Phenotypic Mutation 'macadamias2' (pdf version)
Allelemacadamias2
Mutation Type missense
Chromosome3
Coordinate94,387,193 bp (GRCm38)
Base Change G ⇒ A (forward strand)
Gene Rorc
Gene Name RAR-related orphan receptor gamma
Synonym(s) Thor, thymus orphan receptor, RORgamma
Chromosomal Location 94,372,794-94,398,276 bp (+)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a DNA-binding transcription factor and is a member of the NR1 subfamily of nuclear hormone receptors. The specific functions of this protein are not known; however, studies of a similar gene in mice have shown that this gene may be essential for lymphoid organogenesis and may play an important regulatory role in thymopoiesis. In addition, studies in mice suggest that the protein encoded by this gene may inhibit the expression of Fas ligand and IL2. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit lack of peripheral and mesenteric lymph nodes and Peyer's patches, reduced numbers of thymocytes, and increased apoptosis with loss of thymic expression of anti-apoptosic factor Bcl-xL. [provided by MGI curators]
Accession Number

NCBI RefSeq: NM_011281, NM_001293734; MGI:104856

Mapped Yes 
Limits of the Critical Region 94372794 - 94398276 bp
Amino Acid Change Cysteine changed to Tyrosine
Institutional SourceBeutler Lab
Gene Model predicted gene model for protein(s): [ENSMUSP00000029795] [ENSMUSP00000143763] [ENSMUSP00000143610]
SMART Domains Protein: ENSMUSP00000029795
Gene: ENSMUSG00000028150
AA Change: C48Y

DomainStartEndE-ValueType
ZnF_C4 28 99 7.2e-37 SMART
low complexity region 116 133 N/A INTRINSIC
HOLI 320 474 3.78e-22 SMART
Predicted Effect probably damaging

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
(Using ENSMUST00000029795)
SMART Domains Protein: ENSMUSP00000143763
Gene: ENSMUSG00000028150
AA Change: C27Y

DomainStartEndE-ValueType
ZnF_C4 7 78 7.2e-37 SMART
low complexity region 95 112 N/A INTRINSIC
HOLI 299 453 3.78e-22 SMART
Predicted Effect probably damaging

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
(Using ENSMUST00000197040)
SMART Domains Protein: ENSMUSP00000143610
Gene: ENSMUSG00000028150
AA Change: C33Y

DomainStartEndE-ValueType
ZnF_C4 13 84 7.2e-37 SMART
low complexity region 101 118 N/A INTRINSIC
PDB:3L0L|B 243 309 1e-22 PDB
Predicted Effect probably damaging

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
(Using ENSMUST00000200009)
Meta Mutation Damage Score 0.636 question?
Is this an essential gene? Probably essential (E-score: 0.871) question?
Phenotypic Category
Phenotypequestion? Literature verified References
FACS B:T cells - increased
FACS B1b cells - increased
FACS B2 cells - decreased
FACS CD4:CD8 - decreased
FACS CD4+ T cells - decreased 10963675
FACS CD4+ T cells in CD3+ T cells - decreased 10963675
FACS CD44+ CD4 MFI - increased
FACS CD44+ CD8 MFI - increased
FACS CD8+ T cells in CD3+ T cells - increased 10963675
FACS effector memory CD4 T cells in CD4 T cells - increased 25411202
FACS effector memory CD8 T cells in CD8 T cells - increased
FACS IgD MFI - increased
FACS macrophages - increased
FACS naive CD8 T cells in CD8 T cells - decreased
NALP3 inflammasome signaling defect
NLRP3 inflammasome: high response
T-dependent humoral response defect- decreased antibody response to OVA+ alum immunization
T-dependent humoral response defect- decreased antibody response to rSFV
Candidate Explorer Status CE: excellent candidate; human score: 2.5; ML prob: 0.97
Single pedigree
Linkage Analysis Data
Penetrance  
Alleles Listed at MGI

All Mutations and Alleles(10) : Chemically induced (ENU)(2) Chemically induced (other) (1) Radiation induced(1) Targeted(6)

Lab Alleles
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01626:Rorc APN 3 94388787 missense probably damaging 1.00
beto UTSW 3 94377608 splice site probably null
cashew UTSW 3 94391153 missense probably damaging 1.00
chestnut UTSW 3 94377609 splice site probably benign
macadamias UTSW 3 94397302 nonsense probably null
R0014:Rorc UTSW 3 94377613 splice site probably benign
R0115:Rorc UTSW 3 94377609 splice site probably benign
R0365:Rorc UTSW 3 94388762 missense probably damaging 1.00
R1470:Rorc UTSW 3 94397302 nonsense probably null
R1470:Rorc UTSW 3 94397302 nonsense probably null
R1914:Rorc UTSW 3 94391173 missense probably damaging 1.00
R1915:Rorc UTSW 3 94391173 missense probably damaging 1.00
R2142:Rorc UTSW 3 94389526 missense probably benign 0.04
R2510:Rorc UTSW 3 94389120 missense probably benign 0.30
R4135:Rorc UTSW 3 94389519 missense probably damaging 1.00
R4181:Rorc UTSW 3 94387193 missense probably damaging 1.00
R4574:Rorc UTSW 3 94388984 missense probably benign 0.00
R4701:Rorc UTSW 3 94391710 missense probably null 1.00
R5014:Rorc UTSW 3 94391153 missense probably damaging 1.00
R5233:Rorc UTSW 3 94397325 missense probably benign 0.26
R6758:Rorc UTSW 3 94387518 missense possibly damaging 0.90
R7069:Rorc UTSW 3 94372907 nonsense probably null
R7162:Rorc UTSW 3 94377608 splice site probably null
R7169:Rorc UTSW 3 94389180 missense probably benign 0.00
X0063:Rorc UTSW 3 94391751 missense probably damaging 0.99
Mode of Inheritance Autosomal Recessive
Local Stock
Repository
Last Updated 2019-09-04 9:43 PM by Diantha La Vine
Record Created 2016-03-04 11:30 PM by Jin Huk Choi
Record Posted 2016-05-09
Phenotypic Description

Figure 1. Homozygous macadamias2 mice exhibit increased B to T cell ratios. Flow cytometric analysis of peripheral blood was utilized to determine B and T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 2. Homozygous macadamias2 mice exhibit increased frequencies of B1a cells. Flow cytometric analysis of peripheral blood was utilized to determine B1a cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 3. Homozygous macadamias2 mice exhibit increased frequencies of B1b cells. Flow cytometric analysis of peripheral blood was utilized to determine B1b cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 4. Homozygous macadamias2 mice exhibit reduced frequencies of B2 cells. Flow cytometric analysis of peripheral blood was utilized to determine B2 cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 5. Homozygous macadamias2 mice exhibit increased CD4+ to CD8+ T cell ratios. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 6. Homozygous macadamias2 mice exhibit reduced frequencies of CD4+ T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 7. Homozygous macadamias2 mice exhibit reduced frequencies of CD4+ T cells in CD3+ T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 8. Homozygous macadamias2 mice exhibit increased frequencies of effector memory CD4+ T cells in CD4+ T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 9. Homozygous macadamias2 mice exhibit increased CD44+ CD4+ mean fluorescence intensity (MFI). Flow cytometric analysis of peripheral blood was utilized to determine B2 cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 10. Homozygous macadamias2 mice exhibit reduced frequencies of naïve CD8+ T cells in CD8+ T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 11. Homozygous macadamias2 mice exhibit increased frequencies of CD8+ T cells in CD3+ T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 12. Homozygous macadamias2 mice exhibit increased frequencies of effector memory CD8+ T cells in CD8+ T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 13. Homozygous macadamias2 mice exhibit increased CD44+ MFI on CD8+. Flow cytometric analysis of peripheral blood was utilized to determine CD44 MFI. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 14. Homozygous macadamias2 mice exhibit increased IgD MFI on B cells. Flow cytometric analysis of peripheral blood was utilized to determine IgD MFI. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 15. Homozygous macadamias2 mice exhibit increased frequencies of macrophages. Flow cytometric analysis of peripheral blood was utilized to determine macrophage cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 16. Homozygous macadamias2 mice exhibit diminished T-dependent IgG responses to recombinant Semliki Forest virus (rSFV)-encoded β-galactosidase (rSFV-β-gal). IgG levels were determined by ELISA. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 17. Homozygous macadamias2 mice exhibit diminished T-dependent IgG responses to ovalbumin administered with aluminum hydroxide. IgG levels were determined by ELISA. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The macadamias2 phenotype was identified among N-nitroso-N-ethylurea (ENU)-mutagenized G3 mice of the pedigree R4181, some of which showed an increase in the B to T cell ratio (Figure 1), an increased frequency of B1a cells (Figure 2), an increased frequency of B1b cells (Figure 3), a reduced frequency of B2 cells (Figure 4), a decrease in the CD4+ to CD8+ T cell ratio (Figure 5), a reduced frequency of CD4+ T cells (Figure 6), a reduced frequency of CD4+ T cells in CD3+ T cells (Figure 7), an increased frequency of effector memory CD4+ T cells in CD4+ T cells (Figure 8), increased CD44+ CD4+ mean fluorescence intensity (MFI; Figure 9), a reduced frequency of naïve CD8+ T cells in CD8+ T cells (Figure 10), an increased frequency of CD8+ T cells in CD3+ T cells (Figure 11), an increased frequency of effector memory CD8+ T cells in CD8+ T cells (Figure 12), increased CD44+ CD8 MFI (Figure 13), all in the peripheral blood. Some mice also exhibited increased IgD MFI on B cells (Figure 14) and an increase in the frequency of macrophages (Figure 15) in the peripheral blood.

 

The T-dependent antibody responses to recombinant Semliki Forest virus (rSFV)-encoded β-galactosidase (rSFV-β-gal) (Figure 16) and ovalbumin administered with aluminum hydroxide (Figure 17) were also diminished.

Nature of Mutation

Figure 18. Linkage mapping of the increased frequency of effector memory CD4+ T cells in CD4+ T cells in the peripheral blood using a recessive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 47 mutations (X-axis) identified in the G1 male of pedigree R4181. Normalized phenotype data are shown for single locus linkage analysis without consideration of G2 dam identity.  Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 47 mutations. All of the above anomalies were linked by continuous variable mapping to a mutation in Rorc:  a G to A transition at base pair 94,387,193 (v38) on chromosome 3, or base pair 14,479 in the GenBank genomic region NC_000069 encoding the Rorc gene. The strongest association was found with a recessive model of linkage to the normalized frequency of effector memory CD4 T cells in CD4 T cells, wherein two variant homozygotes departed phenotypically from 13 homozygous reference mice and 17 heterozygous mice with a P value of 1.328 x 10-11 (Figure 18).  

 

The mutation corresponds to residue 241 in the mRNA sequence NM_011281 within exon 3 of 11 total exons and residue x in the mRNA sequence NM_001293734 within exon 2 of 10 total exons.

 
14463 TACGGGGTTATCACCTGTGAGGGGTGCAAGGGC
43   -Y--G--V--I--T--C--E--G--C--K--G- (RORγ1)
22   -Y--G--V--I--T--C--E--G--C--K--G- (RORγt)

 

Genomic numbering corresponds to NC_000069. The mutated nucleotide is indicated in red.  The mutation results in a cysteine (C) to tyrosine (Y) substitution at position 48 (C48Y) in the RAR-related orphan receptor gamma (RORγ1) protein and a cysteine to tyrosine substitution at position 27 in the RORγt protein, and is strongly predicted by PolyPhen-2 to be damaging (score = 1.000).

Protein Prediction

Figure 19. Rorc encodes two isoforms. (A) The genomic organization of Rorc. Exons are labeled with their isoform-specific numbers (γ1, RORγ1; γt, RORγt). The first exon of the RORγt isoform is colored red.  (B) Domain organization of mouse RORγt and RORγ1.  The macadamias2 mutation mutation is a cysteine to tyrosine substitution at residue 48 in the RORγ1 isoform. DBD, DNA binding domain; CTE, carboxy-terminal extension; LBD, ligand binding domain.

RAR-related orphan receptor gamma (RORγ) is a member of the RAR-related orphan nuclear hormone receptor transcription factor family. RORγ has an N-terminal domain (A/B region), a DNA-binding domain (DBD), a hinge domain, and a C-terminal ligand-binding domain (LBD) [Figure 19; reviewed in (1)]. Rorc generates two isoforms of RORγ, RORγ1 and RORγt (alternatively, RORγ2), by the use of alternative promoters and/or by alternative splicing of a common pre-mRNA (2;3). The RORγ isoforms have the same DBDs and LBDs, but RORγt lacks the N-terminal 24 amino acids of RORγ1 encoded by the first two exons of Rorc and has three alternative residues encoded by the first exon specific to RORγt [Figure 19; (2;3)].

 

The macadamias2 mutation results in substitution of C48 for a tyrosine in the RORγ1 isoform as well as a substitution of cysteine 27 for a tyrosine in the RORγt isoform. The mutated residue in both isoforms is within an undefined domain proceeding the DBD (SMART). Protein expression and localization of RORγmacadamias2 has not been examined.

 

Please see the record for chestnut for more information about Rorc.

Putative Mechanism

RORγ has well documented functions including to negatively regulate CD4+CD8+ double positive (DP) thymocyte apoptosis to promote cell survival [(4;5); reviewed in (6)]. In addition, RORγ inhibits expression of Fas ligand (FasL) and interleukin-2 (IL-2), protecting hybridomas from TCR-induced apoptosis [(2;7); reviewed in (6)]. RORγt promotes TGF-β plus IL-6- or IL-21-induced TH17 differentiation and suppress TNF- and IL-1β-induced TH1 and TH2 differentiation (8-11). Rorc-/- mice do not have lymph nodes (both peripheral and mesenteric) as well as Peyer’s patches due to the absence of lymphoid tissue inducer (LTi) cells, which require RORγt for their generation and survival through the regulation of Bcl-xL (4;5;12;13). Studies have shown conflicting results on the splenic structure of Rorc-/- mice (MGI:2384142). Sun et al. reported no change in splenic structure (4), while Zhang et al. reported enlarged spleens due to an accumulation of conventional resting B cells; B lymphocyte development in the bone marrow and spleen in the Rorc-/- mice were normal and B cell levels in the blood were comparable to controls (13).

 

Significant changes in the frequency of T and B cells were not observed in macadamias. However, the deficiency of the macadamias2 mice to mount a T-dependent antibody response to rSFV-β-gal indicates that RORγmacadamias2 has reduced and/or altered function compared to the wild-type protein.

Primers PCR Primer
macadamias2_pcr_F: GTGTTGGAGCTCACTGAAGAAG
macadamias2_pcr_R: CTCCAATTCATGTGCACTGGTC

Sequencing Primer
macadamias2_seq_F: GGCTCATGGTAGTGAAATC
macadamias2_seq_R: CAATTCATGTGCACTGGTCTCAAG
Genotyping

PCR program

1) 94°C 2:00
2) 94°C 0:30
3) 55°C 0:30
4) 72°C 1:00
5) repeat steps (2-4) 40x
6) 72°C 10:00
7) 4°C hold


The following sequence of 401 nucleotides is amplified (chromosome 3, + strand):


1   gtgttggagc tcactgaaga agtgggggga gcaccataca cctgcgtctg cagcccaggc
61  tcatggtagt gaaatccaga aaaaaacatt atgggctagc ttctctttct ctcttccagc
121 acaaattgaa gtgatccctt gcaagatctg tggggacaag tcatctggga tccactacgg
181 ggttatcacc tgtgaggggt gcaaggtgag ttgtacatat ttgtctgcat acatgcactt
241 ggctgtttca gcggtctccc cagggtcagg aacaggaggg aggaggagga cctaatctcg
301 atgtaggaat gtgatcacag ggtccatcac aattatacag tggaggttcg gggactttgg
361 tggatgtaga aattcttgag accagtgcac atgaattgga g


Primer binding sites are underlined and the sequencing primers are highlighted; the mutated nucleotide is shown in red.

References

1. McKenna, N. J., Xu, J., Nawaz, Z., Tsai, S. Y., Tsai, M. J., and O'Malley, B. W. (1999) Nuclear Receptor Coactivators: Multiple Enzymes, Multiple Complexes, Multiple Functions. J Steroid Biochem Mol Biol. 69, 3-12.

Science Writers Anne Murray
Illustrators Peter Jurek
AuthorsJin Huk Choi, James Butler, and Bruce Beutler