Phenotypic Mutation 'Huang_river'

• Allele: Huang_river
• Mutation Type: missense
• Chromosome: 10
• Coordinate: 21,028,516 bp (GRCm39)
• Base Change: A ⇒ G (forward strand)
• Gene: Myb
• Gene Name: myeloblastosis oncogene
• Synonym(s): c-myb
• Chromosomal Location: 21,000,834-21,036,883 bp (-) (GRCm39)
• MGI Phenotype: FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with three HTH DNA-binding domains that functions as a transcription regulator. This protein plays an essential role in the regulation of hematopoiesis. This gene may be aberrently expressed or rearranged or undergo translocation in leukemias and lymphomas, and is considered to be an oncogene. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2016] ; PHENOTYPE: Mice homozygous for deficient alleles of this gene display severe hematopoietic abnormalities. Red and white blood cells and platelets are all affected. [provided by MGI curators]
• Mapped: Yes
• Limits of the Critical Region: 21124930 - 21160984 bp
• Amino Acid Change: Serine changed to Proline
• Institutional Source: Beutler Lab
• Gene Model: predicted gene model for protein(s): [ENSMUSP00000020158] [ENSMUSP00000139699]
• AlphaFold: P06876
• PDB Structure: CRYSTAL STRUCTURE OF C-MYB R1 [X-RAY DIFFRACTION] ; CRYSTAL STRUCTURE OF C-MYB R2R3 [X-RAY DIFFRACTION] ; CRYSTAL STRUCTURE OF C-MYB R2 [X-RAY DIFFRACTION] ; CRYSTAL STRUCTURE OF C-MYB R2 V103L MUTANT [X-RAY DIFFRACTION] ; CRYSTAL STRUCTURE OF TERNARY PROTEIN-DNA COMPLEX1 [X-RAY DIFFRACTION] ; CRYSTAL STRUCTURE OF TERNARY PROTEIN-DNA COMPLEX2 [X-RAY DIFFRACTION] ; STRUCTURE OF MYB TRANSFORMING PROTEIN, NMR, MINIMIZED AVERAGE STRUCTURE [SOLUTION NMR] ; STRUCTURE OF MYB TRANSFORMING PROTEIN, NMR, 20 STRUCTURES [SOLUTION NMR] ; MOUSE C-MYB DNA-BINDING DOMAIN REPEAT 1 [SOLUTION NMR] ; MOUSE C-MYB DNA-BINDING DOMAIN REPEAT 1 [SOLUTION NMR] ; >> 8 additional structures at PDB <<
• SMART Domains: Protein: ENSMUSP00000020158; Gene: ENSMUSG00000019982; AA Change: S116P

Domain	Start	End	E-Value	Type
low complexity region	7	27	N/A	INTRINSIC
SANT	39	88	9.52e-20	SMART
SANT	91	140	2.04e-19	SMART
SANT	143	191	1.75e-18	SMART
low complexity region	227	239	N/A	INTRINSIC
Pfam:LMSTEN	267	313	4e-29	PFAM
Pfam:Cmyb_C	399	559	1.5e-64	PFAM

• Predicted Effect: probably damaging ; PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
  (Using ENSMUST00000020158)
• SMART Domains: Protein: ENSMUSP00000139699; Gene: ENSMUSG00000019982; AA Change: S116P

Domain	Start	End	E-Value	Type
low complexity region	7	27	N/A	INTRINSIC
SANT	39	88	9.52e-20	SMART
SANT	91	140	2.04e-19	SMART
SANT	143	191	1.75e-18	SMART
low complexity region	227	239	N/A	INTRINSIC
Pfam:LMSTEN	266	313	3.6e-32	PFAM
low complexity region	409	421	N/A	INTRINSIC
Pfam:Cmyb_C	516	682	8.5e-66	PFAM

• Predicted Effect: probably damaging ; PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
  (Using ENSMUST00000188495)
• Meta Mutation Damage Score: 0.9162
• Is this an essential gene?: Essential (E-score: 1.000)
• Phenotypic Category: Autosomal Semidominant
• Mode of Inheritance: Autosomal Semidominant
• Local Stock: gDNA
• Last Updated: 2019-09-04 9:43 PM by Diantha La Vine
• Record Created: 2016-04-11 4:57 PM by Xue Zhong
• Record Posted: 2018-09-07
• Science Writers: Anne Murray
• Illustrators: Diantha La Vine
• Authors: Ming Zeng, Xue Zhong, and Bruce Beutler

Accession Number

NCBI RefSeq: NM_001198914 (variant 1), NM_010848 (variant 2); MGI:97249

Alleles Listed at MGI

All Mutations and Alleles(23) : Chemically induced (ENU)(4) Chemically induced (other)(1) Gene trapped(3) Targeted(13) Transgenic(2)

Phenotypic Description

Figure 1. Huang_river mice exhibit decreased frequencies of peripheral B1a cells. Flow cytometric analysis of peripheral blood was utilized to determine B1a cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 2. Huang_river mice exhibit increased frequencies of peripheral NK cells. Flow cytometric analysis of peripheral blood was utilized to determine NK cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The Huang_river phenotype was identified among N-ethyl-N-nitrosourea (ENU)-mutagenized G3 mice of the pedigree R4355, some of which showed a reduced frequency of B1a cells (Figure 1) with a concomitant increase in the frequency of NK cells (Figure 2) in the peripheral blood.

Nature of Mutation

Figure 3. Linkage mapping of increased frequency of peripheral blood NK cells using an additive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 58 mutations (X-axis) identified in the G1 male of pedigree R4355. Normalized phenotype data are shown for single locus linkage analysis without consideration of G2 dam identity. Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Figure 4. CRISPR- Myb mice exhibit increased frequencies of peripheral NK cells. Flow cytometric analysis of peripheral blood was utilized to determine NK cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Whole exome HiSeq sequencing of the G1 grandsire identified 58 mutations. All of the above phenotypes were linked by continuous variable mapping to a mutation in Myb: a T to C transition at base pair 21,152,617 (v38) on chromosome 10, or base pair 8,368 in the GenBank genomic region NC_000076 encoding Myb. The strongest association was found with an additive model of inheritance to the NK cell frequency phenotype, wherein four variant homozygotes and 24 heterozygous mice departed phenotypically from 12 homozygous reference mice with a P value of 6.033 x 10^-11 (Figure 3).  

The mutation corresponds to residue 612 in the mRNA sequence NM_010848 within exon 5 of 15 total exons.

597 GGTCCGAAGCGTTGGTCTGTTATTGCCAAGCAC 111 -G--P--K--R--W--S--V--I--A--K--H-

The mutated nucleotide is indicated in red.  The mutation results in a serine (S) to proline (P) substitution at position 116 (S116P) in the MYB protein, and is strongly predicted by PolyPhen-2 to be damaging (score = 0.998).

The causative mutation in Myb was confirmed by CRISPR-mediated replacement of the Myb^Huang_river allele (Figure 4 (FACS NK cells; P = 2.469 x 10^-7) and Table 1).

Table 1. CRISPR results

Screen	CRISPR P-value
FACS NK cells	2.469 x 10-7
FACS B1a cells	8.895 x 10-4

Protein Prediction

Figure 5. Domain organization of the c-Myb protein. The Huang_river mutation results in a serine to proline substitution at position 116 of the protein. Abbreviations: HTH, helix-turn-helix; DBD, DNA-binding domain; TAD, transactivation domain; NRD, negative regulatory domain

Myb encodes c-Myb, a member of the Myb transcription factor superfamily. Similar to other members of the Myb family (i.e., A-Myb and B-Myb in vertebrates), c-Myb has an N-terminal DNA-binding domain (DBD; alternatively, SANT [Swi3, Ada2, N-Cor, and TFIIIB]-like domain) with three HTH (helix-turn-helix) repeats and a nuclear localization signal, a central transactivation domain (TAD), and a C-terminal negative regulatory domain (NRD) involved in transcriptional repression (Figure 5). 

The HTH motifs are imperfect repeats of approximately 50 amino acids. The HTH motifs have a conserved tryptophan spaced between 18/19 amino acids that participates in forming a hydrophobic core [PDB:1MBK; (1;2)]. The HTH repeats, namely HTH2 and HTH3, specifically bind to the DNA sequence 5’-pYAACG/TG-3’ (3-5). HTH1 is not required for DNA binding, but does mediate the interaction of c-Myb with its associated proteins (6).

The NRD contains a leucine zipper-like motif, FAETL domain, TPTPF motif, and an EVES motif. The leucine zipper is predicted to mediate dimer formation (7). The FAETL domain is required for the function of v-Myb (an oncogene found in two avian retroviruses that induce leukemia) (8). The FAETL domain is highly conserved, but the function in mouse and/or humans is unknown. The function of the TPTPF domain is also unknown. The EVES motif is highly conserved in vertebrate c-Myb. The EVES motif contains a phosphorylation site that negatively regulates c-Myb function. The EVES motif mediates interaction with the transcriptional coactivator p100 as well as interactions with the c-Myb N-terminus as a method of intramolecular regulation (9).

c-Myb can interact with 50 proteins, many of which function as either coactivators (e.g., FLASH, p100, Menin, Mi-2α, Mybbp1a, and CBP/p300) or corepressors (e.g., N-Cor, mSin-3a, TIF-1β, and C-Ski) [(10); reviewed in (11)]. c-Myb also interacts with cyclin D1 and D2 (12). Interaction between the c-Myb TAD, CBP (CREB-binding protein), and p300 promotes transactivation in hematopoietic cells. A LxxLL motif within the TAD mediates the interaction with p300. For a full list of interacting proteins see BioGRID.

c-Myb undergoes several posttranslational modifications, including serine and threonine phosphorylation (9;13-18), lysine acetylation (19), SUMOylation (18;20;21), and ubiquitination (22). The c-Myb posttranslational modifications putatively alter protein-protein interactions to positively or negatively regulate c-Myb function.

Humans have two major c-Myb isoforms: p89-Myb (89 kD; isoform 1) and p72-Myb (72 kD; isoform 2) (23); p72-Myb is the canonical c-Myb isoform. p89-Myb is the product of alternative splicing, having an extra spliced exon 9B that encodes 121 amino acids. The function of p89-Myb is unknown, but it is not required for hematopoietic development (24). There are at least 29 MYB minor transcript isoforms in human CD34+ progenitor and Jurkat-T cells; the functions of these minor isoforms are unknown (25).

The Huang_river mutation results in a serine (S) to proline (P) substitution at position 116 (S116P) in the c-Myb protein; amino acid 116 is within the second HTH repeat.

Expression/Localization

c-Myb is highly expressed in immature, proliferating epithelial, endothelial and hematopoietic cells and is downregulated as cells become more differentiated. c-Myb localizes to the nucleus.

Background

Figure 6. The effects of c-Myb deficiency on hematopoiesis. (+) Indicates an increase in cell population after loss of c-Myb; (-) indicates a decrease in cell population.

c-Myb is a transcription regulator that functions in hematopoiesis and erythropoiesis (Figure 6) (26).  c-Myb is a stem cell regulator in hematopoietic stem cells (27), neurons (28), colonic crypts (29), and vascular smooth muscle cells (30). c-Myb has over 80 validated target genes [Table 1; reviewed in (31)]. Most c-Myb target genes are positively regulated by c-Myb, but some are repressed by c-Myb.

Table 1. Select c-Myb target genes

	Target gene	Details	References
Cell proliferation	Myc	Oncogene; iPS cell transformation transcription factor	(32;33)
	Kit	Proto-oncogene; see the record for pretty2	(34)
	Ccnb1 (cyclin B1) and Ccne1 (cyclin E1)	Cell cycle factors at the G2/M transition in the cell cycle	(35;36)
Cell differentiation	Myadm (myeloid-associated differentiation marker	Myeloid differentiation	(37)
	Klf4 (Kruppel-like factor 4)	Transcription factor; skin development	(36)
	Pf4 (platelet factor 4)	Chemokine; inhibits hematopoiesis, angiogenesis, and T cell function
	Nanog	Transcription factor required for embryonic stem cell proliferation, renewal, and acquisition of pluripotency
	Elane (neutrophil elastase 2)	Serine protease; see the record for Ruo	(38;39)
	Gata3 (GATA binding protein 3)	Transcription factor that promotes helper T cell development and blocks development of cytotoxic T cells	(40)
	Bcl2	Apoptosis regulator in T cell development	(41;42)
	Car1 (carbonic anhydrase 1)	Enzyme that mediates differentiation of mouse erythroleukemia cells	(43)
	H2afz (H2A histone Z)	Histone component	(44)
	Ptcra (pre-T cell antigen receptor alpha)	TCR subunit	(38;41)
	Rag2 (recombination activating gene 2)	Factor in V(D)J recombination; see the record for snowcock	(41;45;46)
	Cd4	TCR co-receptor; see the record for thoth	(47)
	Tcrd (TCR delta chain)	TCR subunit	(48;49)
	Tcrg (TCR gamma chain)	TCR subunit	(50)

c-Myb is an oncogene. Aberrant c-Myb expression, MYB gene rearrangements, or MYB translocations have been detected in some leukemias and lymphomas [(51;52); reviewed in (11)]. High expression levels of MYB have also been found in pancreatic, colon, and breast tumors [(53;54); reviewed in (55)].

Myb-deficient (Myb^-/-) mice exhibited embryonic lethality between days E14 and E15 due to failure to develop mature blood cells (56-58). Myb^-/- mice exhibit reduced body sizes, anemia, and reduced thymocyte numbers as well as abnormal erythropoiesis, B cell differentiation, and T cell differentiation (57-59). Heterozygous Myb (Myb^+/-) mice exhibited reduced B1 B cells in the spleen and peritoneal cavity and pre-B cells in the bone marrow due to arrested B cell differentiation at the pro- to pre-B cell transition (60). Homozygous mice expressing a ENU-induced mutant Myb allele (Myb^boo/boo; E308G) exhibited abnormal erythropoiesis and hematopoiesis (61). The spleen in the Myb^boo/boo mice was enlarged, the number of neutrophils decreased, and they exhibited reduced B cell lymphoiesis (61). Homozygous mice expressing a second ENU-induced mutant Myb allele (Myb^M303V/M303V; M303V) exhibited reduced splenocyte and thymocyte numbers (i.e., B220+ B cells, CD4+ T cells, and CD8+ T cells), block at the pro- to pre-B cell transition, arrested T cell differentiation, anemia, reduced numbers of eosinophils (27).

Putative Mechanism

c-Myb functions in the differentiation of lymphocytes from precursor stem cells. Loss of c-Myb expression blocks early T cell development (62). In T cell development, c-Myb promotes the development of helper T cells and blocks cytotoxic T cell development (40). c-Myb is also essential for B cell development (63). Loss of c-Myb expression results in a block in the transition from the pro-B cell stage to the pre-B cell stage putatively due to defects in IL-7 signaling. The phenotype of the Huang_river mice indicates loss of c-Myb-related function.

Primers

PCR Primer
Huang_river_pcr_F: TTGTTGCCCAAGTCTTACCG
Huang_river_pcr_R: GGTTTCTCACCCCAAGGAAG

Sequencing Primer
Huang_river_seq_F: AAGTCTTACCGTCCGGGCAG
Huang_river_seq_R: CAGGAAGTAAAGGGCTGGCTCC

Genotyping

PCR program

1) 94°C 2:00
2) 94°C 0:30
3) 55°C 0:30
4) 72°C 1:00
5) repeat steps (2-4) 40x
6) 72°C 10:00
7) 4°C hold

The following sequence of 420 nucleotides is amplified (chromosome 10, - strand):

1   ggtttctcac cccaaggaag caatttaaat cttcaaacag gaagtaaagg gctggctcct
61  gcatgtccag tggatgaaag cagattattt caagatctga agatcttgta acattgaggc
121 ttgatgacgc tgactctttc cgtaacatta aaacacagat tatttttctg ttcatctgaa
181 ggtcatagag cttgtccaga aatatggtcc gaagcgttgg tctgttattg ccaagcactt
241 aaaagggaga attggaaagc agtgtcggga gaggtggcac aaccatttga atccagaagt
301 taagaaaacc tcctggacag aagaggagga cagaatcatt taccaggcac acaagcgtct
361 ggggaacaga tgggcagaga tcgcaaagct gctgcccgga cggtaagact tgggcaacaa 

Primer binding sites are underlined and the sequencing primers are highlighted; the mutated nucleotide is shown in red.

References

  1. Ogata, K., Hojo, H., Aimoto, S., Nakai, T., Nakamura, H., Sarai, A., Ishii, S., and Nishimura, Y. (1992) Solution Structure of a DNA-Binding Unit of Myb: A Helix-Turn-Helix-Related Motif with Conserved Tryptophans Forming a Hydrophobic Core. Proc Natl Acad Sci U S A. 89, 6428-6432.

  2. Ogata, K., Morikawa, S., Nakamura, H., Hojo, H., Yoshimura, S., Zhang, R., Aimoto, S., Ametani, Y., Hirata, Z., and Sarai, A. (1995) Comparison of the Free and DNA-Complexed Forms of the DNA-Binding Domain from c-Myb. Nat Struct Biol. 2, 309-320.

  3. Bergholtz, S., Andersen, T. O., Andersson, K. B., Borrebaek, J., Luscher, B., and Gabrielsen, O. S. (2001) The Highly Conserved DNA-Binding Domains of A-, B- and c-Myb Differ with Respect to DNA-Binding, Phosphorylation and Redox Properties. Nucleic Acids Res. 29, 3546-3556.

  4. Howe, K. M., and Watson, R. J. (1991) Nucleotide Preferences in Sequence-Specific Recognition of DNA by c-Myb Protein. Nucleic Acids Res. 19, 3913-3919.

  5. Klempnauer, K. H., and Sippel, A. E. (1987) The Highly Conserved Amino-Terminal Region of the Protein Encoded by the v-Myb Oncogene Functions as a DNA-Binding Domain. EMBO J. 6, 2719-2725.

  6. Ivanova, O., Braas, D., and Klempnauer, K. H. (2007) Oncogenic Point Mutations in the Myb DNA-Binding Domain Alter the DNA-Binding Properties of Myb at a Physiological Target Gene. Nucleic Acids Res. 35, 7237-7247.

  7. Nomura, T., Sakai, N., Sarai, A., Sudo, T., Kanei-Ishii, C., Ramsay, R. G., Favier, D., Gonda, T. J., and Ishii, S. (1993) Negative Autoregulation of c-Myb Activity by Homodimer Formation through the Leucine Zipper. J Biol Chem. 268, 21914-21923.

  8. Fu, S. L., and Lipsick, J. S. (1996) FAETL Motif Required for Leukemic Transformation by v-Myb. J Virol. 70, 5600-5610.

  9. Dash, A. B., Orrico, F. C., and Ness, S. A. (1996) The EVES Motif Mediates both Intermolecular and Intramolecular Regulation of c-Myb. Genes Dev. 10, 1858-1869.

  10. Chatr-Aryamontri, A., Oughtred, R., Boucher, L., Rust, J., Chang, C., Kolas, N. K., O'Donnell, L., Oster, S., Theesfeld, C., Sellam, A., Stark, C., Breitkreutz, B. J., Dolinski, K., and Tyers, M. (2017) The BioGRID Interaction Database: 2017 Update. Nucleic Acids Res. 45, D369-D379.

  11. Wang, X., Angelis, N., and Thein, S. L. (2018) MYB - A Regulatory Factor in Hematopoiesis. Gene. 665, 6-17.

  12. Ganter, B., Fu, S., and Lipsick, J. S. (1998) D-Type Cyclins Repress Transcriptional Activation by the v-Myb but Not the c-Myb DNA-Binding Domain. EMBO J. 17, 255-268.

  13. Luscher, B., and Eisenman, R. N. (1992) Mitosis-Specific Phosphorylation of the Nuclear Oncoproteins Myc and Myb. J Cell Biol. 118, 775-784.

  14. Aziz, N., Miglarese, M. R., Hendrickson, R. C., Shabanowitz, J., Sturgill, T. W., Hunt, D. F., and Bender, T. P. (1995) Modulation of c-Myb-Induced Transcription Activation by a Phosphorylation Site Near the Negative Regulatory Domain. Proc Natl Acad Sci U S A. 92, 6429-6433.

  15. Bousset, K., Oelgeschlager, M. H., Henriksson, M., Schreek, S., Burkhardt, H., Litchfield, D. W., Luscher-Firzlaff, J. M., and Luscher, B. (1994) Regulation of Transcription Factors c-Myc, Max, and c-Myb by Casein Kinase II. Cell Mol Biol Res. 40, 501-511.

  16. Ramsay, R. G., Morrice, N., Van Eeden, P., Kanagasundaram, V., Nomura, T., De Blaquiere, J., Ishii, S., and Wettenhall, R. (1995) Regulation of c-Myb through Protein Phosphorylation and Leucine Zipper Interactions. Oncogene. 11, 2113-2120.

  17. Winn, L. M., Lei, W., and Ness, S. A. (2003) Pim-1 Phosphorylates the DNA Binding Domain of c-Myb. Cell Cycle. 2, 258-262.

  18. Bies, J., Sramko, M., and Wolff, L. (2013) Stress-Induced Phosphorylation of Thr486 in c-Myb by p38 Mitogen-Activated Protein Kinases Attenuates Conjugation of SUMO-2/3. J Biol Chem. 288, 36983-36993.

  19. Tomita, A., Towatari, M., Tsuzuki, S., Hayakawa, F., Kosugi, H., Tamai, K., Miyazaki, T., Kinoshita, T., and Saito, H. (2000) C-Myb Acetylation at the Carboxyl-Terminal Conserved Domain by Transcriptional Co-Activator p300. Oncogene. 19, 444-451.

  20. Bies, J., Markus, J., and Wolff, L. (2002) Covalent Attachment of the SUMO-1 Protein to the Negative Regulatory Domain of the c-Myb Transcription Factor Modifies its Stability and Transactivation Capacity. J Biol Chem. 277, 8999-9009.

  21. Sramko, M., Markus, J., Kabat, J., Wolff, L., and Bies, J. (2006) Stress-Induced Inactivation of the c-Myb Transcription Factor through Conjugation of SUMO-2/3 Proteins. J Biol Chem. 281, 40065-40075.

  22. Kitagawa, K., Kotake, Y., Hiramatsu, Y., Liu, N., Suzuki, S., Nakamura, S., Kikuchi, A., and Kitagawa, M. (2010) GSK3 Regulates the Expressions of Human and Mouse c-Myb Via Different Mechanisms. Cell Div. 5, 27-1028-5-27.

  23. Dudek, H., and Reddy, E. P. (1989) Identification of Two Translational Products for c-Myb. Oncogene. 4, 1061-1066.

  24. Baker, S. J., Kumar, A., and Reddy, E. P. (2010) P89c-Myb is Not Required for Fetal Or Adult Hematopoiesis. Genesis. 48, 309-316.

  25. Brown, R. B., Madrid, N. J., Suzuki, H., and Ness, S. A. (2017) Optimized Approach for Ion Proton RNA Sequencing Reveals Details of RNA Splicing and Editing Features of the Transcriptome. PLoS One. 12, e0176675.

  26. Ramsay, R. G. (2005) C-Myb a Stem-Progenitor Cell Regulator in Multiple Tissue Compartments. Growth Factors. 23, 253-261.

  27. Sandberg, M. L., Sutton, S. E., Pletcher, M. T., Wiltshire, T., Tarantino, L. M., Hogenesch, J. B., and Cooke, M. P. (2005) C-Myb and p300 Regulate Hematopoietic Stem Cell Proliferation and Differentiation. Dev Cell. 8, 153-166.

  28. Malaterre, J., Mantamadiotis, T., Dworkin, S., Lightowler, S., Yang, Q., Ransome, M. I., Turnley, A. M., Nichols, N. R., Emambokus, N. R., Frampton, J., and Ramsay, R. G. (2008) C-Myb is Required for Neural Progenitor Cell Proliferation and Maintenance of the Neural Stem Cell Niche in Adult Brain. Stem Cells. 26, 173-181.

  29. Malaterre, J., Carpinelli, M., Ernst, M., Alexander, W., Cooke, M., Sutton, S., Dworkin, S., Heath, J. K., Frampton, J., McArthur, G., Clevers, H., Hilton, D., Mantamadiotis, T., and Ramsay, R. G. (2007) C-Myb is Required for Progenitor Cell Homeostasis in Colonic Crypts. Proc Natl Acad Sci U S A. 104, 3829-3834.

  30. Shikatani, E. A., Chandy, M., Besla, R., Li, C. C., Momen, A., El-Mounayri, O., Robbins, C. S., and Husain, M. (2016) C-Myb Regulates Proliferation and Differentiation of Adventitial Sca1+ Vascular Smooth Muscle Cell Progenitors by Transactivation of Myocardin. Arterioscler Thromb Vasc Biol. 36, 1367-1376.

  31. Ramsay, R. G., and Gonda, T. J. (2008) MYB Function in Normal and Cancer Cells. Nat Rev Cancer. 8, 523-534.

  32. Cogswell, J. P., Cogswell, P. C., Kuehl, W. M., Cuddihy, A. M., Bender, T. M., Engelke, U., Marcu, K. B., and Ting, J. P. (1993) Mechanism of c-Myc Regulation by c-Myb in Different Cell Lineages. Mol Cell Biol. 13, 2858-2869.

  33. Nakagoshi, H., Kanei-Ishii, C., Sawazaki, T., Mizuguchi, G., and Ishii, S. (1992) Transcriptional Activation of the c-Myc Gene by the c-Myb and B-Myb Gene Products. Oncogene. 7, 1233-1240.

  34. Ratajczak, M. Z., Perrotti, D., Melotti, P., Powzaniuk, M., Calabretta, B., Onodera, K., Kregenow, D. A., Machalinski, B., and Gewirtz, A. M. (1998) Myb and Ets Proteins are Candidate Regulators of c-Kit Expression in Human Hematopoietic Cells. Blood. 91, 1934-1946.

  35. Nakata, Y., Shetzline, S., Sakashita, C., Kalota, A., Rallapalli, R., Rudnick, S. I., Zhang, Y., Emerson, S. G., and Gewirtz, A. M. (2007) C-Myb Contributes to G2/M Cell Cycle Transition in Human Hematopoietic Cells by Direct Regulation of Cyclin B1 Expression. Mol Cell Biol. 27, 2048-2058.

  36. Quintana, A. M., Liu, F., O'Rourke, J. P., and Ness, S. A. (2011) Identification and Regulation of c-Myb Target Genes in MCF-7 Cells. BMC Cancer. 11, 30-2407-11-30.

  37. Lorenzo, P. I., Brendeford, E. M., Gilfillan, S., Gavrilov, A. A., Leedsak, M., Razin, S. V., Eskeland, R., Saether, T., and Gabrielsen, O. S. (2011) Identification of c-Myb Target Genes in K562 Cells Reveals a Role for c-Myb as a Master Regulator. Genes Cancer. 2, 805-817.

  38. Berge, T., Matre, V., Brendeford, E. M., Saether, T., Luscher, B., and Gabrielsen, O. S. (2007) Revisiting a Selection of Target Genes for the Hematopoietic Transcription Factor c-Myb using Chromatin Immunoprecipitation and c-Myb Knockdown. Blood Cells Mol Dis. 39, 278-286.

  39. Oelgeschlager, M., Nuchprayoon, I., Luscher, B., and Friedman, A. D. (1996) C/EBP, c-Myb, and PU.1 Cooperate to Regulate the Neutrophil Elastase Promoter. Mol Cell Biol. 16, 4717-4725.

  40. Maurice, D., Hooper, J., Lang, G., and Weston, K. (2007) C-Myb Regulates Lineage Choice in Developing Thymocytes Via its Target Gene Gata3. EMBO J. 26, 3629-3640.

  41. Bender, T. P., Kremer, C. S., Kraus, M., Buch, T., and Rajewsky, K. (2004) Critical Functions for c-Myb at Three Checkpoints during Thymocyte Development. Nat Immunol. 5, 721-729.

  42. Lieu, Y. K., Kumar, A., Pajerowski, A. G., Rogers, T. J., and Reddy, E. P. (2004) Requirement of c-Myb in T Cell Development and in Mature T Cell Function. Proc Natl Acad Sci U S A. 101, 14853-14858.

  43. Chen, J., Kremer, C. S., and Bender, T. P. (2006) The Carbonic Anhydrase I Locus Contains a c-Myb Target Promoter and Modulates Differentiation of Murine Erythroleukemia Cells. Oncogene. 25, 2758-2772.

  44. Hooper, J., Maurice, D., Argent-Katwala, M. J., and Weston, K. (2008) Myb Proteins Regulate Expression of Histone Variant H2A.Z during Thymocyte Development. Immunology. 123, 282-289.

  45. Kishi, H., Jin, Z. X., Wei, X. C., Nagata, T., Matsuda, T., Saito, S., and Muraguchi, A. (2002) Cooperative Binding of c-Myb and Pax-5 Activates the RAG-2 Promoter in Immature B Cells. Blood. 99, 576-583.

  46. Wang, Q. F., Lauring, J., and Schlissel, M. S. (2000) C-Myb Binds to a Sequence in the Proximal Region of the RAG-2 Promoter and is Essential for Promoter Activity in T-Lineage Cells. Mol Cell Biol. 20, 9203-9211.

  47. Siu, G., Wurster, A. L., Lipsick, J. S., and Hedrick, S. M. (1992) Expression of the CD4 Gene Requires a Myb Transcription Factor. Mol Cell Biol. 12, 1592-1604.

  48. Hernandez-Munain, C., and Krangel, M. S. (1994) Regulation of the T-Cell Receptor Delta Enhancer by Functional Cooperation between c-Myb and Core-Binding Factors. Mol Cell Biol. 14, 473-483.

  49. Hernandez-Munain, C., Lauzurica, P., and Krangel, M. S. (1996) Regulation of T Cell Receptor Delta Gene Rearrangement by c-Myb. J Exp Med. 183, 289-293.

  50. Hsiang, Y. H., Goldman, J. P., and Raulet, D. H. (1995) The Role of c-Myb Or a Related Factor in Regulating the T Cell Receptor Gamma Gene Enhancer. J Immunol. 154, 5195-5204.

  51. Lahortiga, I., De Keersmaecker, K., Van Vlierberghe, P., Graux, C., Cauwelier, B., Lambert, F., Mentens, N., Beverloo, H. B., Pieters, R., Speleman, F., Odero, M. D., Bauters, M., Froyen, G., Marynen, P., Vandenberghe, P., Wlodarska, I., Meijerink, J. P., and Cools, J. (2007) Duplication of the MYB Oncogene in T Cell Acute Lymphoblastic Leukemia. Nat Genet. 39, 593-595.

  52. Barletta, C., Pelicci, P. G., Kenyon, L. C., Smith, S. D., and Dalla-Favera, R. (1987) Relationship between the c-Myb Locus and the 6q-Chromosomal Aberration in Leukemias and Lymphomas. Science. 235, 1064-1067.

  53. Biroccio, A., Benassi, B., D'Agnano, I., D'Angelo, C., Buglioni, S., Mottolese, M., Ricciotti, A., Citro, G., Cosimelli, M., Ramsay, R. G., Calabretta, B., and Zupi, G. (2001) C-Myb and Bcl-x Overexpression Predicts Poor Prognosis in Colorectal Cancer: Clinical and Experimental Findings. Am J Pathol. 158, 1289-1299.

  54. Persson, M., Andren, Y., Mark, J., Horlings, H. M., Persson, F., and Stenman, G. (2009) Recurrent Fusion of MYB and NFIB Transcription Factor Genes in Carcinomas of the Breast and Head and Neck. Proc Natl Acad Sci U S A. 106, 18740-18744.

  55. Ramsay, R. G., and Gonda, T. J. (2008) MYB Function in Normal and Cancer Cells. Nat Rev Cancer. 8, 523-534.

  56. Bender, T. P., Kremer, C. S., Kraus, M., Buch, T., and Rajewsky, K. (2004) Critical Functions for c-Myb at Three Checkpoints during Thymocyte Development. Nat Immunol. 5, 721-729.

  57. Emambokus, N., Vegiopoulos, A., Harman, B., Jenkinson, E., Anderson, G., and Frampton, J. (2003) Progression through Key Stages of Haemopoiesis is Dependent on Distinct Threshold Levels of c-Myb. EMBO J. 22, 4478-4488.

  58. Mucenski, M. L., McLain, K., Kier, A. B., Swerdlow, S. H., Schreiner, C. M., Miller, T. A., Pietryga, D. W., Scott, W. J.,Jr, and Potter, S. S. (1991) A Functional c-Myb Gene is Required for Normal Murine Fetal Hepatic Hematopoiesis. Cell. 65, 677-689.

  59. Takakura, N., Watanabe, T., Suenobu, S., Yamada, Y., Noda, T., Ito, Y., Satake, M., and Suda, T. (2000) A Role for Hematopoietic Stem Cells in Promoting Angiogenesis. Cell. 102, 199-209.

  60. Xiao, C., Calado, D. P., Galler, G., Thai, T. H., Patterson, H. C., Wang, J., Rajewsky, N., Bender, T. P., and Rajewsky, K. (2007) MiR-150 Controls B Cell Differentiation by Targeting the Transcription Factor c-Myb. Cell. 131, 146-159.

  61. Papathanasiou, P., Tunningley, R., Pattabiraman, D. R., Ye, P., Gonda, T. J., Whittle, B., Hamilton, A. E., Cridland, S. O., Lourie, R., and Perkins, A. C. (2010) A Recessive Screen for Genes Regulating Hematopoietic Stem Cells. Blood. 116, 5849-5858.

  62. Allen, R. D.,3rd, Bender, T. P., and Siu, G. (1999) C-Myb is Essential for Early T Cell Development. Genes Dev. 13, 1073-1078.

  63. Thomas, M. D., Kremer, C. S., Ravichandran, K. S., Rajewsky, K., and Bender, T. P. (2005) C-Myb is Critical for B Cell Development and Maintenance of Follicular B Cells. Immunity. 23, 275-286.