Phenotypic Mutation 'Porch' (pdf version)
List |< first << previous [record 61 of 132] next >> last >|
AllelePorch
Mutation Type nonsense
Chromosome14
Coordinate50,950,923 bp (GRCm38)
Base Change C ⇒ T (forward strand)
Gene Pnp
Gene Name purine-nucleoside phosphorylase
Synonym(s) Np, Np-1, Np-2, Pnp, Pnp1
Chromosomal Location 50,931,082-50,965,237 bp (+)
MGI Phenotype PHENOTYPE: Nullizygous mice show impaired thymocyte differentiation, T cell function and mitochondrial DNA repair, altered lymphocyte subpopulations and metabolism, and enhanced thymocyte apoptosis and sensitivity to gamma-irradiation. ENU-induced mutants show a gradual decline in T cell number and function. [provided by MGI curators]
Accession Number

NCBI RefSeq: NM_013632; MGI:97365

Mapped Yes 
Limits of the Critical Region 50944302 - 50953412 bp
Amino Acid Change Arginine changed to Stop codon
Institutional SourceBeutler Lab
Gene Model predicted gene model for protein(s): [ENSMUSP00000043926] [ENSMUSP00000136557] [ENSMUSP00000154805] [ENSMUSP00000154171]
SMART Domains Protein: ENSMUSP00000043926
Gene: ENSMUSG00000115338
AA Change: R185*

DomainStartEndE-ValueType
Pfam:PNP_UDP_1 26 280 5.2e-56 PFAM
Predicted Effect probably null
SMART Domains Protein: ENSMUSP00000136557
Gene: ENSMUSG00000115338
AA Change: R185*

DomainStartEndE-ValueType
Pfam:PNP_UDP_1 26 280 2e-54 PFAM
Predicted Effect probably null
Predicted Effect probably benign
Phenotypic Category
Phenotypequestion? Literature verified References
30 Min. Insulin (Male) - decreased
T-dependent humoral response defect- decreased antibody response to OVA+ alum immunization
Penetrance  
Alleles Listed at MGI

All Mutations and Alleles(20) : Chemically induced (ENU)(6) Chemically induced (other)(1) Gene trapped(11) Targeted(2)

Lab Alleles
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00918:Pnp APN 14 50951002 missense probably benign
IGL01824:Pnp APN 14 50951413 missense probably damaging 1.00
IGL02649:Pnp APN 14 50947846 splice site probably benign
IGL03148:Pnp APN 14 50950728 splice site probably benign
porch2 UTSW 14 50951506 nonsense probably null
R0097:Pnp UTSW 14 50951416 missense probably damaging 1.00
R1510:Pnp UTSW 14 50950585 missense possibly damaging 0.80
R1823:Pnp UTSW 14 50950329 missense probably damaging 1.00
R1864:Pnp UTSW 14 50947973 missense probably benign 0.00
R3429:Pnp UTSW 14 50947986 missense probably benign 0.10
R4639:Pnp UTSW 14 50950923 nonsense probably null
R5078:Pnp UTSW 14 50951506 nonsense probably null
R5982:Pnp UTSW 14 50950543 missense probably damaging 1.00
R6431:Pnp UTSW 14 50951014 missense probably damaging 1.00
Z1088:Pnp UTSW 14 50951495 missense probably benign 0.00
Mode of Inheritance Autosomal Recessive
Local Stock
Repository
Last Updated 2018-07-18 10:11 AM by Anne Murray
Record Created 2016-06-23 11:02 PM by Jin Huk Choi
Record Posted 2018-07-18
Phenotypic Description
Figure 1. Homozygous porch mice exhibit diminished T-dependent IgG responses to OVA + alum. IgG levels were determined by ELISA. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The Porch phenotype was identified among N-ethyl-N-nitrosourea (ENU)-mutagenized G3 mice of the pedigree R4639, some of which showed a diminished T-dependent antibody response to ovalbumin administered with aluminum hydroxide (OVA/alum) (Figure 1).

Nature of Mutation
Figure 2. Linkage mapping of the reduced T-dependent antibody response to OVA + alum using a recessive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 38 mutations (X-axis) identified in the G1 male of pedigree R4639. Normalized phenotype data are shown for single locus linkage analysis without consideration of G2 dam identity. Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 38 mutations. The T-dependent antibody response to OVA/alum phenotype was linked to four mutations on chromosome 14: Eaf1, Pnp, Sacs, and Ppp2r2a. The mutation in Pnp was presumed causative, and a second Pnp allele in the R5078 pedigree confirmed that mutations in Pnp lead to immune phenotypes (see the record for porch2). The mutation in Pnp is a C to T transition at base pair 50,950,923 (v38) on chromosome 14, or base pair 6,621 in the GenBank genomic region NC_000080 encoding Pnp. Linkage was found with a recessive model of inheritance, wherein 1 variant homozygote departed phenotypically from seven homozygous reference mice and 10 heterozygous mice with a P value of 9.276 x 10-5 (Figure 2).  

 

The mutation corresponds to residue 833 in the mRNA sequence NM_013632 within exon 5 of 6 total exons.

 

818 CAAATGGGGGAGCAACGAAAGCTACAAGAAGGC
180 -Q--M--G--E--Q--R--K--L--Q--E--G-
 

The mutated nucleotide is indicated in red. The mutation results in substitution of arginine 185 for a premature stop codon (R185*) in the PNP protein.

Protein Prediction
Figure 3. Domain organization of PNP. PNP has no defined domains. The locations of the structural elements of PNP are shown. The location of the Porch mutation is indicated. Other mutations found in PNP are noted in red. Click on each mutation for more information.
Figure 4. Crystal structure of a human PNP monomer. Figure generated by UCSF Chimera and is based on PDB: 3D1V.

Pnp encodes purine nucleoside phosphorylase (PNP). PNP has no defined domains (Figure 3). The crystal structure of human PNP has been solved [Figure 4; PDB:3D1V; (1)]. PNP is a homotrimer, and each PNP monomer displays an α-/β-fold consisting of a mixed β-sheet surrounded by α-helices. PNP has an eight-stranded mixed β-sheet and a five-stranded mixed β-sheet, which join to form a distorted β-barrel. Seven α-helices surround the β-sheet structure. Tyr88, Phe141, Phe159, Phe200, and Leu209 are involved in subunit interaction. Amino acids 241 to 260 act as a gate that opens during substrate binding and controls access to the active site. Gate opening occurs upon a helical transformation of residues 257 to 265.

 

The Porch mutation results in substitution of arginine 185 for a premature stop codon (R185*) in the PNP protein (Figure 3). Amino acid 185 precedes the seventh strand of the β-sheet.

Expression/Localization

PNP is ubiquitously expressed.

Background
Figure 5. The two biochemical pathways (salvage and de novo) involved in deoxycytidine metabolism converge at the level of dCDP. In the salvage pathway deoxycytidine (dC) is continuously converted to dCMP by dCK. Upstream of dCK, cellular and extracellular dC pools are in equilibrium via the nucleoside transporters (ENTs). Downstream of dCK, the dCMP pool is in equilibrium with the dCDP pool. The de novo pathway contributes to the dCDP pool by RNR-mediated reduction of CDP. ENT, equilibrative nucleoside transporters; NT, 5′ nucleotidase; dCDP, deoxycytidine diphosphate; CDP, cytidine diphosphate; RNR, ribonucleotide reductase. See the text for more details. Figure is modeled after Figure 1 in Ref. 3.

Purine and pyrimidine nucleotides are synthesized through both de novo and deoxyribonucleoside salvage pathways (Figure 5) (2). The de novo pathway facilitates the synthesis of purine and pyrimidine ribonucleotides from carboyhydrate and amino acid derivatives. The de novo pathway produces ribonucleoside diphosphates (NDPs), which are reduced by the enzyme ribonucleotide reductase to deoxyribonucleotide diphosphates (dNDPs) and converted to deoxyribonucleotidetriphosphates (dNTPs) [reviewed in (3)]. In the salvage pathway, nucleosides are transported through the plasma and mitochondrial membranes by nucleoside transporters and phosphorylated by cytosolic (dCK [see the record for rosa] and TK1) or mitochondrial (deoxyguanosine kinase (dGK) and TK2) dNKs, respectively. The dNK family members control the rate-limiting phosphorylation of deoxynucleoside and catalyze the production of deoxynucleotide 5'-monophosphate from a deoxynucleoside, using ATP and yielding ADP in the process. The salvage and de novo pathways converge at the level of dCDP.

 

PNP is an enzyme that functions in purine degradation and salvage. PNP catalyzes the reversible phosphorolysis of inosine, guanosine, deoxyinosine, and deoxyguanosine (dGuo) to their respective bases and ribose-1-phosphate sugar. Control of the levels of PNP substrates (and their phosphorylated products) is essential for cell signaling, energy production, and DNA formation; accumulation of dGuo is toxic to lymphocytes (4;5). PNP inhibitors (e.g., immucillin-H and DADMe–immucillin-H) have been used to treat T-cell cancers and several autoimmune diseases, including rheumatoid arthritis, psoriasis, multiple sclerosis, gout, and tissue transplant rejection (6).

 

Mutations in PNP are linked to immunodeficiency due to purine nucleoside phosphorylase deficiency (OMIM: #613179; (7-9)). Patients with immunodeficiency due to purine nucleoside phosphorylase deficiency exhibit reduced T cell function and some patients exhibit neurologic impairments such as spastic paresis. Patients can exhibit variable B-cell dysfuction. Patients with PNP deficiency have increased risk of autoimmune disorders, including hemolytic anemia, neutropenia, thyroiditis, and thrombocytopenia (10). Patients have normal serum immunoglobulin levels, but T-dependent antibody production is reduced [reviewed in (11)].

 

Mice homozygous for an ENU-induced mutant Pnp allele (Pnpbata/bata) exhibit reduced numbers of marginal zone B cells with concomitant increased numbers of T follicular helper cells (MGI). Proliferation of IL-17-stimulated bone marrow-derived B cells was diminished (MGI). Mice homozygous for other ENU-induced mutant Pnp alleles (Pnpe/e, Pnpf/f, and Pnpg/g) exhibited thymus hypoplasia, reduced numbers of double-positive T cells and CD8+ T cells in the spleen with concomitant increased numbers of double-negative T cells (12). The Pnpe/e, Pnpf/f, and Pnpg/g mice also had impaired spleen leukocyte responses to conA and IL-12 (12). The Pnpe/e and Pnpf/f mice also showed increased amounts of inosine and some guanosine excreted in the urine compared to wild-type controls (13). Pnp-deficient mice exhibited increased thymocyte apoptosis as well as increased double-negative T cell numbers and pre-B cells with concomitant reduced numbers of double-positive T cells, CD4+ T cells, and CD8+ T cells (4). The Pnp-deficient mice had high concentrations of purine nucleosides (inosine, deoxyinosine, guanosine, and deoxyguanosine) in the urine and deficient mitochondrial DNA repair (4).

Putative Mechanism
Figure 6. Mechanism of T cell inhibition by inhibition of PNP. Abbreviations: DR-1-P, deoxyribose-1-phosphate; G, guanosine; dG, 2'-deoxyguanosine; dGMP, 2'-deoxyguanosine monophosphate; dGDP, 2'-deoxyguanosine 5'-diphosphate; dGTP, deoxyguanosine 5'-triphosphate; dNTP, deoxynucleoside triphosphate; PNP, purine nucleoside phosphorylase.

Aberrant PNP activation results in the accumulation of dGTP, an imbalance of the deoxynucleoside triphosphate (dNTP) pools, and induces cell apoptosis (Figure 6). The phenotype of the Porch indicates loss of PNPPorch function.

Primers PCR Primer
Porch(F):5'- TCTACATGCAGAGAGTCTGGC -3'
Porch(R):5'- AACAGTGCTGAGCTCAAGC -3'

Sequencing Primer
Porch_seq(F):5'- AGAGAGTCTGGCCTTGTCCAG -3'
Porch_seq(R):5'- TGAGCTCAAGCCTGTGGTCTC -3'
References
  3. Staub, M., and Eriksson, S. (2006) The Role of Deoxycitidine Kinase in DNA Synthesis and Nucleoside Analog Activation, in Cancer Drug Discovery and Development: Deoxynucleoside Analogs in Cancer Therapy (G. J. Peters, Ed.) pp 29, Humana Press Inc., Totowa, N.J.
Science Writers Anne Murray
Illustrators Diantha La Vine
AuthorsJin Huk Choi, James Butler, and Bruce Beutler
List |< first << previous [record 61 of 132] next >> last >|