Allele | mr_bigger | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Mutation Type | nonsense | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Chromosome | 10 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Coordinate | 80,096,558 bp (GRCm39) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Base Change | T ⇒ A (forward strand) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Gene | Gamt | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Gene Name | guanidinoacetate methyltransferase | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Synonym(s) | Spintz1 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Chromosomal Location | 80,093,985-80,096,846 bp (-) (GRCm39) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
MGI Phenotype |
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a methyltransferase that converts guanidoacetate to creatine, using S-adenosylmethionine as the methyl donor. Defects in this gene have been implicated in neurologic syndromes and muscular hypotonia, probably due to creatine deficiency and accumulation of guanidinoacetate in the brain of affected individuals. Two transcript variants encoding different isoforms have been described for this gene. Pseudogenes of this gene are found on chromosomes 2 and 13. [provided by RefSeq, Feb 2012] PHENOTYPE: Homozygous null mice display increased postnatal lethality; reduced body weight, muscle tension, and creatine concentrations; infertility with impaired spermatogenesis. [provided by MGI curators] |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Accession Number | NCBI RefSeq: NM_010255, NM_001347119; MGI:1098221 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mapped | Yes | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Amino Acid Change | Arginine changed to Stop codon | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Institutional Source | Beutler Lab | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Gene Model | predicted gene model for protein(s): [ENSMUSP00000020359] [ENSMUSP00000101002] | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
AlphaFold | O35969 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
SMART Domains |
Protein: ENSMUSP00000020359 Gene: ENSMUSG00000020150 AA Change: R60*
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Predicted Effect | probably null | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
SMART Domains |
Protein: ENSMUSP00000101002 Gene: ENSMUSG00000020150 AA Change: R60*
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Predicted Effect | probably null | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Meta Mutation Damage Score | 0.9755 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Is this an essential gene? | Possibly nonessential (E-score: 0.331) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Phenotypic Category | Autosomal Recessive | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Candidate Explorer Status | loading ... | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Single pedigree Linkage Analysis Data |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Penetrance | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Alleles Listed at MGI | All Mutations and Alleles(7) : Chemically induced (other)(1) Gene trapped(4) Targeted(2) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Lab Alleles |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mode of Inheritance | Autosomal Recessive | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Local Stock | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Repository | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Last Updated | 2019-09-04 9:43 PM by Anne Murray | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Record Created | 2016-03-15 1:36 PM | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Record Posted | 2018-09-18 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Phenotypic Description |
The mr_bigger phenotype was identified among N-ethyl-N-nitrosourea (ENU)-mutagenized G3 mice of the pedigree R4156, some of which showed reduced body weights compared to wild-type littermates (Figure 1). |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Nature of Mutation |
Whole exome HiSeq sequencing of the G1 grandsire identified 48 mutations. The body weight phenotype was linked to a mutation in Gamt: an A to T transversion at base pair 80,260,724 (v38) on chromosome 10, or base pair 303 in the GenBank genomic region NC_000076 encoding Gamt. Linkage was found with a recessive model of inheritance, wherein four variant homozygotes departed phenotypically from 15 homozygous reference mice and 20 heterozygous mice with a P value of 7.797 x 10-10 (Figure 2). The mutation corresponds to residue 289 in the mRNA sequence NM_010255 within exon 1 of 6 total exons.
The mutated nucleotide is indicated in red. The mutation results in substitution of arginine 60 to a premature stop codon (R60*) in the GAMT protein. | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Illustration of Mutations in Gene & Protein |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Protein Prediction |
Guanidinoacetate N-methyltransferase (GAMT; alternatively, S-adenosyl-L-methionine (SAM):guanidinoacetate N-methyltransferase) is a member of the class I-like SAM-binding methyltransferase superfamily and the RMT2 methyltransferase family. GAMT has no defined functional domains. Trp20, Met50, and Asp135 are predicted to be SAM binding sites, and Met42, Glu46, and Asp135 are involved in substrate binding. Rat GAMT expressed in E. coli was crystallized with S-adenosylhomocysteine (SAH) [Figure 3; PDB:1KHH, (1) and PDB: 1P1B, (2)]. GAMT was cleaved between Leu36 and Gly37 by an undetermined protease (1;2). GAMT is a single domain, with seven α-helices and seven β-strands (1;2). GAMT folds into a typical α/β open sandwich structure and is spherical in shape (1). Truncated GAMT forms a dimer. Each monomer has a ternary complex structure of protein arginine methyltransferase complexed with a protein substrate and SAH. An SAH binds in the active site of each monomer and at the C-terminal ends of β1 and β4. The two monomers point their β-sheets towards each other when forming a dimer. The loop connecting β6 to β7 enters a cleft in the other monomer. The cleft is surrounded by αA, the loop connecting β1 to αB, and the loop connecting β4 to αE. | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Expression/Localization | Gamt is expressed in adipose tissue, pancreas, adrenal gland, liver, testis, epididymis, ovary, spleen, heart, and skeletal muscle [(3;4); (BioGPS; GeneAtlas MOE430, gcrma)]. | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Background |
Creatine biosynthesis maintains energy homeostasis by functioning to replenish ATP in vertebrates, especially in the central nervous system and muscles [(5-8); reviewed in (9)]. Creatine is continually degraded to creatinine, which necessitates dietary creatine intake and/or endogenous creatine synthesis (8). Creatine biosynthesis occurs as a two-step process mainly in the kidney, pancreas, and liver [Figure 4; reviewed in (5;6)]. In the first (and rate-limiting) step, AGAT (alternatively, GATM; see the record for mrbig) catalyzes the transfer of an amidino group from arginine to glycine to form ornithine and guanidinoacetic acid (GAA) in the kidney [(8;10;11); reviewed in (9)]. In the second step, GAA is transported to the liver where GAMT methylates GAA to form creatine (5;8;10;11). Creatine is actively transported to the organs (e.g., muscle, nerve tissue, and myocardium) by the blood and taken up via SLC6A8, the creatine transporter (8;12;12;13). For more information about creatine biosynthesis and deficiency, please see mrbig. Mutations in GAMT are linked to GAMT deficiency (alternatively, cerebral creatine deficiency syndrome-2; OMIM: #612736) (14-16). Patients with GAMT deficiency exhibit creatine depletion with concomitant GAA accumulation (17;18). GAA inhibits Na+/K+ ATPase and/or creatine kinase. GAA also evokes picrotoxin- and bicuculline-sensitive GABAA receptor-mediated chloride currents as well as hyperpolarizes globus pallidus neurons, reducing their spontaneous spike frequency. GAMT deficiency is an autosomal recessive disorder that results in developmental delay, mental retardation, muscle hypotonia, extrapyramidal movement abnormalities, and epileptic seizures (19). Creatine supplementation partially ameliorates clinical symptoms in GAMT-deficient patients (14;20). Gamt-deficient (Gamt-/-) mice showed reduced levels of creatine and creatinine with concomitant increased levels of GAA in the serum, urine, and brain (21). In addition, Gamt-/- mice exhibited increased neonatal mortality, reduced body weight and body fat content, muscle hypotonia, and decreased male fertility (21). However, unlike human patients, Gamt-/- mice displayed only mild cognitive impairment (22). Medial gastrocnemius muscles from the Gamt-/- mice showed reduced maximal tetanic and twitch force as well as increased relaxation times (23). | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Putative Mechanism | Similar to Gamt-/- mice (21), the mr_bigger mice exhibited weight loss, indicating loss of GAMT-associated function and creatine deficiency in the mr_bigger mice. | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Primers |
PCR Primer mr_bigger_pcr_F: AGTAGAAATCTTCCCTGGGAGAG mr_bigger_pcr_R: GTTTGCACAGCCTCACCATG Sequencing Primer mr_bigger_seq_F: AATCTTCCCTGGGAGAGGAAGTTC mr_bigger_seq_R: ATGAGCTCTTCTGCAGCTAG |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Genotyping | PCR program 1) 94°C 2:00 The following sequence of 402 nucleotides is amplified (chromosome 10, - strand): 1 gtttgcacag cctcaccatg agctcttctg cagctagccc gctcttcgcg cccggcgagg Primer binding sites are underlined and the sequencing primers are highlighted; the mutated nucleotide is shown in red. | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
References |
5. Pisano, J. J., Abraham, D., and Udenfriend, S. (1963) Biosynthesis and Disposition of γ-Guanidinobutyric Acid in Mammalian Tissues. Arch Biochem Biophys. 100, 323-329.
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Science Writers | Eva Marie Y. Moresco, Anne Murray | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Illustrators | Diantha La Vine, Peter Jurek | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Authors | Emre Turer and Bruce Beutler |