Phenotypic Mutation 'mr_bigger'

• Allele: mr_bigger
• Mutation Type: nonsense
• Chromosome: 10
• Coordinate: 80,096,558 bp (GRCm39)
• Base Change: T ⇒ A (forward strand)
• Gene: Gamt
• Gene Name: guanidinoacetate methyltransferase
• Synonym(s): Spintz1
• Chromosomal Location: 80,093,985-80,096,846 bp (-) (GRCm39)
• MGI Phenotype: FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a methyltransferase that converts guanidoacetate to creatine, using S-adenosylmethionine as the methyl donor. Defects in this gene have been implicated in neurologic syndromes and muscular hypotonia, probably due to creatine deficiency and accumulation of guanidinoacetate in the brain of affected individuals. Two transcript variants encoding different isoforms have been described for this gene. Pseudogenes of this gene are found on chromosomes 2 and 13. [provided by RefSeq, Feb 2012] ; PHENOTYPE: Homozygous null mice display increased postnatal lethality; reduced body weight, muscle tension, and creatine concentrations; infertility with impaired spermatogenesis. [provided by MGI curators]
• Mapped: Yes
• Amino Acid Change: Arginine changed to Stop codon
• Institutional Source: Beutler Lab
• Gene Model: predicted gene model for protein(s): [ENSMUSP00000020359] [ENSMUSP00000101002]
• AlphaFold: O35969
• SMART Domains: Protein: ENSMUSP00000020359; Gene: ENSMUSG00000020150; AA Change: R60*

Domain	Start	End	E-Value	Type
PDB:1XCL|A	2	252	1e-151	PDB
SCOP:d1khha_	44	252	3e-32	SMART

• Predicted Effect: probably null
• SMART Domains: Protein: ENSMUSP00000101002; Gene: ENSMUSG00000020150; AA Change: R60*

Domain	Start	End	E-Value	Type
PDB:1XCL|A	2	236	1e-155	PDB
SCOP:d1khha_	44	236	2e-34	SMART

• Predicted Effect: probably null
• Meta Mutation Damage Score: 0.9755
• Is this an essential gene?: Possibly nonessential (E-score: 0.331)
• Phenotypic Category: Autosomal Recessive
• Mode of Inheritance: Autosomal Recessive
• Last Updated: 2019-09-04 9:43 PM by Anne Murray
• Record Created: 2016-03-15 1:36 PM
• Record Posted: 2018-09-18
• Science Writers: Eva Marie Y. Moresco, Anne Murray
• Illustrators: Diantha La Vine, Peter Jurek
• Authors: Emre Turer and Bruce Beutler

Accession Number

NCBI RefSeq: NM_010255, NM_001347119; MGI:1098221

Alleles Listed at MGI

All Mutations and Alleles(7) : Chemically induced (other)(1) Gene trapped(4) Targeted(2)

Phenotypic Description

Figure 1. Mr_bigger mice exhibited reduced body weights compared to wild-type littermates. Scaled weight data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The mr_bigger phenotype was identified among N-ethyl-N-nitrosourea (ENU)-mutagenized G3 mice of the pedigree R4156, some of which showed reduced body weights compared to wild-type littermates (Figure 1).

Nature of Mutation

Figure 2. Linkage mapping of the reduced body weight phenotype using a recessive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 48 mutations (X-axis) identified in the G1 male of pedigree R4156. Weight data are shown for single locus linkage analysis without consideration of G2 dam identity. Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 48 mutations. The body weight phenotype was linked to a mutation in Gamt: an A to T transversion at base pair 80,260,724 (v38) on chromosome 10, or base pair 303 in the GenBank genomic region NC_000076 encoding Gamt. Linkage was found with a recessive model of inheritance, wherein four variant homozygotes departed phenotypically from 15 homozygous reference mice and 20 heterozygous mice with a P value of 7.797 x 10^-10 (Figure 2).  

The mutation corresponds to residue 289 in the mRNA sequence NM_010255 within exon 1 of 6 total exons.

274 GCGGCTGCTGCCTCCAGAGGGGGCCGGGTCTTG 55  -A--A--A--A--S--R--G--G--R--V--L-

The mutated nucleotide is indicated in red. The mutation results in substitution of arginine 60 to a premature stop codon (R60*) in the GAMT protein.

Protein Prediction

Figure 3. Domain organization and crystal structure of GAMT. A, There are no defined domains within  GMAT. The secondary structures shown are based on rat GMAT and colors correspond to the crystal structure shown. The mr_bigger mutation results in substitution of arginine 60 for a premature stop codon. B, Crystal structure of a single subunit of rat GMAT. The α-helices are numbered and shown in pink, and β-strands are numbered and shown in blue. SAH is shown in orange. UCSF Chimera model is based on PDB IKHH, Komoto et al., J.Mol.Biol. 320: 223-235 (2002). Click on the 3D structure to view it rotate.

Guanidinoacetate N-methyltransferase (GAMT; alternatively, S-adenosyl-L-methio­nine (SAM):guanidinoacetate N-methyltransferase) is a member of the class I-like SAM-binding methyltransferase superfamily and the RMT2 methyltransferase family. GAMT has no defined functional domains. Trp20, Met50, and Asp135 are predicted to be SAM binding sites, and Met42, Glu46, and Asp135 are involved in substrate binding.

Rat GAMT expressed in E. coli was crystallized with S-adenosylhomocysteine (SAH) [Figure 3; PDB:1KHH, (1) and PDB: 1P1B, (2)]. GAMT was cleaved between Leu36 and Gly37 by an undetermined protease (1;2). GAMT is a single domain, with seven α-helices and seven β-strands (1;2). GAMT folds into a typical α/β open sandwich structure and is spherical in shape (1). Truncated GAMT forms a dimer. Each monomer has a ternary complex structure of protein arginine methyltransferase complexed with a protein substrate and SAH. An SAH binds in the active site of each monomer and at the C-terminal ends of β1 and β4. The two monomers point their β-sheets towards each other when forming a dimer. The loop connecting β6 to β7 enters a cleft in the other monomer. The cleft is surrounded by αA, the loop connecting β1 to αB, and the loop connecting β4 to αE.

Expression/Localization

Gamt is expressed in adipose tissue, pancreas, adrenal gland, liver, testis, epididymis, ovary, spleen, heart, and skeletal muscle [(3;4); (BioGPS; GeneAtlas MOE430, gcrma)].

Background

Figure 4. Creatine metabolism. Although most creatine is found in muscle, it can not synthesize creatine. AGAT functions in the first step of creatine synthesis in the kidney to catalyze the formation of guanidoacetic acid (GAA). In the liver, GAMT subsequently facilitates the methylation of GAA to form creatine via the transfer to a methyl group from S-adenosyl-L-methionine (SAM) to GAA. SLC6A8 (not shown) takes up creatine at the target organs from the blood. Muscular creatine and creatine phosphate are converted to creatinine, which diffuses out of the cells is excreted by the kidneys into the urine.

Creatine biosynthesis maintains energy homeostasis by functioning to replenish ATP in vertebrates, especially in the central nervous system and muscles [(5-8); reviewed in (9)]. Creatine is continually degraded to creatinine, which necessitates dietary creatine intake and/or endogenous creatine synthesis (8). Creatine biosynthesis occurs as a two-step process mainly in the kidney, pancreas, and liver [Figure 4; reviewed in (5;6)]. In the first (and rate-limiting) step, AGAT (alternatively, GATM; see the record for mrbig) catalyzes the transfer of an amidino group from arginine to glycine to form ornithine and guanidinoacetic acid (GAA) in the kidney [(8;10;11); reviewed in (9)]. In the second step, GAA is transported to the liver where GAMT methylates GAA to form creatine (5;8;10;11). Creatine is actively transported to the organs (e.g., muscle, nerve tissue, and myocardium) by the blood and taken up via SLC6A8, the creatine transporter (8;12;12;13). For more information about creatine biosynthesis and deficiency, please see mrbig.

Mutations in GAMT are linked to GAMT deficiency (alternatively, cerebral creatine deficiency syndrome-2; OMIM: #612736) (14-16). Patients with GAMT deficiency exhibit creatine depletion with concomitant GAA accumulation (17;18). GAA inhibits Na⁺/K⁺ ATPase and/or creatine kinase. GAA also evokes picrotoxin- and bicuculline-sensitive GABA_A receptor-mediated chloride currents as well as hyperpolarizes globus pallidus neurons, reducing their spontaneous spike frequency. GAMT deficiency is an autosomal recessive disorder that results in developmental delay, mental retardation, muscle hypotonia, extrapyramidal movement abnormalities, and epileptic seizures (19). Creatine supplementation partially ameliorates clinical symptoms in GAMT-deficient patients (14;20).

Gamt-deficient (Gamt^-/-) mice showed reduced levels of creatine and creatinine with concomitant increased levels of GAA in the serum, urine, and brain (21). In addition, Gamt^-/- mice exhibited increased neonatal mortality, reduced body weight and body fat content, muscle hypotonia, and decreased male fertility (21).  However, unlike human patients, Gamt^-/- mice displayed only mild cognitive impairment (22). Medial gastrocnemius muscles from the Gamt^-/- mice showed reduced maximal tetanic and twitch force as well as increased relaxation times (23).

Putative Mechanism

Similar to Gamt^-/- mice (21), the mr_bigger mice exhibited weight loss, indicating loss of GAMT-associated function and creatine deficiency in the mr_bigger mice.

Primers

PCR Primer
mr_bigger_pcr_F: AGTAGAAATCTTCCCTGGGAGAG
mr_bigger_pcr_R: GTTTGCACAGCCTCACCATG

Sequencing Primer
mr_bigger_seq_F: AATCTTCCCTGGGAGAGGAAGTTC
mr_bigger_seq_R: ATGAGCTCTTCTGCAGCTAG

Genotyping

PCR program

1) 94°C 2:00
2) 94°C 0:30
3) 55°C 0:30
4) 72°C 1:00
5) repeat steps (2-4) 40x
6) 72°C 10:00
7) 4°C hold

The following sequence of 402 nucleotides is amplified (chromosome 10, - strand):

1   gtttgcacag cctcaccatg agctcttctg cagctagccc gctcttcgcg cccggcgagg
61  actgcggccc cgcgtggcgc gcggcccccg cggcctatga cgcgtctgac acgcacctgc
121 aaatcctggg caagccagtg atggagcgtt gggagacccc ctatatgcat gcgctagcgg
181 cggctgctgc ctccagaggt actctgccag aggaaactga ggctgcagct taaaagagca
241 ggagctccca tgcatgttgc aagtctcagt ttccttgcct gaggcactga gctgccttgg
301 ggctaccttg gtcgggaagg gaagggtatt tgcaaaaagt ggacgcagga aagaggtccc
361 ggctccgaac tggaacttcc tctcccaggg aagatttcta ct

Primer binding sites are underlined and the sequencing primers are highlighted; the mutated nucleotide is shown in red.

References

  1. Komoto, J., Huang, Y., Takata, Y., Yamada, T., Konishi, K., Ogawa, H., Gomi, T., Fujioka, M., and Takusagawa, F. (2002) Crystal Structure of Guanidinoacetate Methyltransferase from Rat Liver: A Model Structure of Protein Arginine Methyltransferase. J Mol Biol. 320, 223-235.

  2. Komoto, J., Takata, Y., Yamada, T., Konishi, K., Ogawa, H., Gomi, T., Fujioka, M., and Takusagawa, F. (2003) Monoclinic Guanidinoacetate Methyltransferase and Gadolinium Ion-Binding Characteristics. Acta Crystallogr D Biol Crystallogr. 59, 1589-1596.

  3. Lee, H., Ogawa, H., Fujioka, M., and Gerton, G. L. (1994) Guanidinoacetate Methyltransferase in the Mouse: Extensive Expression in Sertoli Cells of Testis and in Microvilli of Caput Epididymis. Biol Reprod. 50, 152-162.

  4. Tachikawa, M., Fukaya, M., Terasaki, T., Ohtsuki, S., and Watanabe, M. (2004) Distinct Cellular Expressions of Creatine Synthetic Enzyme GAMT and Creatine Kinases uCK-Mi and CK-B Suggest a Novel Neuron-Glial Relationship for Brain Energy Homeostasis. Eur J Neurosci. 20, 144-160.

  5. Pisano, J. J., Abraham, D., and Udenfriend, S. (1963) Biosynthesis and Disposition of γ-Guanidinobutyric Acid in Mammalian Tissues. Arch Biochem Biophys. 100, 323-329.

  6. Humm, A., Fritsche, E., Steinbacher, S., and Huber, R. (1997) Crystal Structure and Mechanism of Human L-Arginine:Glycine Amidinotransferase: A Mitochondrial Enzyme Involved in Creatine Biosynthesis. EMBO J. 16, 3373-3385.

  7. Braissant, O., Henry, H., Villard, A. M., Speer, O., Wallimann, T., and Bachmann, C. (2005) Creatine Synthesis and Transport during Rat Embryogenesis: Spatiotemporal Expression of AGAT, GAMT and CT1. BMC Dev Biol. 5, 9.

  8. Edvardson, S., Korman, S. H., Livne, A., Shaag, A., Saada, A., Nalbandian, R., Allouche-Arnon, H., Gomori, J. M., and Katz-Brull, R. (2010) L-Arginine:Glycine Amidinotransferase (AGAT) Deficiency: Clinical Presentation and Response to Treatment in Two Patients with a Novel Mutation. Mol Genet Metab. 101, 228-232.

  9. Wyss, M., and Kaddurah-Daouk, R. (2000) Creatine and Creatinine Metabolism. Physiol Rev. 80, 1107-1213.

  10. Cullen, M. E., Yuen, A. H., Felkin, L. E., Smolenski, R. T., Hall, J. L., Grindle, S., Miller, L. W., Birks, E. J., Yacoub, M. H., and Barton, P. J. (2006) Myocardial Expression of the Arginine:Glycine Amidinotransferase Gene is Elevated in Heart Failure and Normalized After Recovery: Potential Implications for Local Creatine Synthesis. Circulation. 114, I16-20.

  11. Levillain, O., Marescau, B., and De Deyn, P. P. (1997) Renal Handling of Guanidino Compounds in Rat and Rabbit. J Physiol. 499 ( Pt 2), 561-570.

  12. Braissant, O., Henry, H., Loup, M., Eilers, B., and Bachmann, C. (2001) Endogenous Synthesis and Transport of Creatine in the Rat Brain: An in Situ Hybridization Study. Brain Res Mol Brain Res. 86, 193-201.

  13. Davids, M., Ndika, J. D., Salomons, G. S., Blom, H. J., and Teerlink, T. (2012) Promiscuous Activity of Arginine:Glycine Amidinotransferase is Responsible for the Synthesis of the Novel Cardiovascular Risk Factor Homoarginine. FEBS Lett. 586, 3653-3657.

  14. Stockler, S., Isbrandt, D., Hanefeld, F., Schmidt, B., and von Figura, K. (1996) Guanidinoacetate Methyltransferase Deficiency: The First Inborn Error of Creatine Metabolism in Man. Am J Hum Genet. 58, 914-922.

  15. Caldeira Araujo, H., Smit, W., Verhoeven, N. M., Salomons, G. S., Silva, S., Vasconcelos, R., Tomas, H., Tavares de Almeida, I., Jakobs, C., and Duran, M. (2005) Guanidinoacetate Methyltransferase Deficiency Identified in Adults and a Child with Mental Retardation. Am J Med Genet A. 133A, 122-127.

  16. Lion-Francois, L., Cheillan, D., Pitelet, G., Acquaviva-Bourdain, C., Bussy, G., Cotton, F., Guibaud, L., Gerard, D., Rivier, C., Vianey-Saban, C., Jakobs, C., Salomons, G. S., and des Portes, V. (2006) High Frequency of Creatine Deficiency Syndromes in Patients with Unexplained Mental Retardation. Neurology. 67, 1713-1714.

  17. Schulze, A., Hess, T., Wevers, R., Mayatepek, E., Bachert, P., Marescau, B., Knopp, M. V., De Deyn, P. P., Bremer, H. J., and Rating, D. (1997) Creatine Deficiency Syndrome Caused by Guanidinoacetate Methyltransferase Deficiency: Diagnostic Tools for a New Inborn Error of Metabolism. J Pediatr. 131, 626-631.

  18. Stockler, S., Marescau, B., De Deyn, P. P., Trijbels, J. M., and Hanefeld, F. (1997) Guanidino Compounds in Guanidinoacetate Methyltransferase Deficiency, a New Inborn Error of Creatine Synthesis. Metabolism. 46, 1189-1193.

  19. Schulze, A. (2003) Creatine Deficiency Syndromes. Mol Cell Biochem. 244, 143-150.

  20. Kan, H. E., Meeuwissen, E., van Asten, J. J., Veltien, A., Isbrandt, D., and Heerschap, A. (2007) Creatine Uptake in Brain and Skeletal Muscle of Mice Lacking Guanidinoacetate Methyltransferase Assessed by Magnetic Resonance Spectroscopy. J Appl Physiol (1985). 102, 2121-2127.

  21. Schmidt, A., Marescau, B., Boehm, E. A., Renema, W. K., Peco, R., Das, A., Steinfeld, R., Chan, S., Wallis, J., Davidoff, M., Ullrich, K., Waldschutz, R., Heerschap, A., De Deyn, P. P., Neubauer, S., and Isbrandt, D. (2004) Severely Altered Guanidino Compound Levels, Disturbed Body Weight Homeostasis and Impaired Fertility in a Mouse Model of Guanidinoacetate N-Methyltransferase (GAMT) Deficiency. Hum Mol Genet. 13, 905-921.

  22. Torremans, A., Marescau, B., Possemiers, I., Van Dam, D., D'Hooge, R., Isbrandt, D., and De Deyn, P. P. (2005) Biochemical and Behavioural Phenotyping of a Mouse Model for GAMT Deficiency. J Neurol Sci. 231, 49-55.

  23. Kan, H. E., Buse-Pot, T. E., Peco, R., Isbrandt, D., Heerschap, A., and de Haan, A. (2005) Lower Force and Impaired Performance during High-Intensity Electrical Stimulation in Skeletal Muscle of GAMT-Deficient Knockout Mice. Am J Physiol Cell Physiol. 289, C113-9.