Phenotypic Mutation 'ito2' (pdf version)
Alleleito2
Mutation Type missense
Chromosome15
Coordinate66,671,396 bp (GRCm38)
Base Change G ⇒ A (forward strand)
Gene Tg
Gene Name thyroglobulin
Synonym(s) Tgn
Chromosomal Location 66,670,753-66,850,721 bp (+)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Thyroglobulin (Tg) is a glycoprotein homodimer produced predominantly by the thryroid gland. It acts as a substrate for the synthesis of thyroxine and triiodothyronine as well as the storage of the inactive forms of thyroid hormone and iodine. Thyroglobulin is secreted from the endoplasmic reticulum to its site of iodination, and subsequent thyroxine biosynthesis, in the follicular lumen. Mutations in this gene cause thyroid dyshormonogenesis, manifested as goiter, and are associated with moderate to severe congenital hypothyroidism. Polymorphisms in this gene are associated with susceptibility to autoimmune thyroid diseases (AITD) such as Graves disease and Hashimoto thryoiditis. [provided by RefSeq, Nov 2009]
PHENOTYPE: Mice homozygous for a spontaneous mutation exhibit enlarged thyroid gland, hypothyroidism, abnormal thyroid gland morphology, and decreased body weight. [provided by MGI curators]
Accession Number

NCBI RefSeq: NM_027902; MGI:1919003

MappedYes 
Amino Acid Change Cysteine changed to Tyrosine
Institutional SourceBeutler Lab
Gene Model predicted gene model for protein(s): [ENSMUSP00000070239]
AlphaFold no structure available at present
SMART Domains Protein: ENSMUSP00000070239
Gene: ENSMUSG00000053469
AA Change: C53Y

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
TY 50 97 5.9e-16 SMART
TY 118 165 5.59e-17 SMART
Pfam:Thyroglobulin_1 174 252 4e-9 PFAM
TY 317 363 4.36e-19 SMART
low complexity region 495 504 N/A INTRINSIC
TY 617 662 3.58e-15 SMART
TY 684 730 1.47e-16 SMART
TY 880 926 1.51e-4 SMART
TY 1029 1078 1.21e-12 SMART
TY 1106 1150 7.56e-5 SMART
TY 1167 1215 7.26e-16 SMART
low complexity region 1244 1255 N/A INTRINSIC
Pfam:GCC2_GCC3 1464 1509 2.7e-16 PFAM
TY 1519 1568 9.81e-13 SMART
Pfam:COesterase 2181 2717 8.4e-140 PFAM
Predicted Effect probably damaging

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
(Using ENSMUST00000065916)
Meta Mutation Damage Score 0.9461 question?
Is this an essential gene? Probably nonessential (E-score: 0.110) question?
Phenotypic Category Autosomal Recessive
Candidate Explorer Status loading ...
Single pedigree
Linkage Analysis Data
Penetrance  
Alleles Listed at MGI

All Mutations and Alleles(12) : Chemically induced (ENU)(3) Gene trapped(2) Radiation induced(1) Targeted(6)

Lab Alleles
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00157:Tg APN 15 66847166 missense probably damaging 1.00
IGL00230:Tg APN 15 66827290 missense probably benign 0.00
IGL00324:Tg APN 15 66693424 missense probably benign
IGL00428:Tg APN 15 66773424 missense probably benign 0.33
IGL00703:Tg APN 15 66696489 missense probably benign 0.34
IGL00808:Tg APN 15 66683813 missense probably damaging 1.00
IGL00833:Tg APN 15 66688801 missense probably benign 0.34
IGL00899:Tg APN 15 66674073 critical splice donor site probably null
IGL00921:Tg APN 15 66764453 missense probably benign 0.28
IGL00975:Tg APN 15 66681882 missense probably benign
IGL01288:Tg APN 15 66736276 missense possibly damaging 0.81
IGL01397:Tg APN 15 66696092 splice site probably benign
IGL01634:Tg APN 15 66729566 missense probably benign 0.34
IGL01646:Tg APN 15 66678087 missense probably damaging 1.00
IGL01704:Tg APN 15 66671351 missense probably damaging 0.98
IGL01958:Tg APN 15 66759486 missense probably benign 0.06
IGL02093:Tg APN 15 66692374 missense possibly damaging 0.83
IGL02113:Tg APN 15 66705330 missense probably benign 0.08
IGL02138:Tg APN 15 66717233 missense probably benign 0.01
IGL02156:Tg APN 15 66705348 missense probably benign 0.19
IGL02169:Tg APN 15 66757943 missense probably benign 0.04
IGL02342:Tg APN 15 66764291 missense probably benign
IGL02434:Tg APN 15 66764342 missense probably damaging 0.97
IGL02506:Tg APN 15 66741594 missense possibly damaging 0.71
IGL02513:Tg APN 15 66705274 missense probably benign
IGL02549:Tg APN 15 66839361 missense probably damaging 1.00
IGL02669:Tg APN 15 66748726 splice site probably benign
IGL02756:Tg APN 15 66734586 missense probably benign
IGL02800:Tg APN 15 66757886 missense probably damaging 1.00
IGL02828:Tg APN 15 66682394 missense probably damaging 1.00
IGL02927:Tg APN 15 66678093 missense probably damaging 1.00
IGL03061:Tg APN 15 66671405 missense probably damaging 1.00
IGL03105:Tg APN 15 66715106 missense probably benign 0.01
IGL03160:Tg APN 15 66839303 nonsense probably null
IGL03242:Tg APN 15 66683798 missense probably damaging 0.99
Also_ran UTSW 15 66678839 missense probably damaging 1.00
bedraggled UTSW 15 66740714 missense probably damaging 1.00
foster UTSW 15 66693260 nonsense probably null
hognose UTSW 15 66717208 missense probably damaging 0.99
ito UTSW 15 66766162 nonsense probably null
ito3 UTSW 15 66773474 missense probably damaging 1.00
ito4 UTSW 15 66696520 missense possibly damaging 0.47
Papua UTSW 15 66674050 missense probably damaging 1.00
Pipistrella UTSW 15 66696135 missense probably damaging 1.00
pluribus UTSW 15 66715163 missense probably damaging 0.98
samarai UTSW 15 66758006 critical splice donor site probably null
sariba UTSW 15 66694870 missense probably benign 0.01
ticker UTSW 15 66827382 nonsense probably null
Vampire UTSW 15 66682827 missense probably damaging 1.00
IGL03134:Tg UTSW 15 66740718 missense probably damaging 1.00
P0019:Tg UTSW 15 66688863 missense probably benign 0.01
R0121:Tg UTSW 15 66740781 missense probably benign 0.04
R0135:Tg UTSW 15 66694870 missense probably benign 0.01
R0227:Tg UTSW 15 66698446 missense possibly damaging 0.84
R0448:Tg UTSW 15 66764442 missense probably damaging 1.00
R0453:Tg UTSW 15 66828533 missense probably benign 0.09
R0504:Tg UTSW 15 66682404 missense probably damaging 0.97
R0543:Tg UTSW 15 66729597 missense probably benign 0.13
R0638:Tg UTSW 15 66717208 missense probably damaging 0.99
R0639:Tg UTSW 15 66741484 critical splice acceptor site probably null
R0646:Tg UTSW 15 66729626 missense probably damaging 0.99
R0666:Tg UTSW 15 66737521 missense probably benign
R0673:Tg UTSW 15 66741484 critical splice acceptor site probably null
R0689:Tg UTSW 15 66839404 splice site probably benign
R0704:Tg UTSW 15 66757880 missense probably benign 0.02
R0730:Tg UTSW 15 66678789 missense probably damaging 1.00
R0830:Tg UTSW 15 66725144 missense probably damaging 1.00
R0959:Tg UTSW 15 66708010 missense probably damaging 0.98
R1027:Tg UTSW 15 66672409 missense possibly damaging 0.65
R1061:Tg UTSW 15 66698559 missense probably benign 0.09
R1086:Tg UTSW 15 66684062 missense probably benign
R1103:Tg UTSW 15 66719655 missense probably benign 0.45
R1240:Tg UTSW 15 66828548 missense probably benign 0.16
R1281:Tg UTSW 15 66696489 missense probably benign 0.34
R1470:Tg UTSW 15 66849463 missense possibly damaging 0.95
R1470:Tg UTSW 15 66849463 missense possibly damaging 0.95
R1531:Tg UTSW 15 66850502 missense probably benign 0.02
R1544:Tg UTSW 15 66705232 missense probably benign 0.04
R1550:Tg UTSW 15 66693430 missense possibly damaging 0.52
R1575:Tg UTSW 15 66729685 critical splice donor site probably null
R1638:Tg UTSW 15 66696166 nonsense probably null
R1655:Tg UTSW 15 66828568 critical splice donor site probably null
R1671:Tg UTSW 15 66692387 missense possibly damaging 0.89
R1789:Tg UTSW 15 66737548 missense probably benign 0.00
R1883:Tg UTSW 15 66671309 missense probably damaging 1.00
R1984:Tg UTSW 15 66682842 missense probably benign
R2063:Tg UTSW 15 66828553 missense probably damaging 1.00
R2092:Tg UTSW 15 66849607 missense probably null 0.26
R2109:Tg UTSW 15 66729594 missense probably benign 0.02
R2128:Tg UTSW 15 66694894 missense probably benign 0.10
R2129:Tg UTSW 15 66694894 missense probably benign 0.10
R2207:Tg UTSW 15 66681939 missense probably benign 0.15
R2219:Tg UTSW 15 66681933 missense probably benign 0.03
R2228:Tg UTSW 15 66674011 missense probably damaging 0.99
R2229:Tg UTSW 15 66674011 missense probably damaging 0.99
R2259:Tg UTSW 15 66683898 missense probably benign
R2994:Tg UTSW 15 66681953 missense probably benign
R3904:Tg UTSW 15 66766162 nonsense probably null
R3946:Tg UTSW 15 66674023 missense probably damaging 1.00
R3965:Tg UTSW 15 66684190 missense probably benign
R4245:Tg UTSW 15 66696469 missense possibly damaging 0.68
R4451:Tg UTSW 15 66766147 missense probably benign 0.01
R4487:Tg UTSW 15 66671396 missense probably damaging 1.00
R4489:Tg UTSW 15 66707942 missense probably damaging 1.00
R4623:Tg UTSW 15 66735271 missense probably benign 0.23
R4659:Tg UTSW 15 66673920 missense possibly damaging 0.67
R4728:Tg UTSW 15 66682827 missense probably damaging 1.00
R4760:Tg UTSW 15 66693319 missense probably damaging 1.00
R4797:Tg UTSW 15 66758006 critical splice donor site probably null
R4944:Tg UTSW 15 66764337 missense probably damaging 1.00
R4998:Tg UTSW 15 66674050 missense probably damaging 1.00
R5009:Tg UTSW 15 66696586 missense probably benign 0.01
R5025:Tg UTSW 15 66707930 missense probably damaging 1.00
R5035:Tg UTSW 15 66681813 splice site probably null
R5049:Tg UTSW 15 66827382 nonsense probably null
R5073:Tg UTSW 15 66735252 missense probably benign 0.05
R5169:Tg UTSW 15 66678780 nonsense probably null
R5185:Tg UTSW 15 66773474 missense probably damaging 1.00
R5227:Tg UTSW 15 66759567 missense possibly damaging 0.87
R5300:Tg UTSW 15 66678855 missense probably damaging 1.00
R5334:Tg UTSW 15 66678055 missense probably damaging 1.00
R5339:Tg UTSW 15 66678093 missense probably damaging 1.00
R5402:Tg UTSW 15 66739168 missense probably damaging 0.98
R5441:Tg UTSW 15 66696520 missense possibly damaging 0.47
R5509:Tg UTSW 15 66827293 missense probably benign 0.45
R5580:Tg UTSW 15 66685300 missense possibly damaging 0.66
R5582:Tg UTSW 15 66693435 missense probably damaging 1.00
R5624:Tg UTSW 15 66838057 missense probably benign 0.11
R5686:Tg UTSW 15 66688889 missense probably benign 0.28
R6042:Tg UTSW 15 66683993 missense probably benign 0.01
R6122:Tg UTSW 15 66828457 missense probably damaging 1.00
R6146:Tg UTSW 15 66673367 splice site probably null
R6159:Tg UTSW 15 66735247 missense possibly damaging 0.71
R6223:Tg UTSW 15 66707922 missense probably benign 0.15
R6480:Tg UTSW 15 66671311 missense probably damaging 1.00
R6505:Tg UTSW 15 66759558 missense probably damaging 0.99
R6531:Tg UTSW 15 66839362 missense probably damaging 0.99
R6614:Tg UTSW 15 66735259 missense probably damaging 0.99
R6698:Tg UTSW 15 66839362 missense probably damaging 1.00
R6798:Tg UTSW 15 66678839 missense probably damaging 1.00
R6837:Tg UTSW 15 66696135 missense probably damaging 1.00
R6861:Tg UTSW 15 66688891 missense probably benign 0.00
R6888:Tg UTSW 15 66696246 missense probably damaging 0.99
R6933:Tg UTSW 15 66764309 missense possibly damaging 0.73
R6983:Tg UTSW 15 66693358 missense probably benign 0.01
R7078:Tg UTSW 15 66673543 missense probably damaging 1.00
R7244:Tg UTSW 15 66740714 missense probably damaging 1.00
R7320:Tg UTSW 15 66694784 missense possibly damaging 0.71
R7334:Tg UTSW 15 66725272 missense probably benign 0.01
R7418:Tg UTSW 15 66696583 missense probably damaging 0.99
R7485:Tg UTSW 15 66696588 missense probably benign 0.04
R7524:Tg UTSW 15 66696161 missense probably benign 0.01
R7529:Tg UTSW 15 66694768 missense probably damaging 0.99
R7540:Tg UTSW 15 66689927 missense probably benign 0.16
R7583:Tg UTSW 15 66764418 missense probably damaging 1.00
R7594:Tg UTSW 15 66729583 missense probably benign 0.20
R7667:Tg UTSW 15 66715163 missense probably damaging 0.98
R7722:Tg UTSW 15 66764309 missense possibly damaging 0.73
R7790:Tg UTSW 15 66849604 missense probably damaging 0.99
R7838:Tg UTSW 15 66693263 missense probably benign 0.00
R7890:Tg UTSW 15 66683814 missense probably damaging 1.00
R7904:Tg UTSW 15 66705279 missense probably benign 0.08
R7919:Tg UTSW 15 66684074 missense possibly damaging 0.73
R7921:Tg UTSW 15 66683793 missense probably benign 0.08
R8037:Tg UTSW 15 66688875 missense probably benign 0.00
R8038:Tg UTSW 15 66688875 missense probably benign 0.00
R8214:Tg UTSW 15 66773398 missense probably damaging 1.00
R8304:Tg UTSW 15 66693260 nonsense probably null
R8688:Tg UTSW 15 66694953 critical splice donor site probably benign
R8709:Tg UTSW 15 66681937 missense probably benign 0.08
R8714:Tg UTSW 15 66684042 missense probably damaging 0.97
R8901:Tg UTSW 15 66685335 missense probably damaging 1.00
R8917:Tg UTSW 15 66773483 critical splice donor site probably null
R9023:Tg UTSW 15 66683673 missense probably damaging 1.00
R9232:Tg UTSW 15 66698461 missense probably benign 0.01
R9310:Tg UTSW 15 66827269 missense possibly damaging 0.69
R9361:Tg UTSW 15 66685397 missense possibly damaging 0.50
R9389:Tg UTSW 15 66689324 missense probably benign 0.04
R9501:Tg UTSW 15 66847074 missense possibly damaging 0.52
R9510:Tg UTSW 15 66674064 missense probably damaging 1.00
R9594:Tg UTSW 15 66735260 nonsense probably null
R9629:Tg UTSW 15 66683738 missense possibly damaging 0.95
R9701:Tg UTSW 15 66766142 missense probably benign 0.03
R9743:Tg UTSW 15 66689990 missense probably benign 0.18
R9748:Tg UTSW 15 66847159 missense possibly damaging 0.91
T0975:Tg UTSW 15 66688863 missense probably benign 0.01
X0005:Tg UTSW 15 66688863 missense probably benign 0.01
X0065:Tg UTSW 15 66682454 missense probably damaging 1.00
X0067:Tg UTSW 15 66748743 missense probably benign 0.10
Z1177:Tg UTSW 15 66685310 missense possibly damaging 0.49
Z1177:Tg UTSW 15 66849547 missense probably benign 0.02
Mode of Inheritance Autosomal Recessive
Local Stock
Repository
Last Updated 2019-09-04 9:43 PM by Diantha La Vine
Record Created 2016-04-05 6:18 PM
Record Posted 2016-09-19
Phenotypic Description
Figure 1. Ito2 mice exhibited reduced body weights compared to their wild-type littermates. Scaled weight data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The ito2 phenotype was identified among G3 mice of the pedigree R4487, some of which had reduced body weights compared to wild-type controls (Figure 1).

Nature of Mutation
Figure 2. Linkage mapping of the reduced body weight using a recessive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 38 mutations (X-axis) identified in the G1 male of pedigree R4487. Scaled weight data are shown for single locus linkage analysis with consideration of G2 dam identity. Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 38 mutations. The body weight phenotype was linked to a mutation in Tg: a G to A transversion at base pair 66,671,396 (v38) on chromosome 15, or base pair 641 in the GenBank genomic region NC_000081 encoding Tg. Linkage was found with a recessive model of inheritance, wherein three variant homozygotes departed phenotypically from 21 homozygous reference mice and 17 heterozygous mice with a P value of 2.084 x 10-8 (Figure 2).

 

The mutation corresponds to residue 180 in the NM_009375 mRNA sequence in exon 2 of 48 total exons. 

 

164 GAATATGTTCCCCAGTGCTCTGAAGATGGAAGT

48  -E--Y--V--P--Q--C--S--E--D--G--S-

 

The mutated nucleotide is indicated in red. The mutation results in substitution of cysteine 53 to a tyrosine (C53Y) in the thyroglobulin protein.

Illustration of Mutations in
Gene & Protein
Protein Prediction
Figure 3. The protein domains of TG. The TG protein has a signal peptide (amino acids 1-20), 11 type 1, three type 2, three type 3a, and two type 3b Cys-rich repeats followed by an acetylcholinesterase (AChE)-like domain. Tg can be divided into distinct regions: region I containing 10 type 1 repeats along with linker and hinge segments; region II-III contains the type 2 repeats, the type 1 repeat, and the type 3 repeats; and the AchE-like domain. The location of the ito2 mutation is indicated. Other mutations found in TG are noted in red. This image is interactive. Click on the mutations for more specific information.

Tg encodes thyroglobulin (Tg), a precursor of two thyroid hormones: 3,5,3’ triiodothyronine (T3) and 3,5,3’,5’ tetraiodothyronine (thyroxine; T4). Tg has a 20-amino acid signal peptide (amino acids 1-20). The remaining Tg protein is comprised of 11 type 1, three type 2, three type 3a, and two type 3b Cys-rich repeats followed by an acetylcholinesterase (AChE)-like domain (Figure 3(1-3). Tg can be divided into distinct regions: region I contains the ten type I repeats between amino acids 32 and 1211 along with linker and hinge segments; region II-III contains the type 2 repeats, the type I repeat at amino acids 1510-1564, and the type 3 repeats; and the AchE-like domain (amino acids 2181-2717) (4). Within the secretory system, Tg undergoes several posttranslational modifications including glycosylation, sialylation, sulfation, phosphorylation, iodination, and formation of approximately 60 intrachain disulfide binds per monomer. Upon reaching the follicular lumen, several tyrosines are iodinated. Several of the iodinated tyrosines are coupled to form T3 and T4. The release of thyroid hormone occurs after several steps including intra-and extracellular proteolytic degradation of Tg by several proteases.

 

The ito2 mutation results in an cysteine to tyrosine substitution at amino acid 53. Cys53 is with the first type 1 domain, and is predicted to be involved in a disulfide bond with Cys35.

 

For more information about Tg, please see the record for ito.

Putative Mechanism

Within the thyroid gland, epithelial cells synthesize thyroid hormones and are arranged as thyroid follicles. Between the thyroid follicles are parafollicular (alternatively, C cells), which secrete the hormone calcitonin. Tg is secreted by the thyroid cell into the follicular lumen by regulated (nonconstitutive), merocrine secretion. Upon stimulation by thyroid-stimulating hormone (TSH), Tg is reabsorbed by endocytosis/pinocytosis or phagocytosis (rodents only) to form endocytic/pinocytic vesicles or phagosomes, respectively. After release into the blood stream, T3 and T4 control metabolism. Mutations in TG have been linked to congenital goiter with hypothyroidism (euthyroidism) (OMIM: #274700) (5-7) as well as endemic and euthyroid nonendemic simple goiter (8-10). The 8q24 locus, which contains TG, is linked to autoimmune thyroid disease (AITD) including Graves’ disease and Hashimoto’s thyroiditis. Sequence analysis determined that TG is a AITD susceptibility gene in both humans and mice (11) (OMIM: #608175).

 

The cog/cog (Tgcog; MGI:1856829) mouse model has a point mutation in Tg that causes a Leu to Pro substitution at amino acid 2263 (12;13). The cog/cog mouse exhibits congenital hypothyroidism with goiter as well as abnormal growth, mild anemia, and defects in central nervous system development (e.g., microcephalic cerebrum with hypomyelination) (14;15)Tg expression is normal in the cog/cog mice, but the Tg protein exhibits increased proteolysis (16;17). Furthermore, the Tgcog/cog protein exhibited abnormal folding, dimerication, and export as well increased levels of several ER molecular chaperones, all of which are indicative of an ER storage defect (18). As a result, the levels of total serum T4 and T3 are low with a concomitant increase in serum TSH levels (15). A second mouse model has an ENU-induced mutation in Tg (TgR1471X; MGI:5694939). The TgR1471X mice exhibited stunted growth (19). The ito2 phenotype is similar to that of these two mouse models indicating that Tg function is impaired. Expression and localization of Tgito2 has not been examined.

Primers PCR Primer
ito2_pcr_F: AAGTAAAGGTGTCTGTGTCAGG
ito2_pcr_R: TGGGCTTTCTCATGAAAAGCC

Sequencing Primer
ito2_seq_F: CTGTGTCAGGGGTGGGAG
ito2_seq_R: AGAGCCCCTCAATGGAGAGTC
Genotyping

PCR program

1) 94°C 2:00
2) 94°C 0:30
3) 55°C 0:30
4) 72°C 1:00
5) repeat steps (2-4) 40x
6) 72°C 10:00
7) 4°C hold


The following sequence of 485 nucleotides is amplified (chromosome 15, + strand):


1   aagtaaaggt gtctgtgtca ggggtgggag tggggtacgg gtgtaggact gggaggaaag
61  gggcagacct gtacccttct cacatatcac ttcccttcac acagagtacc aggtagatgc
121 acagccactc cgcccctgtg agctacaaag agagaaggcc tttctgaagc aggctgaata
181 tgttccccag tgctctgaag atggaagttt ccagtaagag tggctatatt aggagctcca
241 gggtcctaaa ataccctgga gaacctctca catcttatcc ctgttatccc caattgtatg
301 gataaggtcc tcagactcct ggcctatgtt gtcattttcc ggggggagga gctccttctc
361 tatcctccca tctaggtatt ttgttggaga gactctccat tgaggggctc tcccccaatt
421 cttgctgaaa ctttatcata attgctttac aacatagtgt gtatggcttt tcatgagaaa
481 gccca


Primer binding sites are underlined and the sequencing primers are highlighted; the mutated nucleotide is shown in red.

References
Science Writers Anne Murray
Illustrators Peter Jurek
AuthorsWilliam McAlpine and Bruce Beutler