Phenotypic Mutation 'Pia'

• Allele: Pia
• Mutation Type: missense
• Chromosome: 16
• Coordinate: 17,281,044 bp (GRCm38)
• Base Change: C ⇒ T (forward strand)
• Gene: Pi4ka
• Gene Name: phosphatidylinositol 4-kinase alpha
• Synonym(s): Pik4ca
• Chromosomal Location: 17,280,351-17,406,314 bp (-)
• MGI Phenotype: FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a phosphatidylinositol (PI) 4-kinase which catalyzes the first committed step in the biosynthesis of phosphatidylinositol 4,5-bisphosphate. The mammalian PI 4-kinases have been classified into two types, II and III, based on their molecular mass, and modulation by detergent and adenosine. The protein encoded by this gene is a type III enzyme that is not inhibited by adenosine. [provided by RefSeq, Sep 2014] ; PHENOTYPE: Mice homozygous for a targeted knock-out or knock-in conditionally activated exhibit premature death associated with degeneration of mucosal cells in the stomach and intestines. Mice homozygous for a knock-out allele exhibit early embryonic lethality. [provided by MGI curators]
• Mapped: Yes
• Amino Acid Change: Arginine changed to Histidine
• Institutional Source: Beutler Lab
• Gene Model: predicted gene model for protein(s): [ENSMUSP00000036162] [ENSMUSP00000122550] [ENSMUSP00000156049]
• SMART Domains: Protein: ENSMUSP00000036162; Gene: ENSMUSG00000041720; AA Change: R1992H

Domain	Start	End	E-Value	Type
low complexity region	198	221	N/A	INTRINSIC
low complexity region	243	253	N/A	INTRINSIC
SCOP:d1gw5a_	268	675	2e-3	SMART
low complexity region	895	907	N/A	INTRINSIC
PI3Ka	1483	1671	2.11e-54	SMART
Blast:PI3Kc	1688	1762	2e-39	BLAST
PI3Kc	1788	2041	4.04e-106	SMART

• Predicted Effect: probably damaging ; PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
  (Using ENSMUST00000036161)
• SMART Domains: Protein: ENSMUSP00000122550; Gene: ENSMUSG00000041720; AA Change: R1992H

Domain	Start	End	E-Value	Type
low complexity region	198	221	N/A	INTRINSIC
low complexity region	243	253	N/A	INTRINSIC
SCOP:d1gw5a_	268	675	2e-3	SMART
low complexity region	895	907	N/A	INTRINSIC
PI3Ka	1483	1671	2.11e-54	SMART
Blast:PI3Kc	1688	1762	2e-39	BLAST
PI3Kc	1788	2041	4.04e-106	SMART

• Predicted Effect: probably damaging ; PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
  (Using ENSMUST00000154364)
• SMART Domains: Protein: ENSMUSP00000123156; Gene: ENSMUSG00000041720; AA Change: R157H

Domain	Start	End	E-Value	Type
PI3Kc	57	207	1.3e-1	SMART

• Predicted Effect: probably damaging ; PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
  (Using ENSMUST00000232232)
• Meta Mutation Damage Score: 0.9140
• Is this an essential gene?: Essential (E-score: 1.000)
• Candidate Explorer Status: CE: potential candidate; Verification probability: 0.424; ML prob: 0.4316; human score: -5.5
• Mode of Inheritance: Autosomal Recessive
• Last Updated: 2020-07-29 6:45 PM by External Program
• Record Created: 2016-03-24 9:47 AM by Bruce Beutler
• Record Posted: 2018-09-07
• Science Writers: Anne Murray
• Illustrators: Diantha La Vine
• Authors: Cristhiaan D. Ochoa, Ying Wang, Zhao Zhang, and Bruce Beutler

Accession Number

NCBI RefSeq: NM_001001983; MGI:2448506

Alleles Listed at MGI

All Mutations and Alleles(28) : Gene trapped(21) Targeted(7)

Phenotypic Description

Figure 1. Pia mice exhibited reduced MTT values of peritoneal exudate cells . Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The pia phenotype was identified among N-ethyl-N-nitrosourea (ENU)-mutagenized G3 mice of the pedigree R4427, some of which showed reduced MTT values of peritoneal exudate cells (Figure 1).

Nature of Mutation

Figure 2. Linkage mapping of the reduced MTT values of peritoneal exudate cellsusing a recessive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 46 mutations (X-axis) identified in the G1 male of pedigree R4427. Normalized phenotype data are shown for single locus linkage analysis without consideration of G2 dam identity. Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Figure 3. CRISPR- Pi4ka mice exhibited reduced MTT values of peritoneal exudate cells . Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Whole exome HiSeq sequencing of the G1 grandsire identified 46 mutations. All of the above anomalies were linked by continuous variable mapping to a mutation in Pi4ka: a G to A transition at base pair 17,281,044 (v38) on chromosome 16, or base pair 125,271 in the GenBank genomic region NC_000082 encoding Pi4ka. Linkage was found with a recessive model of inheritance, wherein seven variant homozygotes departed phenotypically from 25 homozygous reference mice and 23 heterozygous mice with a P value of 4.02x 10^-5 (Figure 2).  

 

The mutation corresponds to residue 6,053 in the mRNA sequence NM_001001983 within exon 53 of 55 total exons.

 

6037 GGCCTGCCCTGTTTTCGTGGCCAGACAATCAAA 1987 -G--L--P--C--F--R--G--Q--T--I--K-

The mutated nucleotide is indicated in red. The mutation results in an arginine (R) to histidine (H) substitution at position 1,992 (R1992H) in the PI4KA protein, and is strongly predicted by PolyPhen-2 to be damaging (score = 0.997).

 

The causative mutation for the MTT phenotype was validated to be in Pi4ka by CRISPR-mediated replacement of the Pi4ka^Pia allele (Figure 3; P = 0.004752).

Protein Prediction

Figure 4. Domain organization of PI4KIIIα. The pia mutation results in an arginine to histidine substitution at position 1,992. This image is interactive. Other mutations found in PI4KIIIα. Click on each allele for more information. SH3: SRC Homology 3; NLS: Nuclear Localization Signal; LKU: Lipid Kinase Unique; PH: Pleckstrin Homology.

Pi4ka encodes phosphatidylinositol-4-kinase IIIα (PI4KIIIα; alternatively STT4), a member of the PI3/PI4 kinase family.

 

PI4KIIIα has a Src homology 3 (SH3) domain, two nuclear localization signals, a PI-3-kinase (PIK) accessory domain (alternatively, lipid kinase unique (LKU) domain), a pleckstrin homology (PH) domain, and a PI3K/PI4K catalytic domain (Figure 4). SH3 domains mediate protein-protein interactions, namely interactions with signaling proteins. The role of the PIK/LKU domain is unknown, but it is predicted to promote substrate presentation [SMART; (1)]. The PI4KIIIα PH domain binds PI 4-phosphate [PI(4)P] (2) and may contribute to product inhibition (3). The PI4KIIIα catalytic domain shares sequence similarities to other PI3K/PI3K family members.

 

Pik4a putatively produces two isoforms: a 230 kDa isoform (isoform 2) and a shorter splice variant that only contains the portion of the C-terminus containing the catalytic domain (isoform 1) (4-6). The shorter form of PI4KIIIα, if produced, is not predicted to be functional (6).

 

The pia mutation results in an arginine (R) to histidine (H) substitution at position 1,992 (R1992H); Arg1992 is within the catalytic domain.

Expression/Localization

Pi4ka is ubiquitously expressed, but is highly expressed in the brain (7-9). PI4KIIIα primarily localizes to the endoplasmic reticulum and the trans-Golgi network (4;6;7;10;11).

Background

Figure 5. PI4KIIIα involvement in the biosynthesis of PI(4,5)P₂. The headgroup of phosphatidylinositol (PI) can be phosphorylated at the D3, D4 and D5 positions by various kinases to generate eight higher phosphoinositides (PIs); PIs phosphorylated by PI 4-kinases (PI4Ks) are shown. Reverse (dephosphorylation) reactions catalysed by specific PI phosphatases are shown. Abbreviations: OCRL, inositol polyphosphate 5-phosphatase; PTEN, phosphatase and tensin homolog; PI(4)P, phosphatidylinositol 4-phosphate; PI(4,5)P 2 , phosphatidylinositol 4,5-bisphosphate; PI(3,4,5)P 2, phosphatidylinositol 3,4,5-trisphosphate

Figure 6. Crystal structure of human PI4KIIIa lipid complex. A, Complex including Tetratricoprotein repeat protein 7B (TTC7B), PFAM 126A, and PI4KIIIa .B, Isolated PI4KIIIa protein. Domains are colored as in Figure 7. The pia mutation occurs in an unsolved section of the protein. This image in interactive. Click on Panel B to view the structure rotate. UCSF Chimera model is based on PDB 6BQ1.

PI4KIIIα is one of four enzymes that catalyzes the first step in the biosynthesis of phosphatidylinositol 4,5-bisphosphate [PI(4,5)P₂] by phosphorylating PI at the 4-position of the inositol ring to form PI(4)P (Figure 5) (10). PI(4)P regulates membrane trafficking at several steps and the surface delivery of apically and basolaterally destined proteins in polarized cells. In the metabolism of D₄ phosphorylated PIs, PI(4)P is subsequently phosphorylated by PI(4)P 5-kinases to form PI(4,5)P₂. PI(4,5)P₂ can subsequently be phosphorylated by PI3Ks to form PI(3,4,5)P₃. PI(3,4,5)P₃ can then be converted to PI(3,4)P₂.

 

PI4KIIIα is part of a complex with TTC7, FAM126, and EFR3 [Figure 6; PDB: 6BQ1; (10;12-14)]. EFR3 is a peripheral plasma membrane protein that recruits PI4KIIIα via the TTC7/FAM126 heterodimer. The plasma membrane protein TMEM150A regulates PI(4,5)P₂ production by reducing the association of TTC7 with the EFR3-PI4KIIIα complex (15).

 

PI4KIIIα is required for protein trafficking from the endoplasmic reticulum to the plasma membrane (16). PI4KIIIα also promotes the PI(4)P-mediated recruitment of the guanine nucleotide exchange factor GBF1 (Golgi-specific brefeldin A resistance guanine nucleotide exchange factor 1) to Golgi membranes (17). At the Golgi membrane, GBF1 activates Arf1 (ADP ribosylation factor-1) through the conversion of Arf1 from a GDP-bound to a GTP-bound state (18). ARF1 is required for the formation of trafficking vesicles for sorting and trafficking cargo from the Golgi apparatus to several cellular destinations including the lysosome and plasma membrane (19).

 

PI4KIIIα is a host cell factor for hepatitis C virus replication (20-23). PI4KIIIα regulates viral RNA replication by favoring p56 or repressing p58 synthesis as well as promoting the enrichment of PI(4)P to the hepatitis C virus-containing membranous web in the host cell (24;25). PI4KIIIα also regulates the phosphorylation of hepatitis C virus nonstructural protein 5A (NS5A) (24-26). PI4KIIIα is required for NS5A-mediated mitochondrial fragmentation in host cells, which subsequently makes cells more resistant to mitochondrial-mediated apoptosis (27).

 

PI4KIIIα was identified as a factor in hematopoiesis, namely in erythroid and myeloid maturation, in a forward genetic screen using Sleeping Beauty (SB) transposon mutagenesis (28). Pi4ka mutant spleens had less lymphocytic, more hematopoietic stem cells, and more common myeloid progenitor features when compared with controls. During hematopoiesis, PI4KIIIα putatively functions in maintaining the balance between phosphorylated AKT and phosphorylated ERK downstream of the IL-3 receptor and cKit (see the record for pretty2). Knockdown of PI4KIIIα in the mouse myeloid lineage cell line 32D caused increased phosphorylation of ERK, but reduced IL-3-induced phosphorylation of AKT.

 

Mutations in PIK4A are associated with perisylvian polymicrogyria, cerebellar hypoplasia, and arthrogryposis (PMGYCHA; OMIM: #616531) (29). Perisylvian polymicrogyria is a neurological condition that affects the cerebral cortex due to impaired neuronal migration. Patients with perisylvian polymicrogyria exhibit partial paralysis of muscles of the face, tongue, jaws, and throat, which causes speaking, chewing, and swallowing difficulties. Arthrogryposis are congenital joint contractures.

 

Pi4ka-deficient mice exhibited early embryonic lethality (10). Homozygous mice expressing a kinase-defective PI4KIIIα were also lethal, exhibiting mucosal epithelial degeneration in the gastrointestinal tract (30). Mice with Schwann cell-specific deletion of Pi4ka showed myelination defects as well as reduced levels of the lipids phosphatidylserine, phosphatidylethanolamine, and sphingomyelin in the nerves (31).

Putative Mechanism

The phenotypes of the pia mice indicate loss of PI4KIIIα^pia function. However, lethality was not observed in homozygous pia mice indicating that some function was retained.

Primers

PCR Primer
Pia_pcr_F: GGCATTTGTGGGAATCTGCC
Pia_pcr_R: ATAGTGCTATATGTGGTCCTGCTAG

Sequencing Primer
Pia_seq_F: CCCAGGGACATTATGCTGTG
Pia_seq_R: TCCTGCTAGCAGATTGTATGGAGAAG

Genotyping

PCR program

1) 94°C 2:00
2) 94°C 0:30
3) 55°C 0:30
4) 72°C 1:00
5) repeat steps (2-4) 40x
6) 72°C 10:00
7) 4°C hold

The following sequence of 403 nucleotides is amplified (chromosome 16, - strand):

1   atagtgctat atgtggtcct gctagcagat tgtatggaga agtggcagct ggaccacagg
61  ttctgtgagc agggtacctc acactgtttg tcccccaccc tctgtctcca cagcccctat
121 atggatgcag tcgtctccct ggttacactc atgttggaca caggcctgcc ctgttttcgt
181 ggccagacaa tcaaactttt gaagtaggta ccatctgctg gggctctatc tagaaatgta
241 tgtatccttg gatccccaga gcagacaggg ggtttataga atagccacat gatcatgcac
301 tccccatgtg gcctagtaat tgctggcgag gatcagggag catactagac cacagcataa
361 tgtccctggg ggatgggggg gggggcagat tcccacaaat gcc

Primer binding sites are underlined and the sequencing primers are highlighted; the mutated nucleotide is shown in red.

References

  1. Flanagan, C. A., Schnieders, E. A., Emerick, A. W., Kunisawa, R., Admon, A., and Thorner, J. (1993) Phosphatidylinositol 4-Kinase: Gene Structure and Requirement for Yeast Cell Viability. Science. 262, 1444-1448.

  2. Stevenson, J. M., Perera, I. Y., and Boss, W. F. (1998) A Phosphatidylinositol 4-Kinase Pleckstrin Homology Domain that Binds Phosphatidylinositol 4-Monophosphate. J Biol Chem. 273, 22761-22767.

  3. Stevenson-Paulik, J., Love, J., and Boss, W. F. (2003) Differential Regulation of Two Arabidopsis Type III Phosphatidylinositol 4-Kinase Isoforms. A Regulatory Role for the Pleckstrin Homology Domain. Plant Physiol. 132, 1053-1064.

  4. Nakagawa, T., Goto, K., and Kondo, H. (1996) Cloning, Expression, and Localization of 230-kDa Phosphatidylinositol 4-Kinase. J Biol Chem. 271, 12088-12094.

  5. Nakagawa, T., Goto, K., and Kondo, H. (1996) Cloning and Characterization of a 92 kDa Soluble Phosphatidylinositol 4-Kinase. Biochem J. 320 ( Pt 2), 643-649.

  6. Szentpetery, Z., Szakacs, G., Bojjireddy, N., Tai, A. W., and Balla, T. (2011) Genetic and Functional Studies of Phosphatidyl-Inositol 4-Kinase Type IIIalpha. Biochim Biophys Acta. 1811, 476-483.

  7. Wong, K., Meyers, d., and Cantley, L. C. (1997) Subcellular Locations of Phosphatidylinositol 4-Kinase Isoforms. J Biol Chem. 272, 13236-13241.

  8. Gehrmann, T., Gulkan, H., Suer, S., Herberg, F. W., Balla, A., Vereb, G., Mayr, G. W., and Heilmeyer, L. M.,Jr. (1999) Functional Expression and Characterisation of a New Human Phosphatidylinositol 4-Kinase PI4K230. Biochim Biophys Acta. 1437, 341-356.

  9. Zolyomi, A., Zhao, X., Downing, G. J., and Balla, T. (2000) Localization of Two Distinct Type III Phosphatidylinositol 4-Kinase Enzyme mRNAs in the Rat. Am J Physiol Cell Physiol. 278, C914-20.

  10. Nakatsu, F., Baskin, J. M., Chung, J., Tanner, L. B., Shui, G., Lee, S. Y., Pirruccello, M., Hao, M., Ingolia, N. T., Wenk, M. R., and De Camilli, P. (2012) PtdIns4P Synthesis by PI4KIIIalpha at the Plasma Membrane and its Impact on Plasma Membrane Identity. J Cell Biol. 199, 1003-1016.

  11. Weixel, K. M., Blumental-Perry, A., Watkins, S. C., Aridor, M., and Weisz, O. A. (2005) Distinct Golgi Populations of Phosphatidylinositol 4-Phosphate Regulated by Phosphatidylinositol 4-Kinases. J Biol Chem. 280, 10501-10508.

  12. Baird, D., Stefan, C., Audhya, A., Weys, S., and Emr, S. D. (2008) Assembly of the PtdIns 4-Kinase Stt4 Complex at the Plasma Membrane Requires Ypp1 and Efr3. J Cell Biol. 183, 1061-1074.

  13. Wu, X., Chi, R. J., Baskin, J. M., Lucast, L., Burd, C. G., De Camilli, P., and Reinisch, K. M. (2014) Structural Insights into Assembly and Regulation of the Plasma Membrane Phosphatidylinositol 4-Kinase Complex. Dev Cell. 28, 19-29.

  14. Lees, J. A., Zhang, Y., Oh, M. S., Schauder, C. M., Yu, X., Baskin, J. M., Dobbs, K., Notarangelo, L. D., De Camilli, P., Walz, T., and Reinisch, K. M. (2017) Architecture of the Human PI4KIIIalpha Lipid Kinase Complex. Proc Natl Acad Sci U S A. 114, 13720-13725.

  15. Chung, J., Nakatsu, F., Baskin, J. M., and De Camilli, P. (2015) Plasticity of PI4KIIIalpha Interactions at the Plasma Membrane. EMBO Rep. 16, 312-320.

  16. Bryant, K. L., Baird, B., and Holowka, D. (2015) A Novel Fluorescence-Based Biosynthetic Trafficking Method Provides Pharmacologic Evidence that PI4-Kinase IIIalpha is Important for Protein Trafficking from the Endoplasmic Reticulum to the Plasma Membrane. BMC Cell Biol. 16, 5-015-0049-5.

  17. Dumaresq-Doiron, K., Savard, M. F., Akam, S., Costantino, S., and Lefrancois, S. (2010) The Phosphatidylinositol 4-Kinase PI4KIIIalpha is Required for the Recruitment of GBF1 to Golgi Membranes. J Cell Sci. 123, 2273-2280.

  18. Niu, T. K., Pfeifer, A. C., Lippincott-Schwartz, J., and Jackson, C. L. (2005) Dynamics of GBF1, a Brefeldin A-Sensitive Arf1 Exchange Factor at the Golgi. Mol Biol Cell. 16, 1213-1222.

  19. Dell'Angelica, E. C., Puertollano, R., Mullins, C., Aguilar, R. C., Vargas, J. D., Hartnell, L. M., and Bonifacino, J. S. (2000) GGAs: A Family of ADP Ribosylation Factor-Binding Proteins Related to Adaptors and Associated with the Golgi Complex. J Cell Biol. 149, 81-94.

  20. Vaillancourt, F. H., Pilote, L., Cartier, M., Lippens, J., Liuzzi, M., Bethell, R. C., Cordingley, M. G., and Kukolj, G. (2009) Identification of a Lipid Kinase as a Host Factor Involved in Hepatitis C Virus RNA Replication. Virology. 387, 5-10.

  21. Borawski, J., Troke, P., Puyang, X., Gibaja, V., Zhao, S., Mickanin, C., Leighton-Davies, J., Wilson, C. J., Myer, V., Cornellataracido, I., Baryza, J., Tallarico, J., Joberty, G., Bantscheff, M., Schirle, M., Bouwmeester, T., Mathy, J. E., Lin, K., Compton, T., Labow, M., Wiedmann, B., and Gaither, L. A. (2009) Class III Phosphatidylinositol 4-Kinase Alpha and Beta are Novel Host Factor Regulators of Hepatitis C Virus Replication. J Virol. 83, 10058-10074.

  22. Lim, Y. S., and Hwang, S. B. (2011) Hepatitis C Virus NS5A Protein Interacts with Phosphatidylinositol 4-Kinase Type IIIalpha and Regulates Viral Propagation. J Biol Chem. 286, 11290-11298.

  23. Berger, K. L., Kelly, S. M., Jordan, T. X., Tartell, M. A., and Randall, G. (2011) Hepatitis C Virus Stimulates the Phosphatidylinositol 4-Kinase III Alpha-Dependent Phosphatidylinositol 4-Phosphate Production that is Essential for its Replication. J Virol. 85, 8870-8883.

  24. Tai, A. W., and Salloum, S. (2011) The Role of the Phosphatidylinositol 4-Kinase PI4KA in Hepatitis C Virus-Induced Host Membrane Rearrangement. PLoS One. 6, e26300.

  25. Reiss, S., Harak, C., Romero-Brey, I., Radujkovic, D., Klein, R., Ruggieri, A., Rebhan, I., Bartenschlager, R., and Lohmann, V. (2013) The Lipid Kinase Phosphatidylinositol-4 Kinase III Alpha Regulates the Phosphorylation Status of Hepatitis C Virus NS5A. PLoS Pathog. 9, e1003359.

  26. Lim, Y. S., and Hwang, S. B. (2011) Hepatitis C Virus NS5A Protein Interacts with Phosphatidylinositol 4-Kinase Type IIIalpha and Regulates Viral Propagation. J Biol Chem. 286, 11290-11298.

  27. Siu, G. K., Zhou, F., Yu, M. K., Zhang, L., Wang, T., Liang, Y., Chen, Y., Chan, H. C., and Yu, S. (2016) Hepatitis C Virus NS5A Protein Cooperates with Phosphatidylinositol 4-Kinase IIIalpha to Induce Mitochondrial Fragmentation. Sci Rep. 6, 23464.

  28. Ziyad, S., Riordan, J. D., Cavanaugh, A. M., Su, T., Hernandez, G. E., Hilfenhaus, G., Morselli, M., Huynh, K., Wang, K., Chen, J. N., Dupuy, A. J., and Iruela-Arispe, M. L. (2018) A Forward Genetic Screen Targeting the Endothelium Reveals a Regulatory Role for the Lipid Kinase Pi4ka in Myelo- and Erythropoiesis. Cell Rep. 22, 1211-1224.

  29. Pagnamenta, A. T., Howard, M. F., Wisniewski, E., Popitsch, N., Knight, S. J., Keays, D. A., Quaghebeur, G., Cox, H., Cox, P., Balla, T., Taylor, J. C., and Kini, U. (2015) Germline Recessive Mutations in PI4KA are Associated with Perisylvian Polymicrogyria, Cerebellar Hypoplasia and Arthrogryposis. Hum Mol Genet. 24, 3732-3741.

  30. Vaillancourt, F. H., Brault, M., Pilote, L., Uyttersprot, N., Gaillard, E. T., Stoltz, J. H., Knight, B. L., Pantages, L., McFarland, M., Breitfelder, S., Chiu, T. T., Mahrouche, L., Faucher, A. M., Cartier, M., Cordingley, M. G., Bethell, R. C., Jiang, H., White, P. W., and Kukolj, G. (2012) Evaluation of Phosphatidylinositol-4-Kinase IIIalpha as a Hepatitis C Virus Drug Target. J Virol. 86, 11595-11607.

  31. Alvarez-Prats, A., Bjelobaba, I., Aldworth, Z., Baba, T., Abebe, D., Kim, Y. J., Stojilkovic, S. S., Stopfer, M., and Balla, T. (2018) Schwann-Cell-Specific Deletion of Phosphatidylinositol 4-Kinase Alpha Causes Aberrant Myelination. Cell Rep. 23, 2881-2890.