Phenotypic Mutation 'piddling' (pdf version)
List |< first << previous [record 53 of 74] next >> last >|
Allelepiddling
Mutation Type critical splice donor site
Chromosome10
Coordinate76,608,106 bp (GRCm38)
Base Change C ⇒ T (forward strand)
Gene Col6a2
Gene Name collagen, type VI, alpha 2
Synonym(s) Col6a-2
Chromosomal Location 76,595,762-76,623,630 bp (-)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of the three alpha chains of type VI collagen, a beaded filament collagen found in most connective tissues. The product of this gene contains several domains similar to von Willebrand Factor type A domains. These domains have been shown to bind extracellular matrix proteins, an interaction that explains the importance of this collagen in organizing matrix components. Mutations in this gene are associated with Bethlem myopathy and Ullrich scleroatonic muscular dystrophy. Three transcript variants have been identified for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for an ENU-induced allele exhibit reduced body weight. [provided by MGI curators]
Accession Number

NCBI RefSeq: NM_146007 (variant 1), NM_001347207 (variant 2); MGI:88460

Mapped Yes 
Amino Acid Change
Institutional SourceBeutler Lab
Gene Model predicted gene model for protein(s): [ENSMUSP00000001181] [ENSMUSP00000101053]
SMART Domains Protein: ENSMUSP00000001181
Gene: ENSMUSG00000020241

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
VWA 59 246 9.55e-29 SMART
Pfam:Collagen 269 329 3.3e-11 PFAM
Pfam:Collagen 317 383 6.2e-10 PFAM
Pfam:Collagen 366 430 2.2e-8 PFAM
Pfam:Collagen 424 483 1.7e-9 PFAM
low complexity region 502 517 N/A INTRINSIC
Pfam:Collagen 546 605 1.1e-9 PFAM
VWA 628 816 7.51e-36 SMART
VWA 846 1029 3.97e-26 SMART
Predicted Effect probably null
SMART Domains Protein: ENSMUSP00000101053
Gene: ENSMUSG00000020241

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
VWA 59 246 9.55e-29 SMART
Pfam:Collagen 269 330 5.2e-12 PFAM
Pfam:Collagen 316 384 6.1e-10 PFAM
Pfam:Collagen 364 431 1.4e-8 PFAM
Pfam:Collagen 424 483 5.3e-10 PFAM
Pfam:Collagen 475 542 3.3e-9 PFAM
Pfam:Collagen 531 605 7.4e-8 PFAM
VWA 628 816 7.51e-36 SMART
Predicted Effect probably null
Phenotypic Category
Phenotypequestion? Literature verified References
Body Weight - decreased
Body Weight (Male) - decreased
growth/size
Penetrance  
Alleles Listed at MGI

All Mutations and Alleles(7) : Chemically induced (other)(1) Targeted(6)

Lab Alleles
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00959:Col6a2 APN 10 76614534 missense probably damaging 0.96
IGL01995:Col6a2 APN 10 76604842 splice site probably benign
IGL02005:Col6a2 APN 10 76610173 missense probably damaging 1.00
IGL02793:Col6a2 APN 10 76596310 missense possibly damaging 0.96
IGL03144:Col6a2 APN 10 76614425 missense probably benign
R0137:Col6a2 UTSW 10 76596425 missense probably damaging 1.00
R0371:Col6a2 UTSW 10 76614473 missense probably benign 0.25
R0423:Col6a2 UTSW 10 76614917 missense possibly damaging 0.85
R0554:Col6a2 UTSW 10 76611161 critical splice donor site probably null
R0781:Col6a2 UTSW 10 76607740 missense probably benign 0.00
R0831:Col6a2 UTSW 10 76604105 missense probably damaging 1.00
R1110:Col6a2 UTSW 10 76607740 missense probably benign 0.00
R1499:Col6a2 UTSW 10 76603710 missense probably damaging 1.00
R1502:Col6a2 UTSW 10 76614678 missense probably benign 0.00
R1854:Col6a2 UTSW 10 76614812 missense probably damaging 0.98
R1878:Col6a2 UTSW 10 76614788 missense probably benign 0.00
R3410:Col6a2 UTSW 10 76603359 missense probably benign 0.17
R4110:Col6a2 UTSW 10 76606169 splice site probably null
R4242:Col6a2 UTSW 10 76608106 critical splice donor site probably null
R5562:Col6a2 UTSW 10 76599675 nonsense probably null
R5603:Col6a2 UTSW 10 76596769 missense probably damaging 1.00
R5641:Col6a2 UTSW 10 76613278 missense probably damaging 1.00
R5681:Col6a2 UTSW 10 76609251 splice site probably null
R5707:Col6a2 UTSW 10 76611031 missense possibly damaging 0.95
R5735:Col6a2 UTSW 10 76599893 missense probably benign 0.32
R5789:Col6a2 UTSW 10 76604389 missense probably damaging 1.00
R6134:Col6a2 UTSW 10 76607144 missense probably damaging 0.97
R6156:Col6a2 UTSW 10 76604170 missense possibly damaging 0.92
R6208:Col6a2 UTSW 10 76615057 missense possibly damaging 0.88
R6296:Col6a2 UTSW 10 76611049 missense probably damaging 1.00
R6328:Col6a2 UTSW 10 76614378 missense possibly damaging 0.67
R6329:Col6a2 UTSW 10 76599828 missense probably benign 0.01
R6722:Col6a2 UTSW 10 76614558 missense probably damaging 0.98
Mode of Inheritance Autosomal Recessive
Local Stock
Repository
Last Updated 2017-01-06 10:53 AM by Anne Murray
Record Created 2016-04-20 8:13 PM
Record Posted 2017-01-06
Phenotypic Description

Figure 1. Piddling mice exhibit decreased body weights. Scaled weight data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The piddling phenotype was identified among N-nitroso-N-ethylurea (ENU)-mutagenized G3 mice of the pedigree R4242, some of which showed reduced body weights compared to wild-type littermates (Figure 1).

Nature of Mutation

Figure 2. Linkage mapping of the reduced body weights using a recessive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 34 mutations (X-axis) identified in the G1 male of pedigree R4242. Scaled body weight phenotype data are shown for single locus linkage analysis without consideration of G2 dam identity. Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 34 mutations. The body weight phenotype was linked to a mutation in Col6a2: a G to A transition at base pair 76,608,106 (v38) on chromosome 10, or base pair 15,520 in the GenBank genomic region NC_000076 within the donor splice site of intron 16. Linkage was found with a recessive model of inheritance, wherein six variant homozygotes departed phenotypically from 19 homozygous reference mice and 24 heterozygous mice with a P value of 1.18 x 10-7 (Figure 2).  A substantial semidominant effect was also observed (P = 5.528 x 10-6). 

 

The effect of the mutation at the cDNA and protein level has not examined, but the mutation is predicted to result in the use of a cryptic splice site in intron 16. The resulting transcript would have a 57-base pair insertion in intron 16, resulting an in-frame insertion of 19 amino acids after amino acid 480 (in both COL6A2 protein variants). The protein would terminate at the appropriate site.

 

C57BL/6J:

             <--exon 15     <--exon 16 intron 16-->      exon 17-->         <--exon 28

14904 ……CCAAAGGGAGAGAAG ……AAAGGAGCCAAG gtaggctctgcagaa…… GGAGACAGAGGT…… ……TGGATCTGTTAG…… 27413
455   ……-P--K--G--E--K- ……-K--G--A--K-                   -G--D--R--G-…… ……-W--I--C--*-   1034 (NP_666119)

                                               correct

 

             <--exon 15     <--exon 16 intron 16-->      exon 17-->         <--exon 28

14904 ……CCAAAGGGAGAGAAG ……AAAGGAGCCAAG gtaggctctgcagaa…… GGAGACAGAGGT…… ……GCACTCTGCTAA…… 24028
455   ……-P--K--G--E--K- ……-K--G--A--K-                   -G--D--R--G-…… ……-A--L--C--*-   933 (NP_001334136)

                                               correct

 

piddling:

             <--exon 15     <--exon 16       <--intron 16-->      exon 17-->         <--exon 28

14904 ……CCAAAGGGAGAGAAG ……AAAGGAGCCAAG gtaggctctgca……ccaggacaggag…… GGAGACAGAGGT…… ……TGGATCTGTTAG…… 27413 
455   ……-P--K--G--E--K- ……-K--G--A--K- -V--G--S--A-……-P--G--Q--E-…… -G--D--R--G-…… ……-W--I--C--*-   1051 (NP_666119)

                   correct                      aberrant                       correct

 

             <--exon 15     <--exon 16       <--intron 16-->        exon 17-->         <--exon 28

14904 ……CCAAAGGGAGAGAAG ……AAAGGAGCCAAG gtaggctctgca……ccaggacaggag…… GGAGACAGAGGT…… ……GCACTCTGCTAA…… 24028

455   ……-P--K--G--E--K- ……-K--G--A--K- -V--G--S--A-……-P--G--Q--E-…… -G--D--R--G-…… ……-A--L--C--*-   950 (NP_001334136)

                    correct                     aberrant                       correct

 

Genomic numbering corresponds to NC_000076. The donor splice site of intron 16, which is destroyed by the piddling mutation, is indicated in blue lettering and the mutated nucleotide is indicated in red.

Protein Prediction
Figure 3. Domain organization of the COL6A2 protein. COL6A2 is a member of the type VI collagen family and contains a signal peptide, triple helix region, and three von Willebrand factor A-like (VWA) domains. The piddling mutation is within the donor splice site of intron 16.

The Col6a2 gene encodes α2(VI), a 1,034 amino acid member of the type VI collagen family. In vertebrates, the collagen superfamily contains 28 different types of collagen (collagens I to XXVIII) (1;2). The type VI collagen family includes six highly homologous α-chains, α1-α6. Each of the collagen VI proteins has a large globular N-terminus that has multiple von Willebrand factor A-like (VWA) domains; α2(VI) has three VWA domains (Figure 3). The VWA domains putatively mediate the interaction between the collagens and other extracellular matrix proteins. The collagen VI proteins also have a 336 amino acid Gly-Xaa-Yaa repeat triple helix. The collagen VI proteins all have a Cys residue in the triple helical domain that stabilizes the assembly of higher-order structures (3;4). The triple helical domain of α2(VI) acts as a storage site for the preforms of collagenases, including proMMP-1, -3, and -8 (5); MMP-1, -3, and -13 activities are inhibited by α2(VI). At low concentrations, α2(VI) enhances the autolytic activation of proMMP-2 and substrate conversion rate of MMP-2, but reduces MMP-9 activation and activity; however, at high molar excesses, α2(VI) blocks the processing of proMMP-2.

 

Type VI collagen α-chains form α1α2α3 heterotrimers to make up single collagen molecules [(6-8); reviewed in (9). Alternative heterotrimers may also be formed comprised of a combination of α1, α2, and α5 or α6 (α1α2α5 or α1α2α6) (10). The α chains associate at their C-terminal globular domains, and hydrogen bonds link the three α-chains from the C-terminus to the N-terminus, leading to a triple-helical structure. The assembly of large collagen VI aggregates occurs before secretion. The association of the α1α2α3 (or α1α2α5 or α1α2α6) heterotrimers occurs before assembly of disulfide-bonded antiparallel dimers, which subsequently align to form tetramers that are also stabilized by disulfide bonds (3;7). The tetramers are secreted. In the extracellular space, the tetramers associate end-to-end to form beaded microfilaments (3;11-14). For more information about collagen folding and structure, please see the records for seal and aoba.

 

The piddling mutation is predicted to cause a 57-base pair insertion in intron 16, resulting an in-frame insertion of 19 amino acids after amino acid 480. The protein would terminate at the appropriate site. The 19-amino acid insertion would occur in the triple helical domain, possibly disrupting the assembly of higher order collagen VI structures.

Expression/Localization

Collagen VI is expressed in most connective tissues, including muscle, skin, tendon, cartilage, intervertebral discs, lens, internal organs, and blood vessels. Collagens are localized to the extracellular matrix.

Background
Figure 4. Collagen VI interacts with several proteins in the extracellular matrix to perform  essential functions. The basement membrane is comprised to the basal lamina and a layer of reticular connective tissue. In the basement membrane, the collagens, including collagen VI, interact with laminin, nidogen, and the proteoglycan perlecan. Transmembrane laminin receptors (integrins and dystroglycan) in the plasma membrane organize the assembly of the basement membrane. Please see the text for more details.

Collagens form the structural basis of skin, tendon, bone, cartilage, and other tissues. Collagens are the most abundant proteins in the human body, making up approximately 30% of its protein mass (2). There are at least 28 collagen types and 42 α chains in vertebrates, in addition to a variety of proteins containing the collagen triple helix motif (2;15). Fibril-forming collagen orthologues have been identified in invertebrates (16), as well as in bacteria and viruses (17). Collagen VI has several functions, including mechanical functions, inhibition of apoptosis and oxidative damage, promotion of tumor growth and progression, regulation of cell differentiation, regulation of autophagy, maintenance of cell stemness, adhesion, proliferation, migration, cell survival, regulation and differentiation of adipocytes and of normal and malignant mammary ductal cells [reviewed in (18) and references therein]. Collagen VI α1, α2, and α3 chains are found in basement membrane structures in mouse skeletal muscles, and α1α2α3 heterotrimers are proposed to function in basement membrane integrity (19). In the ECM, collagen VI interacts with several proteins to anchor to the basement membrane, including collagen II, collagen IV (see the record for aoba), collagen XIV, fibulin 2, fibronectin, perlecan, microfibril-associated glycoprotein 1, membrane-associated chondroitin sulfate proteoglycan 4, biglycan, heparin, hyaluran, and decorin [reviewed in (9)]. Cell binding to collagen VI might be mediated by the membrane-associated chondroitin proteoglycan NG2 and integrins α1β1 and α2β1; integrins α5β1 and αVβ3 can also bind collagen VI [(20); reviewed in (9)].

 

A Col6a1 knockout (Col6a1-/-) mouse idoes not express collagen VI in muscle (21). The Col6a1-/- mice exhibit a mild neuromuscular disorder without much overt weakness (21). The muscles from the Col6a1-/- mice show increased apoptosis (22) and defective autophagocytic flux including mitochondrial autophagy (23) in muscle cells. Mutations in COL6A1, COL6A2, and COL6A3 are linked to two types of congenital muscular dystrophies: Bethlem myopathy 1 (BM1; OMIM: #158810) and Ullrich congenital muscular dystrophy 1 (UCMD1; OMIM: #254090) (24-30). Mutations in COL6A2 are also linked to congenital myosclerosis (OMIM: #255600), a recessive form of BM1 (31). BM1 and UCMD1 symptoms are usually evident at birth, with patients exhibiting hypotonia and weakness as well as hyperlaxity in the distal joints (32;33). The hands, fingers, and feet are extremely flexible and can bend backwards. Joint contractures have also been observed, affecting the elbows, knees, spine, and neck. In the neonatal period, some UCMD1 patients have transient feeding difficulties, which may lead to severe dysphagia (34). In severe cases of UCMD1, patients never gain the ability to walk, but the infants can usually learn to roll crawl, and sit (35). The muscle weakness phenotype is slowly progressive, but the resulting disability is aggravated by progressive contractures of the large joints (e.g., shoulder, elbows, hips, knees, and ankles). After the loss of ambulation, some patients exhibit respiratory insufficiency (e.g., nocturnal hypoxemia) (34). Patients with BM1 have variable phenotypes; the symptoms are typically milder than that in UCMD1. Infants with BM1 may exhibit hypotonia, foot deformities, and torticollis (i.e., wry neck or loxia) (36). The congenital contractures largely resolve in the first two years. Young children may exhibit mild weakness only, displaying distal joint hyperlaxity instead of contractures. Some patients with collagen VI-related myopathies exhibit skin phenotypes, including keratosis pilaris of the extensor surfaces of the arms and legs, abnormal scar formation, and/or a soft texture to the palmar skin of the hands and feet.

Putative Mechanism

Body weight changes as the result of COL6A2 mutations have not been described. However, a Col6a3 mutant mouse model (Col6a3tm1Chu/Col6a3tm1Chu; MGI:5514357), which exhibits muscle and tendon defects, also had reduced body weight and organ weights (37). The weights of extensor digitorum longus, soleus, and tibialis anterior, gastrocnemius, quadriceps, and diaphragm muscles were reduced compared to that in wild-type mice. The body weight phenotype of the Col6a3tm1Chu/Col6a3tm1Chu mice progressed with age. Organ and muscle weights of the piddling mice were not examined, but the reduced overall body weights observed indicate that some α2(VI)piddling function is lost.

Primers PCR Primer
piddling(F):5'- TAACCTGCCATGGACTTGCC -3'
piddling(R):5'- TACAACAGAGTGGCCTCAGG -3'

Sequencing Primer
piddling_seq(F):5'- CATGGACTTGCCTTGGCTG -3'
piddling_seq(R):5'- CTGAGGGGTTGAATAACTTATCCC -3'
References
Science Writers Anne Murray
Illustrators Katherine Timer
AuthorsEmre Turer and Bruce Beutler
List |< first << previous [record 53 of 74] next >> last >|