Phenotypic Mutation 'mr_bigger' (pdf version)
List |< first << previous [record 38 of 132] next >> last >|
Allelemr_bigger
Mutation Type nonsense
Chromosome10
Coordinate80,260,724 bp (GRCm38)
Base Change T ⇒ A (forward strand)
Gene Gamt
Gene Name guanidinoacetate methyltransferase
Synonym(s) Spintz1
Chromosomal Location 80,258,151-80,261,012 bp (-)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a methyltransferase that converts guanidoacetate to creatine, using S-adenosylmethionine as the methyl donor. Defects in this gene have been implicated in neurologic syndromes and muscular hypotonia, probably due to creatine deficiency and accumulation of guanidinoacetate in the brain of affected individuals. Two transcript variants encoding different isoforms have been described for this gene. Pseudogenes of this gene are found on chromosomes 2 and 13. [provided by RefSeq, Feb 2012]
PHENOTYPE: Homozygous null mice display increased postnatal lethality; reduced body weight, muscle tension, and creatine concentrations; infertility with impaired spermatogenesis. [provided by MGI curators]
Accession Number

NCBI RefSeq: NM_010255, NM_001347119; MGI:1098221

Mapped Yes 
Amino Acid Change Arginine changed to Stop codon
Institutional SourceBeutler Lab
Gene Model predicted gene model for protein(s): [ENSMUSP00000020359] [ENSMUSP00000020361] [ENSMUSP00000089958] [ENSMUSP00000101000] [ENSMUSP00000101001] [ENSMUSP00000101002] [ENSMUSP00000101003] [ENSMUSP00000117497]
SMART Domains Protein: ENSMUSP00000020359
Gene: ENSMUSG00000020150
AA Change: R60*

DomainStartEndE-ValueType
PDB:1XCL|A 2 252 1e-151 PDB
SCOP:d1khha_ 44 252 3e-32 SMART
Predicted Effect probably null
SMART Domains Protein: ENSMUSP00000101002
Gene: ENSMUSG00000020150
AA Change: R60*

DomainStartEndE-ValueType
PDB:1XCL|A 2 236 1e-155 PDB
SCOP:d1khha_ 44 236 2e-34 SMART
Predicted Effect probably null
Phenotypic Category
Phenotypequestion? Literature verified References
Body Weight - decreased 15028668
Body Weight (Female) - decreased 15028668
Body Weight (Male) - decreased 15028668
Penetrance  
Alleles Listed at MGI

All Mutations and Alleles(7) : Chemically induced (other)(1) Gene trapped(4) Targeted(2)

Lab Alleles
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02174:Gamt APN 10 80258396 missense possibly damaging 0.89
IGL03115:Gamt APN 10 80258438 missense probably damaging 1.00
R0001:Gamt UTSW 10 80259061 unclassified probably benign
R1471:Gamt UTSW 10 80260858 missense probably benign 0.37
R4156:Gamt UTSW 10 80260724 nonsense probably null
R5049:Gamt UTSW 10 80258954 missense probably benign
R5890:Gamt UTSW 10 80259907 missense possibly damaging 0.94
Mode of Inheritance Autosomal Recessive
Local Stock
Repository
Last Updated 2018-09-18 9:01 AM by Anne Murray
Record Created 2016-03-15 1:36 PM
Record Posted 2018-09-18
Phenotypic Description
Figure 1. Mr_bigger mice exhibited reduced body weights compared to wild-type littermates.  Scaled weight data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The mr_bigger phenotype was identified among N-ethyl-N-nitrosourea (ENU)-mutagenized G3 mice of the pedigree R4156, some of which showed reduced body weights compared to wild-type littermates (Figure 1).

Nature of Mutation
Figure 2. Linkage mapping of the reduced body weight phenotype using a recessive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 48 mutations (X-axis) identified in the G1 male of pedigree R4156. Weight data are shown for single locus linkage analysis without consideration of G2 dam identity. Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 48 mutations. The body weight phenotype was linked to a mutation in Gamt: an A to T transversion at base pair 80,260,724 (v38) on chromosome 10, or base pair 303 in the GenBank genomic region NC_000076 encoding Gamt. Linkage was found with a recessive model of inheritance, wherein four variant homozygotes departed phenotypically from 15 homozygous reference mice and 20 heterozygous mice with a P value of 7.797 x 10-10 (Figure 2).  

 

The mutation corresponds to residue 289 in the mRNA sequence NM_010255 within exon 1 of 6 total exons.

 

274 GCGGCTGCTGCCTCCAGAGGGGGCCGGGTCTTG
55  -A--A--A--A--S--R--G--G--R--V--L-
 

The mutated nucleotide is indicated in red. The mutation results in substitution of arginine 60 to a premature stop codon (R60*) in the GAMT protein.

Protein Prediction
Figure 3. Domain organization and crystal structure of GAMT. A, There are no defined domains within  GMAT. The secondary structures shown are based on rat GMAT and colors correspond to the crystal structure shown. The mr_bigger mutation results in substitution of arginine 60 for a premature stop codon. B, Crystal structure of a single subunit of rat GMAT. The α-helices are numbered and shown in pink, and β-strands are numbered and shown in blue. SAH is shown in orange. UCSF Chimera model is based on PDB IKHH, Komoto et al., J.Mol.Biol. 320: 223-235 (2002). Click on the 3D structure to view it rotate.

Guanidinoacetate N-methyltransferase (GAMT; alternatively, S-adenosyl-L-methio­nine (SAM):guanidinoacetate N-methyltransferase) is a member of the class I-like SAM-binding methyltransferase superfamily and the RMT2 methyltransferase family. GAMT has no defined functional domains. Trp20, Met50, and Asp135 are predicted to be SAM binding sites, and Met42, Glu46, and Asp135 are involved in substrate binding.

 

Rat GAMT expressed in E. coli was crystallized with S-adenosylhomocysteine (SAH) [Figure 3; PDB:1KHH, (1) and PDB: 1P1B, (2)]. GAMT was cleaved between Leu36 and Gly37 by an undetermined protease (1;2). GAMT is a single domain, with seven α-helices and seven β-strands (1;2). GAMT folds into a typical α/β open sandwich structure and is spherical in shape (1). Truncated GAMT forms a dimer. Each monomer has a ternary complex structure of protein arginine methyltransferase complexed with a protein substrate and SAH. An SAH binds in the active site of each monomer and at the C-terminal ends of β1 and β4. The two monomers point their β-sheets towards each other when forming a dimer. The loop connecting β6 to β7 enters a cleft in the other monomer. The cleft is surrounded by αA, the loop connecting β1 to αB, and the loop connecting β4 to αE.

Expression/Localization

Gamt is expressed in adipose tissue, pancreas, adrenal gland, liver, testis, epididymis, ovary, spleen, heart, and skeletal muscle [(3;4); (BioGPS; GeneAtlas MOE430, gcrma)].

Background
Figure 4. Creatine metabolism. Although most creatine is found in muscle, it can not synthesize creatine. AGAT functions in the first step of creatine synthesis in the kidney to catalyze the formation of guanidoacetic acid (GAA). In the liver, GAMT subsequently facilitates the methylation of GAA to form creatine via the transfer to a methyl group from S-adenosyl-L-methionine (SAM) to GAA. SLC6A8 (not shown) takes up creatine at the target organs from the blood. Muscular creatine and creatine phosphate are converted to creatinine, which diffuses out of the cells is excreted by the kidneys into the urine.

Creatine biosynthesis maintains energy homeostasis by functioning to replenish ATP in vertebrates, especially in the central nervous system and muscles [(5-8); reviewed in (9)]. Creatine is continually degraded to creatinine, which necessitates dietary creatine intake and/or endogenous creatine synthesis (8). Creatine biosynthesis occurs as a two-step process mainly in the kidney, pancreas, and liver [Figure 4; reviewed in (5;6)]. In the first (and rate-limiting) step, AGAT (alternatively, GATM; see the record for mrbig) catalyzes the transfer of an amidino group from arginine to glycine to form ornithine and guanidinoacetic acid (GAA) in the kidney [(8;10;11); reviewed in (9)]. In the second step, GAA is transported to the liver where GAMT methylates GAA to form creatine (5;8;10;11). Creatine is actively transported to the organs (e.g., muscle, nerve tissue, and myocardium) by the blood and taken up via SLC6A8, the creatine transporter (8;12;12;13). For more information about creatine biosynthesis and deficiency, please see mrbig.

 

Mutations in GAMT are linked to GAMT deficiency (alternatively, cerebral creatine deficiency syndrome-2; OMIM: #612736) (14-16). Patients with GAMT deficiency exhibit creatine depletion with concomitant GAA accumulation (17;18). GAA inhibits Na+/K+ ATPase and/or creatine kinase. GAA also evokes picrotoxin- and bicuculline-sensitive GABAA receptor-mediated chloride currents as well as hyperpolarizes globus pallidus neurons, reducing their spontaneous spike frequency. GAMT deficiency is an autosomal recessive disorder that results in developmental delay, mental retardation, muscle hypotonia, extrapyramidal movement abnormalities, and epileptic seizures (19). Creatine supplementation partially ameliorates clinical symptoms in GAMT-deficient patients (14;20).

 

Gamt-deficient (Gamt-/-) mice showed reduced levels of creatine and creatinine with concomitant increased levels of GAA in the serum, urine, and brain (21). In addition, Gamt-/- mice exhibited increased neonatal mortality, reduced body weight and body fat content, muscle hypotonia, and decreased male fertility (21).  However, unlike human patients, Gamt-/- mice displayed only mild cognitive impairment (22). Medial gastrocnemius muscles from the Gamt-/- mice showed reduced maximal tetanic and twitch force as well as increased relaxation times (23).

Putative Mechanism

Similar to Gamt-/- mice (21), the mr_bigger mice exhibited weight loss, indicating loss of GAMT-associated function and creatine deficiency in the mr_bigger mice.

Primers PCR Primer
mr_bigger(F):5'- AGTAGAAATCTTCCCTGGGAGAG -3'
mr_bigger(R):5'- GTTTGCACAGCCTCACCATG -3'

Sequencing Primer
mr_bigger_seq(F):5'- AATCTTCCCTGGGAGAGGAAGTTC -3'
mr_bigger_seq(R):5'- ATGAGCTCTTCTGCAGCTAG -3'
References
  5. Pisano, J. J., Abraham, D., and Udenfriend, S. (1963) Biosynthesis and Disposition of γ-Guanidinobutyric Acid in Mammalian Tissues. Arch Biochem Biophys. 100, 323-329.
Science Writers Eva Marie Y. Moresco, Anne Murray
Illustrators Diantha La Vine, Peter Jurek
AuthorsEmre Turer and Bruce Beutler
List |< first << previous [record 38 of 132] next >> last >|