Phenotypic Mutation 'ito2'

• Allele: ito2
• Mutation Type: missense
• Chromosome: 15
• Coordinate: 66,671,396 bp (GRCm38)
• Base Change: G ⇒ A (forward strand)
• Gene: Tg
• Gene Name: thyroglobulin
• Synonym(s): Tgn
• Chromosomal Location: 66,670,753-66,850,721 bp (+)
• MGI Phenotype: FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Thyroglobulin (Tg) is a glycoprotein homodimer produced predominantly by the thryroid gland. It acts as a substrate for the synthesis of thyroxine and triiodothyronine as well as the storage of the inactive forms of thyroid hormone and iodine. Thyroglobulin is secreted from the endoplasmic reticulum to its site of iodination, and subsequent thyroxine biosynthesis, in the follicular lumen. Mutations in this gene cause thyroid dyshormonogenesis, manifested as goiter, and are associated with moderate to severe congenital hypothyroidism. Polymorphisms in this gene are associated with susceptibility to autoimmune thyroid diseases (AITD) such as Graves disease and Hashimoto thryoiditis. [provided by RefSeq, Nov 2009] ; PHENOTYPE: Mice homozygous for a spontaneous mutation exhibit enlarged thyroid gland, hypothyroidism, abnormal thyroid gland morphology, and decreased body weight. [provided by MGI curators]
• Mapped: Yes
• Amino Acid Change: Cysteine changed to Tyrosine
• Institutional Source: Beutler Lab
• Gene Model: predicted gene model for protein(s): [ENSMUSP00000070239]
• AlphaFold: no structure available at present
• SMART Domains: Protein: ENSMUSP00000070239; Gene: ENSMUSG00000053469; AA Change: C53Y

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC
TY	50	97	5.9e-16	SMART
TY	118	165	5.59e-17	SMART
Pfam:Thyroglobulin_1	174	252	4e-9	PFAM
TY	317	363	4.36e-19	SMART
low complexity region	495	504	N/A	INTRINSIC
TY	617	662	3.58e-15	SMART
TY	684	730	1.47e-16	SMART
TY	880	926	1.51e-4	SMART
TY	1029	1078	1.21e-12	SMART
TY	1106	1150	7.56e-5	SMART
TY	1167	1215	7.26e-16	SMART
low complexity region	1244	1255	N/A	INTRINSIC
Pfam:GCC2_GCC3	1464	1509	2.7e-16	PFAM
TY	1519	1568	9.81e-13	SMART
Pfam:COesterase	2181	2717	8.4e-140	PFAM

• Predicted Effect: probably damaging ; PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
  (Using ENSMUST00000065916)
• Meta Mutation Damage Score: 0.9461
• Is this an essential gene?: Probably nonessential (E-score: 0.110)
• Phenotypic Category: Autosomal Recessive
• Mode of Inheritance: Autosomal Recessive
• Last Updated: 2019-09-04 9:43 PM by Diantha La Vine
• Record Created: 2016-04-05 6:18 PM
• Record Posted: 2016-09-19
• Science Writers: Anne Murray
• Illustrators: Peter Jurek
• Authors: William McAlpine and Bruce Beutler

Accession Number

NCBI RefSeq: NM_027902; MGI:1919003

Alleles Listed at MGI

All Mutations and Alleles(12) : Chemically induced (ENU)(3) Gene trapped(2) Radiation induced(1) Targeted(6)

Phenotypic Description

Figure 1. Ito2 mice exhibited reduced body weights compared to their wild-type littermates. Scaled weight data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The ito2 phenotype was identified among G3 mice of the pedigree R4487, some of which had reduced body weights compared to wild-type controls (Figure 1).

Nature of Mutation

Figure 2. Linkage mapping of the reduced body weight using a recessive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 38 mutations (X-axis) identified in the G1 male of pedigree R4487. Scaled weight data are shown for single locus linkage analysis with consideration of G2 dam identity. Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 38 mutations. The body weight phenotype was linked to a mutation in Tg: a G to A transversion at base pair 66,671,396 (v38) on chromosome 15, or base pair 641 in the GenBank genomic region NC_000081 encoding Tg. Linkage was found with a recessive model of inheritance, wherein three variant homozygotes departed phenotypically from 21 homozygous reference mice and 17 heterozygous mice with a P value of 2.084 x 10^-8 (Figure 2).

 

The mutation corresponds to residue 180 in the NM_009375 mRNA sequence in exon 2 of 48 total exons. 

164 GAATATGTTCCCCAGTGCTCTGAAGATGGAAGT 48  -E--Y--V--P--Q--C--S--E--D--G--S-

 

The mutated nucleotide is indicated in red. The mutation results in substitution of cysteine 53 to a tyrosine (C53Y) in the thyroglobulin protein.

Protein Prediction

Figure 3. The protein domains of TG. The TG protein has a signal peptide (amino acids 1-20), 11 type 1, three type 2, three type 3a, and two type 3b Cys-rich repeats followed by an acetylcholinesterase (AChE)-like domain. Tg can be divided into distinct regions: region I containing 10 type 1 repeats along with linker and hinge segments; region II-III contains the type 2 repeats, the type 1 repeat, and the type 3 repeats; and the AchE-like domain. The location of the ito2 mutation is indicated. Other mutations found in TG are noted in red. This image is interactive. Click on the mutations for more specific information.

Tg encodes thyroglobulin (Tg), a precursor of two thyroid hormones: 3,5,3’ triiodothyronine (T₃) and 3,5,3’,5’ tetraiodothyronine (thyroxine; T₄). Tg has a 20-amino acid signal peptide (amino acids 1-20). The remaining Tg protein is comprised of 11 type 1, three type 2, three type 3a, and two type 3b Cys-rich repeats followed by an acetylcholinesterase (AChE)-like domain (Figure 3) (1-3). Tg can be divided into distinct regions: region I contains the ten type I repeats between amino acids 32 and 1211 along with linker and hinge segments; region II-III contains the type 2 repeats, the type I repeat at amino acids 1510-1564, and the type 3 repeats; and the AchE-like domain (amino acids 2181-2717) (4). Within the secretory system, Tg undergoes several posttranslational modifications including glycosylation, sialylation, sulfation, phosphorylation, iodination, and formation of approximately 60 intrachain disulfide binds per monomer. Upon reaching the follicular lumen, several tyrosines are iodinated. Several of the iodinated tyrosines are coupled to form T₃ and T₄. The release of thyroid hormone occurs after several steps including intra-and extracellular proteolytic degradation of Tg by several proteases.

 

The ito2 mutation results in an cysteine to tyrosine substitution at amino acid 53. Cys53 is with the first type 1 domain, and is predicted to be involved in a disulfide bond with Cys35.

 

For more information about Tg, please see the record for ito.

Putative Mechanism

Within the thyroid gland, epithelial cells synthesize thyroid hormones and are arranged as thyroid follicles. Between the thyroid follicles are parafollicular (alternatively, C cells), which secrete the hormone calcitonin. Tg is secreted by the thyroid cell into the follicular lumen by regulated (nonconstitutive), merocrine secretion. Upon stimulation by thyroid-stimulating hormone (TSH), Tg is reabsorbed by endocytosis/pinocytosis or phagocytosis (rodents only) to form endocytic/pinocytic vesicles or phagosomes, respectively. After release into the blood stream, T3 and T4 control metabolism. Mutations in TG have been linked to congenital goiter with hypothyroidism (euthyroidism) (OMIM: #274700) (5-7) as well as endemic and euthyroid nonendemic simple goiter (8-10). The 8q24 locus, which contains TG, is linked to autoimmune thyroid disease (AITD) including Graves’ disease and Hashimoto’s thyroiditis. Sequence analysis determined that TG is a AITD susceptibility gene in both humans and mice (11) (OMIM: #608175).

 

The cog/cog (Tg^cog; MGI:1856829) mouse model has a point mutation in Tg that causes a Leu to Pro substitution at amino acid 2263 (12;13). The cog/cog mouse exhibits congenital hypothyroidism with goiter as well as abnormal growth, mild anemia, and defects in central nervous system development (e.g., microcephalic cerebrum with hypomyelination) (14;15).  Tg expression is normal in the cog/cog mice, but the Tg protein exhibits increased proteolysis (16;17). Furthermore, the Tg^cog/cog protein exhibited abnormal folding, dimerication, and export as well increased levels of several ER molecular chaperones, all of which are indicative of an ER storage defect (18). As a result, the levels of total serum T₄ and T₃ are low with a concomitant increase in serum TSH levels (15). A second mouse model has an ENU-induced mutation in Tg (Tg^R1471X; MGI:5694939). The Tg^R1471X mice exhibited stunted growth (19). The ito2 phenotype is similar to that of these two mouse models indicating that Tg function is impaired. Expression and localization of Tg^ito2 has not been examined.

Primers

PCR Primer
ito2_pcr_F: AAGTAAAGGTGTCTGTGTCAGG
ito2_pcr_R: TGGGCTTTCTCATGAAAAGCC

Sequencing Primer
ito2_seq_F: CTGTGTCAGGGGTGGGAG
ito2_seq_R: AGAGCCCCTCAATGGAGAGTC

Genotyping

PCR program

1) 94°C 2:00
2) 94°C 0:30
3) 55°C 0:30
4) 72°C 1:00
5) repeat steps (2-4) 40x
6) 72°C 10:00
7) 4°C hold

The following sequence of 485 nucleotides is amplified (chromosome 15, + strand):

1   aagtaaaggt gtctgtgtca ggggtgggag tggggtacgg gtgtaggact gggaggaaag
61  gggcagacct gtacccttct cacatatcac ttcccttcac acagagtacc aggtagatgc
121 acagccactc cgcccctgtg agctacaaag agagaaggcc tttctgaagc aggctgaata
181 tgttccccag tgctctgaag atggaagttt ccagtaagag tggctatatt aggagctcca
241 gggtcctaaa ataccctgga gaacctctca catcttatcc ctgttatccc caattgtatg
301 gataaggtcc tcagactcct ggcctatgtt gtcattttcc ggggggagga gctccttctc
361 tatcctccca tctaggtatt ttgttggaga gactctccat tgaggggctc tcccccaatt
421 cttgctgaaa ctttatcata attgctttac aacatagtgt gtatggcttt tcatgagaaa
481 gccca

Primer binding sites are underlined and the sequencing primers are highlighted; the mutated nucleotide is shown in red.

References

  1. Malthiery, Y., and Lissitzky, S. (1987) Primary Structure of Human Thyroglobulin Deduced from the Sequence of its 8448-Base Complementary DNA. Eur J Biochem. 165, 491-498.

  2. Park, Y. N., and Arvan, P. (2004) The Acetylcholinesterase Homology Region is Essential for Normal Conformational Maturation and Secretion of Thyroglobulin. J Biol Chem. 279, 17085-17089.

  3. Swillens, S., Ludgate, M., Mercken, L., Dumont, J. E., and Vassart, G. (1986) Analysis of Sequence and Structure Homologies between Thyroglobulin and Acetylcholinesterase: Possible Functional and Clinical Significance. Biochem Biophys Res Commun. 137, 142-148.

  4. Lee, J., and Arvan, P. (2011) Repeat Motif-Containing Regions within Thyroglobulin. J Biol Chem. 286, 26327-26333.

  5. Ieiri, T., Cochaux, P., Targovnik, H. M., Suzuki, M., Shimoda, S., Perret, J., and Vassart, G. (1991) A 3' Splice Site Mutation in the Thyroglobulin Gene Responsible for Congenital Goiter with Hypothyroidism. J Clin Invest. 88, 1901-1905.

  6. Medeiros-Neto, G., Targovnik, H. M., and Vassart, G. (1993) Defective Thyroglobulin Synthesis and Secretion Causing Goiter and Hypothyroidism. Endocr Rev. 14, 165-183.

  7. Rivolta, C. M., and Targovnik, H. M. (2006) Molecular Advances in Thyroglobulin Disorders. Clin Chim Acta. 374, 8-24.

  8. Corral, J., Martin, C., Perez, R., Sanchez, I., Mories, M. T., San Millan, J. L., Miralles, J. M., and Gonzalez-Sarmiento, R. (1993) Thyroglobulin Gene Point Mutation Associated with Non-Endemic Simple Goitre. Lancet. 341, 462-464.

  9. Perez-Centeno, C., Gonzalez-Sarmiento, R., Mories, M. T., Corrales, J. J., and Miralles-Garcia, J. M. (1996) Thyroglobulin Exon 10 Gene Point Mutation in a Patient with Endemic Goiter. Thyroid. 6, 423-427.

  10. Gonzalez-Sarmiento, R., Corral, J., Mories, M. T., Corrales, J. J., Miguel-Velado, E., and Miralles-Garcia, J. M. (2001) Monoallelic Deletion in the 5' Region of the Thyroglobulin Gene as a Cause of Sporadic Nonendemic Simple Goiter. Thyroid. 11, 789-793.

  11. Ban, Y., Greenberg, D. A., Concepcion, E., Skrabanek, L., Villanueva, R., and Tomer, Y. (2003) Amino Acid Substitutions in the Thyroglobulin Gene are Associated with Susceptibility to Human and Murine Autoimmune Thyroid Disease. Proc Natl Acad Sci U S A. 100, 15119-15124.

  12. Kim, P. S., Hossain, S. A., Park, Y. N., Lee, I., Yoo, S. E., and Arvan, P. (1998) A Single Amino Acid Change in the Acetylcholinesterase-Like Domain of Thyroglobulin Causes Congenital Goiter with Hypothyroidism in the cog/cog Mouse: A Model of Human Endoplasmic Reticulum Storage Diseases. Proc Natl Acad Sci U S A. 95, 9909-9913.

  13. Taylor, B. A., and Rowe, L. (1987) The Congenital Goiter Mutation is Linked to the Thyroglobulin Gene in the Mouse. Proc Natl Acad Sci U S A. 84, 1986-1990.

  14. Sugisaki, T., Beamer, W. G., and Noguchi, T. (1992) Microcephalic Cerebrum with Hypomyelination in the Congenital Goiter Mouse (Cog). Neurochem Res. 17, 1037-1040.

  15. Beamer, W. G., Maltais, L. J., DeBaets, M. H., and Eicher, E. M. (1987) Inherited Congenital Goiter in Mice. Endocrinology. 120, 838-840.

  16. Adkison, L. R., Taylor, S., and Beamer, W. G. (1990) Mutant Gene-Induced Disorders of Structure, Function and Thyroglobulin Synthesis in Congenital Goitre (cog/cog) in Mice. J Endocrinol. 126, 51-58.

  17. Basche, M., Beamer, W. G., and Schneider, A. B. (1989) Abnormal Properties of Thyroglobulin in Mice with Inherited Congenital Goiter (cog/cog). Endocrinology. 124, 1822-1829.

  18. Kim, P. S., Kwon, O. Y., and Arvan, P. (1996) An Endoplasmic Reticulum Storage Disease Causing Congenital Goiter with Hypothyroidism. J Cell Biol. 133, 517-527.

  19. Andrews, T. D., Whittle, B., Field, M. A., Balakishnan, B., Zhang, Y., Shao, Y., Cho, V., Kirk, M., Singh, M., Xia, Y., Hager, J., Winslade, S., Sjollema, G., Beutler, B., Enders, A., and Goodnow, C. C. (2012) Massively Parallel Sequencing of the Mouse Exome to Accurately Identify Rare, Induced Mutations: An Immediate Source for Thousands of New Mouse Models. Open Biol. 2, 120061.