Phenotypic Mutation 'Modest' (pdf version)
AlleleModest
Mutation Type missense
Chromosome13
Coordinate55,166,251 bp (GRCm38)
Base Change G ⇒ A (forward strand)
Gene Fgfr4
Gene Name fibroblast growth factor receptor 4
Synonym(s) Fgfr-4
Chromosomal Location 55,152,640-55,168,759 bp (+)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the fibroblast growth factor receptor family, where amino acid sequence is highly conserved between members and throughout evolution. FGFR family members differ from one another in their ligand affinities and tissue distribution. A full-length representative protein would consist of an extracellular region, composed of three immunoglobulin-like domains, a single hydrophobic membrane-spanning segment and a cytoplasmic tyrosine kinase domain. The extracellular portion of the protein interacts with fibroblast growth factors, setting in motion a cascade of downstream signals, ultimately influencing mitogenesis and differentiation. The genomic organization of this gene, compared to members 1-3, encompasses 18 exons rather than 19 or 20. Although alternative splicing has been observed, there is no evidence that the C-terminal half of the IgIII domain of this protein varies between three alternate forms, as indicated for members 1-3. This particular family member preferentially binds acidic fibroblast growth factor and, although its specific function is unknown, it is overexpressed in gynecological tumor samples, suggesting a role in breast and ovarian tumorigenesis. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted mutation are viable, healthy and overtly normal, except for a 10% weight reduction at weaning. Mice doubly homozygous for disruptions of Fgfr3 and Fgfr4 show novel phenotypes not seen in either single mutant, including dwarfismand defective respiratory alveogenesis. [provided by MGI curators]
Accession Number

NCBI RefSeq: NM_008011; MGI:95525

Mapped Yes 
Amino Acid Change Valine changed to Methionine
Institutional SourceBeutler Lab
Gene Model predicted gene model for protein(s): [ENSMUSP00000005452]
SMART Domains Protein: ENSMUSP00000005452
Gene: ENSMUSG00000005320
AA Change: V593M

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
IGc2 45 105 1.39e-11 SMART
IGc2 160 228 3.1e-18 SMART
IGc2 259 337 1.59e-6 SMART
low complexity region 369 387 N/A INTRINSIC
low complexity region 416 446 N/A INTRINSIC
TyrKc 464 740 1.67e-148 SMART
low complexity region 764 795 N/A INTRINSIC
Predicted Effect probably damaging

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
(Using ENSMUST00000005452)
Meta Mutation Damage Score 0.9088 question?
Is this an essential gene? Non Essential (E-score: 0.000) question?
Phenotypic Category
Phenotypequestion? Literature verified References
Body Weight - decreased 9716527
Body Weight (DSS) - decreased 9716527
Body Weight (DSS, z-score) - decreased
Body Weight (Z-score) - decreased
FACS B1a cells in B1 cells - decreased
Candidate Explorer Status CE: good candidate; human score: -1; ML prob: 0.498
Single pedigree
Linkage Analysis Data
Penetrance  
Alleles Listed at MGI

All Mutations and Alleles(8) : Chemically induced (other)(1) Targeted(7)

Lab Alleles
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00848:Fgfr4 APN 13 55159170 missense probably damaging 0.99
IGL02140:Fgfr4 APN 13 55161179 missense probably benign
IGL02817:Fgfr4 APN 13 55156668 critical splice donor site probably null
R0153:Fgfr4 UTSW 13 55161385 splice site probably benign
R0727:Fgfr4 UTSW 13 55156228 splice site probably null
R1646:Fgfr4 UTSW 13 55165964 missense probably damaging 1.00
R1749:Fgfr4 UTSW 13 55167792 splice site probably null
R1993:Fgfr4 UTSW 13 55165902 missense probably damaging 1.00
R2037:Fgfr4 UTSW 13 55167889 missense possibly damaging 0.51
R2152:Fgfr4 UTSW 13 55166964 missense probably damaging 1.00
R2386:Fgfr4 UTSW 13 55167901 missense probably benign 0.36
R3086:Fgfr4 UTSW 13 55167392 splice site probably benign
R3939:Fgfr4 UTSW 13 55156494 missense probably null 0.96
R4255:Fgfr4 UTSW 13 55166251 missense probably damaging 1.00
R4463:Fgfr4 UTSW 13 55156467 missense probably benign 0.02
R4510:Fgfr4 UTSW 13 55161515 missense possibly damaging 0.81
R4511:Fgfr4 UTSW 13 55161515 missense possibly damaging 0.81
R4852:Fgfr4 UTSW 13 55161156 missense possibly damaging 0.68
R4932:Fgfr4 UTSW 13 55168170 missense unknown
R5133:Fgfr4 UTSW 13 55160015 missense probably damaging 1.00
R5146:Fgfr4 UTSW 13 55165912 missense probably damaging 1.00
R5380:Fgfr4 UTSW 13 55167417 missense probably damaging 1.00
R5431:Fgfr4 UTSW 13 55156651 missense probably benign
R5927:Fgfr4 UTSW 13 55166887 missense probably damaging 1.00
R6318:Fgfr4 UTSW 13 55166108 missense probably damaging 1.00
R6792:Fgfr4 UTSW 13 55156898 missense possibly damaging 0.65
R7018:Fgfr4 UTSW 13 55166200 missense probably damaging 0.98
R7290:Fgfr4 UTSW 13 55161449 missense probably benign 0.00
R7343:Fgfr4 UTSW 13 55159155 missense probably damaging 1.00
R7808:Fgfr4 UTSW 13 55161156 missense possibly damaging 0.68
R7891:Fgfr4 UTSW 13 55159151 missense probably benign 0.22
R7974:Fgfr4 UTSW 13 55159151 missense probably benign 0.22
Z1177:Fgfr4 UTSW 13 55161707 missense probably damaging 1.00
Z1177:Fgfr4 UTSW 13 55165929 missense probably damaging 1.00
Mode of Inheritance Autosomal Semidominant
Local Stock
Repository
Last Updated 2019-09-04 9:43 PM by Diantha La Vine
Record Created 2016-04-05 9:23 PM
Record Posted 2018-04-11
Phenotypic Description
Figure 1. Modest mice exhibit reduced body weights compared to wild-type littermates. Scaled weight are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 2. Modest mice exhibit decreased frequencies of peripheral B1a cells in B1 cells. Flow cytometric analysis of peripheral blood was utilized to determine B1a cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The Modest phenotype was identified among N-ethyl-N-nitrosourea (ENU)-mutagenized G3 mice of the pedigree R4255, some of which showed reduced body weights compared to wild-type littermates (Figure 1) and reduced frequencies of B1a cells in B1 cells (Figure 2).

Nature of Mutation
Figure 3. Linkage mapping of the reduced body weight phenotype using an additive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 49 mutations (X-axis) identified in the G1 male of pedigree R4255. Weight data are shown for single locus linkage analysis without consideration of G2 dam identity. Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 49 mutations. Both of the above anomalies were linked to a mutation in Fgfr4: a G to A transversion at base pair 55,166,251 (v38) on chromosome 13, or base pair 13,434 in the GenBank genomic region NC_000079 encoding Fgfr4. The strongest association was found with an additive model of inheritance to the body weight phenotype, wherein five variant homozygotes and 15 heterozygous mice departed phenotypically from 14 homozygous reference mice with a P value of 6.228 x 10-6 (Figure 3).  

 

The mutation corresponds to residue 1,939 in the mRNA sequence NM_008011 within exon 13 of 18 total exons.

 

1924 TCCTGTGCCTACCAGGTGGCCCGAGGCATGCAG

588  -S--C--A--Y--Q--V--A--R--G--M--Q-

 

The mutated nucleotide is indicated in red.  The mutation results in a valine (V) to methionine (M) substitution at position 593 (V593M) in the FGFR4 protein, and is strongly predicted by PolyPhen-2 to be damaging (score = 1.000).

Protein Prediction
Figure 4. Domain organization of FGFR4. FGFR4 is a single-pass transmembrane protein with three extracellular immunoglobulin-like domains and a cytoplasmic tyrosine kinase domain. The location of the Modest mutation is indicated. Domain information is from SMART and UniProt.

Fibroblast growth factor receptor-4 (FGFR4; alternatively JTK2 or CD334) is a member of the FGFR family. There are four members of the FGFR family: FGFR1, FGFR2, FGFR3, and FGFR4. The FGFRs are receptor tyrosine kinases. FGFR4 is a single-pass transmembrane protein with three extracellular immunoglobulin-like domains and a cytoplasmic tyrosine kinase domain (Figure 4) (1).

 

FGFR4 undergoes posttranslational modifications. FGFR4 is N-glycosylated on several sites, including Asn109, Asn255, Asn287, Asn308, and Asn319 (locations in mouse FGFR4) (2;3). FGFR4 glycosylation mediates high affinity interactions with ligands. FGFR4 is also ubiquitinated, and is subject to proteasomal degradation when not fully glycosylated. FGFR4 is trans-autophosphorylated at Tyr639, Tyr640, and Tyr751 (locations in mouse FGFR4) in the intracellular domain upon ligand binding.

 

There are additional splice forms of Fgfr4. One isoform lacks exon 16 [designated FGFR4(-16)], which causes a deletion within the kinase domain (2). Two additional splice forms occur after alternative splicing of intron 17 (4). The FGFR4-17a isoform includes 31 3’-nucleotides of intron 17, while the FGFR4-17b isoform includes all of the nucleotides of intron 17. Both the FGFR4-17a and FGFR4-17b proteins have truncated C-terminal tails due to coding of a premature stop codon.

 

The Modest mutation results in a valine (V) to methionine (M) substitution at position 593 (V593M) in the FGFR4 protein; amino acid 593 is within the kinase domain.

Expression/Localization

FGFR4 is expressed in the lung, kidney, brain, liver, pancreas, intestine, striated muscle, adrenal glands, and spleen as well as various types of tumors (5-8).

 

Expression of FGFR4(-16) is similar to that of full-length FGFR4 (2). FGFR4-17a and FGFR4-17b cDNAs are highly expressed in the kidney, muscle, liver, and cochlear material, with lower expression in the heart, brain, and vestibular epithelium (4).

Background
Figure 5. FGFR-associated signaling. The FGF–FGFR complex consists of a receptor homodimer, the FGF ligand, and a heparan sulfate proteoglycan (HSPG). The HSPG stabilizes and sequesters FGFs. After ligand binding and FGFR dimerization, the kinase domains transphosphorylate each other, leading to the docking of adapter proteins and the activation of downstream pathways. Figure and legend adapted from Kelleher et al. (2013).

FGFR-associated signaling controls several cellular events, including cell proliferation, differentiation and survival [Figure 5; reviewed in (9)]. Binding of FGFs (e.g., FGF3 [see the record for porkchop] and FGF5 [see the record for porcupine]) to FGFRs induces receptor dimerization and subsequent trans-autophosphorylation. FGFR4 has highest binding affinity for FGF1 (alternatively, acidic FGF [aFGF]), followed by FGF4 (alternatively, kFGF/HST1) and FGF2 (alternatively, bFGF); FGFR4 can also bind FGF6, FGF8, FGF19, FGF21, and FGF15 (10-16). The phosphorylated tyrosines on the FGFR serve as recruitment and binding sites for docking and signaling molecules, including PLCγ (phospholipase Cγ; see the record for queen) (17), Shc, FGFR substrate 2α (FRS2α) and FRS2β (18;19). The FRS2 proteins activate the growth factor receptor bound 2 (GRB2)/son of sevenless (SOS) 1 complex, which subsequently activates RAS and the downstream MAPK pathway when phosphorylated. GRB2 can also activate GRB2-associated binding protein-1 (GAB1), which recruits PI3K to activate the AKT pathway. The FGFRs can also activate the PLCγ pathway inducing hydrolysis of phosphatidylinositol-4,5-bisphosphate (PIP2) to phosphatidylinositol (3,4,5)-triphosphate (PIP3) and diacylglycerol (DAG). FGFR4 also interacts with IKKβ, a component of the NF-κB pathway, and is proposed to facilitate IKKβ phosphorylation and negative regulation of NF-κB signaling (20).

 

FGFR4 functions in cell migration, lipid metabolism (21), vitamin D metabolism, bile acid biosynthesis (15), glucose uptake (22), and phosphate homeostasis. FGFR4 putatively functions in muscle regeneration, but the precise function of FGFR4 during myogenesis is unknown (23;24). FGF19-induced activation of FGFR4 increases hepatocyte proliferation and can induce hepatocellular carcinoma formation (12;25). FGFR4 is also a ligand-dependent modulator of erythropoiesis (26).

 

Inappropriate activation of FGFR-associated signaling, either by amplification of FGF expression or activating mutations in FGFRs, may cause cell transformation and tumors (27;28).Patients expressing a Gly388Arg mutant FGFR4 exhibited enhanced metastasis and poor prognosis in breast, prostate, lung, pituitary, and colon cancers as well as in head and neck squamous cell carcinoma (29-33). The Gly388Arg substitution resulted in alteration of the transmembrane domain and subsequent exposure of a membrane-proximal cytoplasmic STAT3-binding site (390YPXXQ393), subsequently enhancing STAT3 membrane recruitment and its phosphorylation (30). Mouse embryonic fibroblasts from homozygous knock-in mice expressing a glycine to arginine substitution at amino acid 385 (i.e., mimicking the Gly388Arg human mutation) exhibited faster transformation and formed more foci after infection with an oncogene (34). Mutations in FGFR4 have also been associated with instances of rhabdomyosarcoma (35). Rhabdomyosarcoma-causing FGFR4 mutant proteins with mutations at K535 or E550 caused increased autophosphorylation, STAT3 signaling, tumor proliferation, and metastatic potential (35).

Putative Mechanism

Fgfr4-deficient (Fgfr4-/-) mice are viable and fertile, but exhibited reduced body weights and reduced bone mineral content [(36) and MGI (accessed October 13, 2017)]. A second study found that Fgfr4-/- mice had comparable body weights to wild-type controls as well as comparable body masses to wild-type mice, but the mice showed an increase in white adipose tissue mass (21). The Fgfr4-/- mice exhibited elevated fasting plasma glucose levels, reduced glucose tolerance, hyperlipidemia, and increased insulin resistance (21). On a high-fat diet, the Fgfr4-/- mice exhibited fatty livers (21). A third study found that Fgfr4-/- mice had improved glucose metabolism, insulin sensitivity, and reduced body weights (13). The changes in glucose metabolism, insulin sensitivity, and body weights under high fat conditions observed in the Fgfr4-/- mice were proposed to be due to increased plasma levels of adiponectin as well as the endocrine FGF factors FGF21 and FGF15 (the mouse ortholog of human FGF19) (13). In addition, the Fgfr4-/- mice have depleted gallbladders, elevated excretion of bile acids, eleveated levels of cholesterol- and bile acid-controlled liver cholesterol 7α-hydroxylase (the limiting enzyme for bile synthesis, and an elevated bile acid pool (37). The Fgfr4-/- mice exhibited cholate-dependent, cholesterol-induced hepatomegaly (37).

 

The phenotype of the Modest mice is similar to that observed in the Fgfr4-/- mice, indicating loss of FGFR4Modest function.

Primers PCR Primer
Modest_pcr_F: GAATCAGATGCGCAGTTGGG
Modest_pcr_R: CAGGGTTAGCTGCAAATGTATGG

Sequencing Primer
Modest_seq_F: GGATGCAAAGGACCACTCTTGC
Modest_seq_R: TTAGCTGCAAATGTATGGGAATG
Genotyping

PCR program

1) 94°C 2:00
2) 94°C 0:30
3) 55°C 0:30
4) 72°C 1:00
5) repeat steps (2-4) 40x
6) 72°C 10:00
7) 4°C hold


The following sequence of 407 nucleotides is amplified (chromosome 13, + strand):


1   gaatcagatg cgcagttggg atgcaaagga ccactcttgc cagacttccc atcccctggt
61  ccatggcttc cctctgtagg gcccctgtac gtgattgtgg aatgtgccgc caagggaaac
121 cttcgggaat tcctccgtgc ccggcgcccc ccaggccctg atctcagccc tgatggacct
181 cggagcagcg aaggaccact ctccttcccg gccctagtct cctgtgccta ccaggtggcc
241 cgaggcatgc agtatctgga gtctcggaag gtgtggacaa aggacagttg tgctggggtc
301 tccacacctt cttgctgggg gcactgaatg tcctcagcag cccccttgtt tccagctcac
361 aggtctatcc tttaaccatc attcccatac atttgcagct aaccctg


Primer binding sites are underlined and the sequencing primers are highlighted; the mutated nucleotide is shown in red.

References
Science Writers Anne Murray
Illustrators Diantha La Vine, Katherine Timer
AuthorsEmre Turer, Xue Zhong, and Bruce Beutler