Phenotypic Mutation 'potter' (pdf version)
List |< first << previous [record 91 of 132] next >> last >|
Allelepotter
Mutation Type nonsense
Chromosome15
Coordinate78,570,743 bp (GRCm38)
Base Change G ⇒ T (forward strand)
Gene Rac2
Gene Name Rac family small GTPase 2
Chromosomal Location 78,559,167-78,572,783 bp (-)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Ras superfamily of small guanosine triphosphate (GTP)-metabolizing proteins. The encoded protein localizes to the plasma membrane, where it regulates diverse processes, such as secretion, phagocytosis, and cell polarization. Activity of this protein is also involved in the generation of reactive oxygen species. Mutations in this gene are associated with neutrophil immunodeficiency syndrome. There is a pseudogene for this gene on chromosome 6. [provided by RefSeq, Jul 2013]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit peripheral blood lymphocytosis, reductions in peritoneal B-1a lymphocytes, marginal zone lymphocytes, and IgM-secreting plasma cells, decreased levels of serum IgM and IgA, and abnormal T cell migration. [provided by MGI curators]
Accession Number

NCBI RefSeq: NM_009008; MGI:97846

Mapped Yes 
Limits of the Critical Region 78559169 - 78572783 bp
Amino Acid Change Tyrosine changed to Stop codon
Institutional SourceBeutler Lab
Gene Model predicted gene model for protein(s): [ENSMUSP00000036384] [ENSMUSP00000154826]
SMART Domains Protein: ENSMUSP00000036384
Gene: ENSMUSG00000033220
AA Change: Y32*

DomainStartEndE-ValueType
RHO 6 179 3.36e-135 SMART
Predicted Effect probably null
Predicted Effect probably null
Phenotypic Category
Phenotypequestion? Literature verified References
FACS B cells - decreased 11907095
FACS B1b cells in B1 cells - increased
FACS IgD+ B cell percentage - decreased 11907095
FACS IgM+ B cells - decreased 11907095
FACS neutrophils - increased 10072071
T-independent B cell response defect- decreased TNP-specific IgM to TNP-Ficoll immunization
Penetrance  
Alleles Listed at MGI

All Mutations and Alleles(8) : Chemically induced (ENU)(2) Chemically induced (other)(1) Gene trapped(2) Radiation induced(2) Targeted(1)

Lab Alleles
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02931:Rac2 APN 15 78570747 missense possibly damaging 0.79
Big_bend UTSW 15 78565945 missense possibly damaging 0.95
bingo UTSW 15 78564968 missense probably damaging 1.00
Lamb UTSW 15 78564934 missense probably benign 0.01
Potter2 UTSW 15 78565454 missense probably damaging 0.97
R0557:Rac2 UTSW 15 78564974 missense probably damaging 1.00
R0627:Rac2 UTSW 15 78564968 missense probably damaging 1.00
R0751:Rac2 UTSW 15 78565945 missense possibly damaging 0.95
R1184:Rac2 UTSW 15 78565945 missense possibly damaging 0.95
R2349:Rac2 UTSW 15 78565475 missense possibly damaging 0.51
R3816:Rac2 UTSW 15 78565999 missense possibly damaging 0.75
R4436:Rac2 UTSW 15 78570743 nonsense probably null
R5051:Rac2 UTSW 15 78564934 missense possibly damaging 0.68
R5207:Rac2 UTSW 15 78565454 missense probably damaging 0.97
Mode of Inheritance Autosomal Recessive
Local Stock
Repository
Last Updated 2017-08-09 5:25 PM by Diantha La Vine
Record Created 2016-06-23 10:49 PM by Jin Huk Choi
Record Posted 2016-09-15
Phenotypic Description

Figure 1. Potter mice exhibit increased frequencies of peripheral blood neutrophils cells. Flow cytometric analysis of peripheral blood was utilized to determine neutrophil frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 2. Potter mice exhibit reduced frequencies of peripheral blood B cells. Flow cytometric analysis of peripheral blood was utilized to determine B cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 3. Potter mice exhibit reduced frequencies of peripheral blood IgM+ B cells. Flow cytometric analysis of peripheral blood was utilized to determine B cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 4. Potter mice exhibit reduced frequencies of peripheral blood B1a cells in B1 cells. Flow cytometric analysis of peripheral blood was utilized to determine B1a cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 5. Potter mice exhibit increased frequencies of peripheral blood B1b cells in B1 cells. Flow cytometric analysis of peripheral blood was utilized to determine B1b cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 6. Potter mice exhibit diminished T-independent IgM responses to 4-hydroxy-3-nitrophenylacetyl-Ficoll (NP-Ficoll). IgM levels were determined by ELISA. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The potter phenotype was identified among G3 mice of the pedigree R4436, some of which showed an increased frequency of neutrophils (Figure 1), a reduced frequency of B cells (Figure 2), a reduced frequency of IgM+ B cells (Figure 3), a reduced frequency of B1a cells in B1 cells (Figure 4), and an increased frequency of B1b cells in B1 cells (Figure 5), all in the peripheral blood. Some mice also exhibited a diminished T-independent antibody response to 4-hydroxy-3-nitrophenylacetyl-Ficoll (NP-Ficoll) (Figure 6). 

Nature of Mutation

Figure 7. Linkage mapping of the increased frequency of neutrophils in the peripheral blood using a recessive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 53 mutations (X-axis) identified in the G1 male of pedigree R4436. Normalized phenotype data are shown for single locus linkage analysis without consideration of G2 dam identity.  Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 53 mutations. All of the above anomalies were linked by continuous variable mapping to a mutation in Rac2:  a C to A transversion at base pair 78,570,743 (v38) on chromosome 15, or base pair 2,041 in the GenBank genomic region NC_000081 encoding Rac2. The strongest association was found with a recessive model of linkage to the normalized frequency of peripheral blood neutrophils, wherein two variant homozygotes departed phenotypically from 11 homozygous reference mice and 10 heterozygous mice with a P value of 2.941 x 10-7 (Figure 7).  A substantial semidominant effect was observed in most of the assays but the mutation is preponderantly recessive, and in no assay was a purely dominant effect observed. 

 

The mutation corresponds to residue 234 in the mRNA sequence NM_009008 within exon 2 of 7 total exons.


 

217 GCCTTCCCTGGAGAATACATCCCCACTGTATTT

27  -A--F--P--G--E--Y--I--P--T--V--F-

 

The mutated nucleotide is indicated in red.  The mutation results in substitution of tyrosine 32 for a premature stop codon (Y32*) in the RAC2 protein.

Protein Prediction

Figure 5. Protein domains of Rac2. Rac proteins have 5 GTP binding and hydrolysis domains (G-boxes; G1-G5), 2 switch regions, and a C-terminal polybasic region. The amino acid altered in potter is indicated. The image is interactive; click to view additional mutations in Rac2.

Rac2 is a member of the Rac subfamily of Rho guanosine triphosphatases (Rho GTPases). Rho GTPases have several conserved domains including five GTP binding and hydrolysis domains (G-boxes; G1-G5), two switch regions (switch I and II), a polybasic domain, and a prenylation site [Figure 8; (1)]. G-boxes function in GDP binding and exhibit GTPase activity (2). In Rac2, these regions correspond to amino acids 10-17 (G1), Thr35 (G2), 57-61 (G3), and 115-118 (G4), and 157-160 (G5). The Rac proteins each have two highly conserved switch regions, switch I (amino acids 27-40) and switch II (amino acids 56-71), situated on either side of the bound nucleotide. Both switch regions are sites of interactions between the Rac proteins and guanine nucleotide exchange factors (GEFs) and guanine nucleotide-dissociation inhibitors (GDIs) as well as with downstream protein targets (3). The polybasic region of Rac2 (RQQKRP; amino acids 183-188) is required for its function as a regulator of NAPDH oxidase.

 

The mutation in potter results in substitution of tyrosine 32 for a premature stop codon (Y32*). Amino acid 32 is within the G2 domain.

 

For more information about Rac2, please see the record for bingo.

Putative Mechanism

Rho GTPases integrate receptor-mediated signals through binding to effectors and regulators of the actin cytoskeleton and affect multiple cellular activities including cell morphology, polarity, migration, proliferation, apoptosis, phagocytosis, cytokinesis, adhesion, vesicular transport, and transcription. Rac2 functions in actin polymerization resulting in lamellopodial extension and membrane ruffling, directed migration, chemotaxis, and superoxide (O2) production in phagocytic cells as well as cytoskeleton organization in red blood cells and osteoclasts (4-9). The Rac proteins regulate leukocyte migration by transducing signals from cell surface receptors (e.g., the Fcγ receptor, formylmethionyl-leucyl-phenylalanine (fMLP) receptor, and β2 integrins) to the actin and microtubule cytoskeletons through cytoplasmic effectors (e.g., tyrosine kinases, scaffolding/adapter proteins, nucleotide exchange proteins, and phosphatases) upon binding of GTP (10).

 

The potter mice exhibited increased frequency of B1 cells and B1b cells as well as a reduced frequency of B1a cells in B1 cells in the peripheral blood. Rac2 is required for B cell development as well as for either B cell receptor (BCR) signal transduction and subsequent calcium mobilization or in determining the efficiency of BCR ligation (11;12). Rac2-deficient (Rac2-/-) mice exhibit a 30% reduction in B cell numbers due mainly be a reduced number of recirculating B lymphocytes in the bone marrow (11). Rac2-/- mice also display a lack of peritoneal B1 and marginal zone B cells (11). In the peripheral blood, Rac2-/- mice had an increase in total leukocyte number including both B and T cells (11). B cell numbers were reduced in the spleen due to a loss of mature and/or marginal zone B cells (11). In humans, mutations in RAC2 are linked to neutrophil (alternatively, phagocytic) immunodeficiency syndrome [NIS; OMIM: #608203; (13-15)] and decreased numbers of peripheral T and B cells. Patients with NIS have severe, recurrent infections, poor wound healing, and exhibit reduced neutrophil migration, azurophilic granule secretion, and superoxide production (13-15).

 

The alterations in the frequencies of B1, B1b, and B1a cells in B1 cells indicate a loss of Rac2potter function; however, some Rac2 function may remain or Rac1 may be compensating for the loss of Rac2 function and/or expression as other Rac2-/--associated phenotypes were not observed in the potter mice.

Primers PCR Primer
potter(F):5'- GCTGGCTTGAAGGACATATTCC -3'
potter(R):5'- TCTTTATGGGCACTGCACGG -3'

Sequencing Primer
potter_seq(F):5'- AGTCCCTCTGCCTTCTGGAG -3'
potter_seq(R):5'- AGCACACTGGTATGGGGTGTC -3'
References
Science Writers Anne Murray
Illustrators Katherine Timer
AuthorsJin Huk Choi, James Butler, Bruce Beutler
List |< first << previous [record 91 of 132] next >> last >|