxy-Terminal Peptide of the Fibroblast Growth Factor Receptor (Flg) is a Binding Site for the SH2 Domain of Phospholipase C-Gamma 1. Mol Cell Biol. 11, 5068-5078.

  16. Ong, S. H., Guy, G. R., Hadari, Y. R., Laks, S., Gotoh, N., Schlessinger, J., and Lax, I. (2000) FRS2 Proteins Recruit Intracellular Signaling Pathways by Binding to Diverse Targets on Fibroblast Growth Factor and Nerve Growth Factor Receptors. Mol Cell Biol. 20, 979-989.

  17. Dhalluin, C., Yan, K. S., Plotnikova, O., Lee, K. W., Zeng, L., Kuti, M., Mujtaba, S., Goldfarb, M. P., and Zhou, M. M. (2000) Structural Basis of SNT PTB Domain Interactions with Distinct Neurotrophic Receptors. Mol Cell. 6, 921-929.

  18. Nguyen, C., Roux, D., Mattei, M. G., de, L. O., Goldfarb, M., Birnbaum, D., and Jordan, B. R. (1988) The FGF-Related Oncogenes Hst and Int.2, and the Bcl.1 Locus are Contained within One Megabase in Band q13 of Chromosome 11, while the Fgf.5 Oncogene Maps to 4q21. Oncogene. 3, 703-708.

  19. Zhan, X., Bates, B., Hu, X. G., and Goldfarb, M. (1988) The Human FGF-5 Oncogene Encodes a Novel Protein Related to Fibroblast Growth Factors. Mol Cell Biol. 8, 3487-3495.

  20. Martinez-Morales, J. R., Del Bene, F., Nica, G., Hammerschmidt, M., Bovolenta, P., and Wittbrodt, J. (2005) Differentiation of the Vertebrate Retina is Coordinated by an FGF Signaling Center. Dev Cell. 8, 565-574.

  21. Hatch, E. P., Noyes, C. A., Wang, X., Wright, T. J., and Mansour, S. L. (2007) Fgf3 is Required for Dorsal Patterning and Morphogenesis of the Inner Ear Epithelium. Development. 134, 3615-3625.

  22. Represa, J., Leon, Y., Miner, C., and Giraldez, F. (1991) The Int-2 Proto-Oncogene is Responsible for Induction of the Inner Ear. Nature. 353, 561-563.

  23. Wright, T. J., and Mansour, S. L. (2003) Fgf3 and Fgf10 are Required for Mouse Otic Placode Induction. Development. 130, 3379-3390.

  24. Urness, L. D., Paxton, C. N., Wang, X., Schoenwolf, G. C., and Mansour, S. L. (2010) FGF Signaling Regulates Otic Placode Induction and Refinement by Controlling both Ectodermal Target Genes and Hindbrain Wnt8a. Dev Biol. 340, 595-604.

  25. Weisinger, K., Kayam, G., Missulawin-Drillman, T., and Sela-Donenfeld, D. (2010) Analysis of Expression and Function of FGF-MAPK Signaling Components in the Hindbrain Reveals a Central Role for FGF3 in the Regulation of Krox20, Mediated by Pea3. Dev Biol. 344, 881-895.

  26. Mansour, S. L., Goddard, J. M., and Capecchi, M. R. (1993) Mice Homozygous for a Targeted Disruption of the Proto-Oncogene Int-2 have Developmental Defects in the Tail and Inner Ear. Development. 117, 13-28.

  27. Alvarez, Y., Alonso, M. T., Vendrell, V., Zelarayan, L. C., Chamero, P., Theil, T., Bosl, M. R., Kato, S., Maconochie, M., Riethmacher, D., and Schimmang, T. (2003) Requirements for FGF3 and FGF10 during Inner Ear Formation. Development. 130, 6329-6338.

  28. McIntosh, I., Bellus, G. A., and Jab, E. W. (2000) The Pleiotropic Effects of Fibroblast Growth Factor Receptors in Mammalian Development. Cell Struct Funct. 25, 85-96.