Phenotypic Mutation 'sunrise' (pdf version)
List |< first << previous [record 77 of 132] next >> last >|
Allelesunrise
Mutation Type nonsense
Chromosome7
Coordinate19,811,580 bp (GRCm38)
Base Change G ⇒ T (forward strand)
Gene Bcl3
Gene Name B cell leukemia/lymphoma 3
Synonym(s) Bcl-3
Chromosomal Location 19,808,462-19,822,770 bp (-)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a proto-oncogene candidate. It is identified by its translocation into the immunoglobulin alpha-locus in some cases of B-cell leukemia. The protein encoded by this gene contains seven ankyrin repeats, which are most closely related to those found in I kappa B proteins. This protein functions as a transcriptional co-activator that activates through its association with NF-kappa B homodimers. The expression of this gene can be induced by NF-kappa B, which forms a part of the autoregulatory loop that controls the nuclear residence of p50 NF-kappa B. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice lacking functional copies of this gene exhibit defects of the immune system including disruption of the humoral immune response and abnormal spleen and Peyer's patch organogenesis. Mutant mice show increased susceptibility to pathogens. [provided by MGI curators]
Accession Number

NCBI RefSeq: NM_033601; MGI:88140

Mapped Yes 
Limits of the Critical Region 19808462 - 19822770 bp
Amino Acid Change Cysteine changed to Stop codon
Institutional SourceBeutler Lab
Gene Model predicted gene model for protein(s): [ENSMUSP00000113851] [ENSMUSP00000117754]
SMART Domains Protein: ENSMUSP00000113851
Gene: ENSMUSG00000053175
AA Change: C208*

DomainStartEndE-ValueType
ANK 129 162 4.01e0 SMART
ANK 166 195 4.43e-2 SMART
ANK 199 230 8.99e-3 SMART
ANK 236 265 3.23e-4 SMART
ANK 270 299 5.79e-6 SMART
ANK 303 332 1.4e1 SMART
low complexity region 377 402 N/A INTRINSIC
low complexity region 425 447 N/A INTRINSIC
Predicted Effect probably null
SMART Domains Protein: ENSMUSP00000117754
Gene: ENSMUSG00000053175

DomainStartEndE-ValueType
Pfam:Ank_5 1 52 7.2e-7 PFAM
low complexity region 85 94 N/A INTRINSIC
low complexity region 100 114 N/A INTRINSIC
Predicted Effect probably benign
SMART Domains Protein: ENSMUSP00000116129
Gene: ENSMUSG00000053175

DomainStartEndE-ValueType
ANK 66 99 4.01e0 SMART
ANK 103 132 4.43e-2 SMART
Predicted Effect noncoding transcript
Phenotypic Category
Phenotypequestion? Literature verified References
125-03 Response - increased
FACS B1 cells - increased
FACS B1b cells in B1 cells - decreased
FACS CD44+ CD8 MFI - increased
FACS CD44+ CD8 T cells - increased
FACS central memory CD8 T cells in CD8 T cells - increased
FACS macrophages - increased
ratio of OVA-specific IgE over the total IgE - increased
T-dependent humoral response defect- decreased antibody response to rSFV
Total IgE After 2nd OVA/Alum Challenge (day 7) - decreased
total IgE level - decreased
Penetrance  
Alleles Listed at MGI

All Mutations and Alleles(49) : Gene trapped(38) Targeted(11)

Lab Alleles
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01510:Bcl3 APN 7 19809614 missense probably damaging 1.00
IGL01669:Bcl3 APN 7 19812491 nonsense probably null
IGL03024:Bcl3 APN 7 19809134 splice site probably benign
memorial UTSW 7 19812484 missense
sunrise2 UTSW 7 19809634 nonsense probably null
R0124:Bcl3 UTSW 7 19809651 missense probably damaging 1.00
R0136:Bcl3 UTSW 7 19809569 missense probably damaging 1.00
R0554:Bcl3 UTSW 7 19820066 missense probably benign 0.26
R1845:Bcl3 UTSW 7 19809627 missense probably damaging 0.98
R2571:Bcl3 UTSW 7 19809527 missense probably damaging 1.00
R4355:Bcl3 UTSW 7 19811580 nonsense probably null
R4597:Bcl3 UTSW 7 19812503 missense probably damaging 0.97
R4993:Bcl3 UTSW 7 19820177 missense probably benign 0.00
R5587:Bcl3 UTSW 7 19809634 nonsense probably null
R6232:Bcl3 UTSW 7 19812484 missense probably damaging 1.00
Mode of Inheritance Autosomal Recessive
Local Stock
Repository
Last Updated 2018-03-30 12:45 PM by Diantha La Vine
Record Created 2016-04-08 10:11 PM by Jin Huk Choi
Record Posted 2016-12-16
Phenotypic Description

Figure 1. Sunrise mice exhibit decreased percentages of peripheral IgD+ B cells. Flow cytometric analysis of peripheral blood was utilized to determine B cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 2. Sunrise mice exhibit an increased frequency of peripheral B1 cells. Flow cytometric analysis of peripheral blood was utilized to determine B cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 3. Sunrise mice exhibit an increased frequency of peripheral macrophages. Flow cytometric analysis of peripheral blood was utilized to determine macrophage frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 4. Sunrise mice exhibit increased expression of CD44 on peripheral blood T cells. Flow cytometric analysis of peripheral blood was utilized to determine CD44 MFI. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 5. Sunrise mice exhibit increased expression of CD44 on peripheral blood CD8+ T cells. Flow cytometric analysis of peripheral blood was utilized to determine CD44 MFI. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 6. Sunrise mice exhibit an increased ratio of secreted OVA-specific IgE to total IgE. ELISA was used to determine IgE expression. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 7. Homozygous sunrise mice exhibit diminished T-dependent IgG responses to recombinant Semliki Forest virus (rSFV)-encoded β-galactosidase (rSFV-β-gal). IgG levels were determined by ELISA. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The sunrise phenotype was identified among N-nitroso-N-ethylurea (ENU)-mutagenized G3 mice of the pedigree R4355, some of which showed a reduced frequency of IgD+ B cells (Figure 1) and an increased frequency of B1 cells (Figure 2) and macrophages (Figure 3) in the peripheral blood. Some mice also exhibited increased expression of CD44 on total T cells (Figure 4) and CD8+ T cells (Figure 5). Homozygous mice also exhibited an increase in the ratio of secreted OVA-specific IgE to total IgE (Figure 6) after OVA-alum immunization. The T-dependent antibody response to recombinant Semliki Forest virus (rSFV)-encoded β-galactosidase (rSFV-β-gal) was also diminished in the sunrise mice (Figure 7).

Nature of Mutation

Figure 8. Linkage mapping of the increased ratio of OVA-specific IgE to total IgE using a recessive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 58 mutations (X-axis) identified in the G1 male of pedigree R4355. Normalized phenotype data are shown for single locus linkage analysis without consideration of G2 dam identity.  Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 58 mutations. All of the above anomalies were linked by continuous variable mapping to a mutation in Bcl3:  a C to A transversion at base pair 19,811,580 (v38) on chromosome 7, or base pair 11,188 in the GenBank genomic region NC_000073 encoding Bcl3. The strongest association was found with a recessive model of linkage to the normalized OVA-specific IgE to total IgE ratio, wherein nine variant homozygotes departed phenotypically from 13 homozygous reference mice and 16 heterozygous mice with a P value of 1.216 x 10-10 (Figure 8).  A substantial semidominant effect was observed in most of the assays but the mutation is preponderantly recessive, and in no assay was a purely dominant effect observed. 

 

The mutation corresponds to residue 702 in the mRNA sequence NM_033601 within exon 4 of 9 total exons.

 

685 GCAATTCACCTGGCATGCGAGCACCGCAGCCCC

203 -A--I--H--L--A--C--E--H--R--S--P-

 

The mutated nucleotide is indicated in red. The mutation results in substitution of cysteine 208 for a premature stop codon (C208*) in the Bcl-3 protein.

Protein Prediction

Figure 9. Domain organization of Bcl-3. Bcl-3 has seven ankyrin repeats, a proline-rich N-terminal domain and a serine/proline-rich C-terminal domain. The sunrise mutation results in substitution of cysteine 208 for a premature stop codon (C208*). Other mutations found in Bcl-3 are noted in red. Click on the mutations to view more information.

Bcl-3 (B cell leukemia-3) is a member of the atypical subfamily of the IκB family, which also includes IκBNS, IκBζ, and IκBη. The IκB family has two other subfamilies: the prototypical IκBs (IκBα, IκBβ, and IκBε) and the p50 and p52 precursors, p105 (see the record for Finlay) and p100, respectively. The members of the prototypical IκB family, along with p50 and p52, interact with NF-κB dimers in the cytoplasm, inhibiting their translocation to the nucleus (see the Background section for more details) (1). After stimulation, the prototypical IκBs are degraded, allowing the NF-κB dimers to translocate to the nucleus. The atypical IκB molecules are not degraded following NF-κB pathway activation and are localized primarily in the nucleus where they interact with NF-κB dimers to regulate transcription. IκB family members share a common feature: multiple ankyrin repeats. Bcl-3 has seven ankyrin repeats, a proline-rich N-terminal domain and a serine/proline-rich C-terminal domain (Figure 9) (2). The ankyrin repeats mediate the interaction with the NF-κB subunit, p50 (3;4).

 

Bcl-3 undergoes several posttranslational modifications, including phosphorylation and ubiquitination. Bcl-3 is constitutively phosphorylated (2;5;6); phosphorylation of Bcl-3 is required for its activity. GSK3-mediated Bcl-3 phosphorylation regulates the ability of Bcl-3 to control a subset of NF-κB target genes (e.g., Slpi, Cxcl1, Ifi205 and Cypibi) by altering its association with HDAC1, -3, and -6 (7). GSK3-mediated phosphorylation of Bcl-3 promotes the ubiquitination of two lysines in the N-terminal region of the protein and subsequent degradation of Bcl-3 (7). Hypophosphorylated Bcl-3 has increased interaction with transcriptional corepressors (7) and lessons its ability to enhance DNA:p50 homodimer binding (8). Bcl-3 ubiquitination regulates Bcl-3 intracellular localization. Although Bcl-3 is primarily localized in the nucleus, in some cell types inactive Bcl-3 localizes to the cytoplasm (9;10). The cytoplasmic Bcl-3 requires K63-linked polyubiquitination to translocate to the nucleus. CYLD, a de-ubiquitinase, controls Bcl-3 localization in keratinocytes by removing the polyubiquitin chains (11).

 

The sunrise mutation results in substitution of cysteine 208 for a premature stop codon (C208*); residue 208 is within the third ankyrin repeat domain (amino acids 199-228).

Expression/Localization

Bcl-3 is ubiquitously expressed.

Background

Figure 10. Canonical and non-canonical NF-κB signaling pathways. In the canonical pathway, several membrane receptors, including TNFR (tumor-necrosis factor receptor) signal through kinases and adaptors (TRAFs), resulting in IKK activation. This activation occurs after the K63 ubiquitination of TRAFs and RIP. TAK1 and its adaptor proteins TAB1 and TAB2 bind ubiquitin chains to TRAF and NEMO (IKKγ) resulting in the activation of the IKK complex (NEMO, IKKα and IKKβ). See the sothe page for a description of NF-κB signaling after B cell receptor stimulation (not shown here for simplicity). The IKK complex phosphorylates both IκB, p105 and TPL2 (or MAP3K8), resulting in IκB and p105 ubiquitination and degradation (small pink circles) by 26S proteasome. Degradation of IκB releases activated NF-κB dimers for translocation to the nucleus. A subset of TNFRs such as the lymphotoxin-β receptor (LT-βR),CD40, B-cell-activating factor receptor (BAFFR) and receptor activator of Nf-κB (RANK) can activate the canonical or non-canonical NF-κB signaling pathways. In the non-canonical pathway, the receptors bind to TRAFs to regulate NIK activity. TRAF3 and TRAF2 are recruited to the receptor along with cIAP1/2. TRAF2 undergoes K63 self-ubiquitination and is responsible for the K63 ubiquitination of cIAP1/2. TRAF3 is degraded by K48 ubiquitination, enhanced by the K63 ubiquitination of TRAF2 and cIAP1/2. (Gray arrows represent ubiquitination dependence.) As TRAF levels decrease, NIK is released and phosphorylates IKKα which phosphorylates p100. Phosphorylation and ubiquitination of p100 leads to the 26S proteasomal degradation of p100 and the processing of p52. P52 and RelB are released for translocation to the nucleus. This image is interactive. Click on the image to view mutations in the pathway (red) and the genes affected by these mutations (black). Click on the mutations for more specific information.

The NF-κB family of transcription factors consists of the evolutionary conserved proteins p65/RelA, c-Rel, RelB, p50 and p52 (derived from the p100 precursor; see the record for xander). In the resting cell, NF-κB dimers are kept inactive in the cytoplasm through their association with IκB inhibitory molecules, including p105 and p100.  In the canonical NF-κB signaling pathway, cytokines (e.g., IL-1 and TNFα) or bacterial products (e.g., LPS) facilitate IKK (inhibitory κB kinase; see the record for panr2 for information about IKK-γ [alternatively, NEMO (NF-κB essential modulator)]) activation, which phosphorylate IκBs   at conserved serine residues (Figure 10). This modification induces the K48-linked polyubiquitination of IκB molecules and subsequent recognition by the 26S proteasome as substrates for proteolysis. For example, IKKβ activation results in the phosphorylation and subsequent proteasomal-mediated degradation of IκBα. Degradation of IκBα releases the p50:p65 NF-κB heterodimer to translocate to the nucleus. Degradation of IκBs allows the NF-κB dimers to translocate into the nucleus, where they are able to activate the transcription of target genes, including pro-inflammatory cytokines (e.g., TNFα (see the record for PanR1), IL-1, and IL-6), chemokines [e.g., MIP-1α (macrophage inflammatory protein-1α) and RANTES (regulated upon activation, normal T-cell expressed and secreted)], cell adhesion molecules [e.g., E-selectin and VCAM-1 (vascular cell adhesion molecule-1)], effector molecules [e.g., defensins], enzymes [e.g., inducible nitric oxide synthase], and growth factors to regulate the recruitment of immune cells to the site of infection [(12;13); reviewed in (14;15)]. In a noncanonical NF-κB signaling pathway, CD40 and lymphotoxin activate IKKα through NF-κB inducing kinase (NIK). A third NF-κB signaling pathway involves homodimers of p50. Upon translocation into the nucleus, p50-containing NF-κB dimers can complex with BCL-3 (16). The ankyrin-rich repeat domain of BCL-3 can be used by other IκB proteins to bind and sequester NF-κB in an inactive form (17). Bcl-3 in complex with p50 homodimers stimulates nuclear import of the dimer, facilitating an increased affinity for DNA and the subsequent activation of the transcription of NF-κB responsive genes such as the anti-inflammatory cytokine Il10 (16;18). The p50 subunit, when complexed with Bcl-3, may also function in an oncogenic capacity (19). The p50 homodimers can also associate with histone deacetylase (HDAC)-1 when transcriptionally inactive (20). Upon stimulation, NF-κB dimers containing p65 displace the p50 homodimer that is complexed with HDAC-1, subsequently initiating gene transcription. Association of the p50 homodimer with HDAC-1 functions to inhibit the transcription of several pro-inflammatory genes (i.e., Ccl2Cxcl10Gmcsf, and Mmp13) (21). Association of the p50 homodimer with the transcriptional co-activator CREB binding protein (CREBBP; alternatively, CBP) in LPS- or TLR agonist-stimulated macrophages leads to increased expression of Il10 (22). Inhibition of NF-κB leads to apoptosis [through the misregulation of anti-apoptotic proteins (e.g., c-IAP-1/2, AI, Bcl-2 and Bcl-XL)], delayed cell growth, reduced cell proliferation [through negative regulation of cell cycle regulator cyclin D1 (23)] and incorrect immune cell development [reviewed in (24-26)]. Please see the records xander and Finlay for additional details about NF-κB signaling.

 

Bcl-3 regulates both classical and non-canonical NF-κB signaling by selectively interacting with p50 and p52 homodimers, but not inhibiting DNA binding (5;27-29). Bcl-3-mediated suppression of the classical NF-κB signaling pathway is context- and/or stimulus-dependent. In noncanonical NF-κB signaling, Bcl-3 putatively acts as an adaptor that recruits nuclear coactivator and corepressors complexes to the p50/p52 homodimers (30). Bcl-3 enhances p50 homodimer binding to target DNA in thymocytes (8). In bone marrow-derived macrophages, Bcl-3 stabilizes DNA-bound p50 homodimers by inhibiting p50 ubiquitination and degradation (31). During Toll-like receptor and TNF receptor signaling, Bcl-3-stabilized p50 homodimers can block NF-κB target sites in the DNA, subsequently preventing the binding of active dimers to the DNA and gene transcription (31).

 

During an adaptive immune response, Bcl-3 functions in the formation of secondary lymphoid organs (e.g., Peyer’s patches) (29), the formation of splenic microarchitecture, induction of central T cell tolerance in the thymus (32), and lymphocyte development in the secondary lymphoid organs. Bcl3-/- mice have smaller and less abundant Peyer’s patches (29). In the remaining Bcl3-/- Peyer’s patches, the T cell areas were enlarged and the follicles were small, containing fewer follicular dendritic cells (DCs). DC distribution in the subepithelial dome was abnormal in the Bcl3-/- mice, and the mice had an increased number of M cells (i.e., epithelial cells that transport antigens from the gut lumen to the subepithelial dome).

 

Bcl-3 is required for B cell proliferative responses, germinal center formation, and class-switched antibody production (33). The lymph nodes and Peyer’s patches from the Bcl3-/- mice contain fewer B cells. The spleens in the Bcl3-/- mice have small follicles that contain fewer B cells, follicular DCs, and germinal centers (34-36). Although the Peyer’s patches in the Bcl3-/- mice contain fewer B cells, the Bcl3-/- mice have more marginal zone B cells (CD1dhiCD23lo/−IgM+IgDlo; B220+CD1dhiCD9+ or B220+IgM+CD21hiCD23lo/−) than wild-type mice (37). Eµ-BCL3 mice express a human BCL3 transgene in both their T and B cells (38). The Eµ-BCL3 mice exhibit an expansion of the B cell compartment, and mature follicular B cells accumulate in the spleen, lymph nodes, bone marrow, and peritoneal cavity. The Bcl-3-overexpressing mice do not exhibit lymphoid malignancies. Bcl-3BOE mice carry a B cell-restricted mouse Bcl3 transgene (37;39). The Bcl-3BOE mice exhibit a loss of marginal zone B cells (37;39) and have fewer B1 B cells in their peritoneal cavity.

 

Bcl-3 functions in the differentiation and development of TH cell subsets in the periphery (40) and in the induction of anergy in CD4+ T cells; Bcl-3 also is a survival factor in activated T cells (41-43). Bcl3 deficiency in T cells resulted in impaired TH2 differentiation due to a defect in the expression of the TH2 cell differentiation transcription factor GATA-3 (40). Loss of Bcl3 expression did not affect the differentiation of naïve T cells to TH1 or TH17 cells (40;44;45). However, Bcl-3 suppressed the conversion of IFN-γ-producing TH1 cells into TH17 cells (44). In TH1 cells, the Bcl-3-mediated stabilization of p50 homodimers on NF-κB-binding sites in the Rorc (see the record for chestnut) promoter was proposed to be responsible for restricting RORγt production, thereby stabilizing the TH1 cell phenotype and restricting conversion to TH17 cells. In TFH cell development, Bcl-3 regulates the expression of several genes including Bcl6 (a regulator of TFH cell differentiation) and Il21 (46;47). Bcl-3 inhibits production of IL-2, a T cell growth factor that initiates population expansion and differentiation into effector cells, in anergic CD4+ T cells by putatively enhancing the binding of p50 homodimers to the IL-2 promoter region (48). Bcl-3 also inhibits NF-κB-dependent transcription in T cells in response to specific cytokines (IL-4 and IL-9) (49). The prosurival function of Bcl-3 is putatively due to its ability to block the activation of Bim, a pro-apoptotic Bcl-2 protein family member (42).

 

Bcl-3 promotes DC survival, enhances successful antigen presentation and T cell priming by DCs, and can modify cytokine production by activated DCs (50;51). DC-specific deletion of Bcl3 resulted in mice with aberrant antigen presentation to CD4+ and CD8+ T cells (51). In addition, the expression of pro-apoptotic genes was increased in Bcl3-deficient DCs after stimulation with lipopolysaccharide. Overexpression of Bcl3 in DCs resulted in increased T cell priming and proliferation (51). In mature DCs, Bcl-3 regulates the expression of surface proteins, and alters the balance between costimulatory and inhibitory factors to promote activation signals.

 

BCL3 was initially identified as being involved in recurrent t(14;19)(q32;13.1) translocations in some patients with B cell chronic lymphocytic leukemia; Bcl-3 is within the translocation breakpoint junction (52;53). Bcl-3 overexpression is associated with classical Hodgkin’s and peripheral T-cell lymphoma (54), chronic lymphocytic leukemia (53), and some solid tumors (55;56). Increased Bcl-3 expression has been observed in several autoimmune diseases including rheumatoid arthritis (57). Mutations that reduced Bcl-3 expression have been identified as putative risk factors for Crohn’s disease (58). However, other studies have shown that BCL3 expression is elevated in patients with Crohn’s disease and ulcerative colitis compared to healthy patients (59). In a dextran-sodium sulfate mouse model of colitis, colitis was associated with increased Bcl3 expression and Bcl3 deficiency partially protected against disease development (59). In the intestine, Bcl-3 putatively regulates intestinal epithelial cell turnover during inflammatory conditions.

Putative Mechanism

Bcl3−/− mice are overtly normal and were born at the expected Mendelian frequency (35). The Bcl3−/− mice exhibited a reduced B to T cell ratio in the spleen, blood, and lymph nodes (35). The Bcl3−/− mice had a smaller B220-positive B cell compartment than wild-type littermates, and did not have densely packed B cell follicles in the spleens and lymph nodes. The Bcl3−/− mice lacked germinal centers with the B cell follicular areas before and after challenge with influenza virus and with the parasite T. gondii. However, after exposure to TNP–keyhole limpet hemocyanin (TNP-KLH) antigen absorbed in alum, the Bcl3−/− mice showed some PNA-stained cell clusters indicative of germinal center B cells, albeit at lower numbers then that in wild-type littermates. Although the PNA staining was observed in the Bcl3−/− mice, other markers of germinal center reactions were not observed. After infection with the T-dependent antigen, influenza, the Bcl3−/− mice exhibited a reduced IgG2a antibody response, and other antibody isotypes were not significantly generated. Although the Bcl3−/− mice showed an impaired humoral response to influenza virus, the serum titers for all immunoglobulin isotypes were comparable to that in wild-type littermate controls. The microarchitecture of the B cell follicular zones in the Bcl3−/− mice were less well organized, although the T cell zones of the spleen were normal. In the marginal zone of the spleen, the number of marginal metallophilic macrophages and marginal zone macrophages were reduced in the Bcl3−/− mice compared to that in wild-type littermates. After challenge with T. gondii, the Bcl3−/− mice exhibited reduced survival compared to wild-type littermates; the Bcl3−/− mice failed to mount a T helper type I-like immune response to T. gondii. Expression of cell surface markers CD4, CD8, B220, IgM, Igκ, Igλ, TCRαβ, TCRγδ, IL-2Rα, HAS, CD43, BP1, Mac1, and Gr1 were comparable between Bcl3−/− and wild-type mice indicating that B and T cell subsets in the Bcl3−/− mice were normal (33). After vaccination, the Bcl3−/− mice produced greater than normal amounts of antibodies, but the Bcl3−/− mice could not generate antigen-specific antibodies. Bcl3−/− mice were more susceptible to autoimmune diabetes (45) and Listeria monocytogenes infection (60). Similar to Bcl3−/− mice, the sunrise mice exhibited immune defects indicative of diminished Bcl-3sunrise function.

Primers PCR Primer
sunrise(F):5'- GCAGTGAGCCCTTGAAGAAG -3'
sunrise(R):5'- TGACTCTCTTGAATCGGGAGAG -3'

Sequencing Primer
sunrise_seq(F):5'- GGGGAAGCCACAGTCAGTC -3'
sunrise_seq(R):5'- TCCCTAGATTCAAAAAGCCTGAGGTG -3'
References
Science Writers Anne Murray
Illustrators Peter Jurek, Katherine Timer
AuthorsJin Huk Choi, James Butler, Ming Zeng, Xue Zhong, Bruce Beutler
List |< first << previous [record 77 of 132] next >> last >|