Phenotypic Mutation 'pique' (pdf version)
List |< first << previous [record 42 of 132] next >> last >|
Allelepique
Mutation Type nonsense
Chromosome1
Coordinate16,691,716 bp (GRCm38)
Base Change G ⇒ T (forward strand)
Gene Ly96
Gene Name lymphocyte antigen 96
Synonym(s) MD-2, ESOP-1, MD2, myeloid differentiation factor-2
Chromosomal Location 16,688,051-16,709,611 bp (+)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein which associates with toll-like receptor 4 on the cell surface and confers responsiveness to lipopolysaccyaride (LPS), thus providing a link between the receptor and LPS signaling. Studies of the mouse ortholog suggest that this gene may be involved in endotoxin neutralization. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Sep 2010]
PHENOTYPE: Mice homozygous for a knock-out allele display impaired responsiveness to LPS, are resistant to LPS-induced lethal toxicity but show increased susceptibility to Salmonella typhimurium infection. [provided by MGI curators]
Accession Number

NCBI RefSeq: NM_016923 (variant 1) NM_001159711 (variant 2); MGI:1341909

Mapped Yes 
Amino Acid Change Glutamic Acid changed to Stop codon
Institutional SourceBeutler Lab
Gene Model predicted gene model for protein(s): [ENSMUSP00000026881] [ENSMUSP00000140411]
PDB Structure
Crystal structure of mouse TLR4 and mouse MD-2 complex [X-RAY DIFFRACTION]
Crystal structure of mouse TLR4/MD-2/lipid IVa complex [X-RAY DIFFRACTION]
Crystal structure of mouse TLR4/MD-2/LPS complex [X-RAY DIFFRACTION]
SMART Domains Protein: ENSMUSP00000026881
Gene: ENSMUSG00000025779
AA Change: E49*

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
ML 34 153 7.82e-29 SMART
Predicted Effect probably null
SMART Domains Protein: ENSMUSP00000140411
Gene: ENSMUSG00000025779
AA Change: E49*

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
Pfam:E1_DerP2_DerF2 66 137 1.8e-11 PFAM
Predicted Effect probably null
Phenotypic Category
Phenotypequestion? Literature verified References
LPS-induced Necroptosis - decreased
Macrophage necroptosis: low
NALP3 inflammasome signaling defect
Nlrc4 inflammasome: low response
NLRP3 inflammasome: low response
TLR signaling defect: hyposensitivity to LPS
TLR signaling defect: TNF production by macrophages
Penetrance  
Alleles Listed at MGI

All Mutations and Alleles(3) : Targeted(3)

Lab Alleles
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00588:Ly96 APN 1 16706228 splice site probably null
IGL01588:Ly96 APN 1 16709454 missense probably benign 0.11
H8562:Ly96 UTSW 1 16691694 missense probably damaging 1.00
R1186:Ly96 UTSW 1 16700894 missense possibly damaging 0.90
R1751:Ly96 UTSW 1 16706175 missense probably benign 0.00
R1767:Ly96 UTSW 1 16706175 missense probably benign 0.00
R4645:Ly96 UTSW 1 16691716 nonsense probably null
R5189:Ly96 UTSW 1 16700867 missense probably damaging 1.00
R5470:Ly96 UTSW 1 16709486 missense probably benign 0.16
Mode of Inheritance Autosomal Recessive
Local Stock
Repository
Last Updated 2018-09-06 3:15 PM by Anne Murray
Record Created 2016-06-29 2:42 PM by Anne Murray
Record Posted 2018-09-06
Phenotypic Description
Figure 1. Pique mice exhibited diminished rate of LPS-induced macrophagenecroptosis. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 2. Pique mice exhibited decreased TNFα secretion in response to TLR4 ligand, LPS. TNFα levels were determined by ELISA. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 3. Pique mice exhibited decreased IL-1β secretion in response to priming with lipopolysaccharide (LPS) followed by nigericin treatment. IL-1β levels were determined by ELISA. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The pique phenotype was identified among G3 mice of the pedigree R4645, some of which showed a decrease in LPS-induced macrophage necroptosis (Figure 1) and reduced TNFα secretion from macrophages in response to the Toll-like receptor 4 (TLR4) ligand, lipolysaccharide (LPS) (Figure 2). Peritoneal macrophages isolated from pique homozygous mice secreted reduced amounts of the proinflammatory cytokine interleukin (IL)-1β in response to priming with lipopolysaccharide (LPS) followed by nigericin treatment (Figure 3).

Nature of Mutation

Figure 4. Linkage mapping of the reduced rate of LPS-induced necroptosis using a recessive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 52 mutations (X-axis) identified in the G1 male of pedigree R4645. Normalized phenotype data are shown for single locus linkage analysis without consideration of G2 dam identity.  Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 52 mutations. All of the above anomalies were linked by continuous variable mapping to a mutation in Ly96:  a G to T transversion at base pair 16,691,716 (v38) on chromosome 1, or base pair 3,261 in the GenBank genomic region NC_000067 encoding Ly96. The strongest association was found with a recessive model of linkage to the normalized rate of LPS-induced necroptosis, wherein four variant homozygotes departed phenotypically from 14 homozygous reference mice and 20 heterozygous mice with a P value of 2.966 x 10-9 (Figure 4). A substantial semidominant effect was observed in most of the assays but the mutation is preponderantly recessive, and in no assay was a purely dominant effect observed. 

 

The mutation corresponds to residue 197 in the mRNA sequence NM_016923 within exon 2 of 5 total exons.

 

182 ATTTCAATTAGTTCTGAACCCTGCATAAGACTG

44  -I--S--I--S--S--E--P--C--I--R--L-

 

The mutated nucleotide is indicated in red.  The mutation results in substitution of glutamic acid 49 (E49) for a premature stop codon (E49*) in the MD-2 protein.

Protein Prediction
Figure 5. Domain organization of MD-2. MD-2 does not have defined domains, but the first 16 amino acids of MD-2 constitute a cleavable signal sequence. The pique mutation results in substitution of glutamic acid 49 for a premature stop codon.
Figure 6. Crystal structure of the mouse TLR4/MD2 complex. Shown are the extracellular domain of TLR4 (blue) and MD2 (magenta). β-strands are represented by arrows and α-helices by coils. Ligands bind to the pocket formed by the MD2 β-strands (arrow). UCSF Chimera structure is based on PDB 2Z64, Kim et al, Cell 130, 906-917 (2007). Click on the 3D structure to view it rotate. 

Ly96 encodes myeloid differentiation factor 2 (MD-2). MD-2 is a secreted protein that binds both lipopolysaccharide (LPS) and the ectodomain of Toll-like receptor 4 (TLR4; see the record for lps3) (1). MD-2 does not have defined domains, but the first 16 amino acids of MD-2 constitute a cleavable signal sequence that regulates trafficking of MD-2 through the secretory pathway; mature MD-2 is 144 amino acids in length (Figure 5).

 

MD-2 undergoes several posttranslational modifications. It has seven cysteine residues that form disulfide bonds (Cys25<->Cys51, Cys37<->Cys148, and Cys95<->Cys105) (2). One cysteine (Cys133) is proposed to be unpaired and involved in forming interchain disulfide bonds. Most MD-2 orthologs have at least two N-linked glycosylation consensus sequences (NXS/T). Three glycosylation sites are most conserved: Asn26, Asn114, and Asn150. Human and chimp MD-2 do not contain the glycosylation site at Asn150. Full glycosylation of MD-2 is required for an efficient MD-2 function (3;4). MD-2 phosphorylation is required for TLR4/MD-2-associated signaling; the Src tyrosine kinase Lyn (see the record for Lemon) phosphorylates MD-2 after TLR4 activation (5).

 

Several residues throughout the length of MD-2 have specialized functions. Lys128 and Lys132 are required for MD-2 interaction with lipid A. Lys128 and Lys132 stabilize the binding of MD-2 to LPS, but not the binding of MD-2 to TLR4 (6-8). Cys95, Tyr102, and Cys105 are required for MD-2 binding to TLR4. Amino acids 57 to 79 and 108 to 135 determine the species-specific activity of lipid IVa (9). More specifically, Thr57, Val61, and Glu122 of mouse MD-2 are essential in determining the agonist-antagonist activity of lipid IVa. Lysines 122, 125, and 58 in human MD-2 (Glu122, Leu125, and Asn58 in mouse MD-2) confer the functional differences between human and murine MD-2 (10). Residue 58 influences the solubility of MD-2 and the electrostatic charge in the vicinity of the 4’-P of lipid IVa (10). Residue 122 regulates the interaction with the phosphate group of lipid IVa. Mutation of mouse Glu122 to a lysine (E122K) reduced the response to lipid IVa (11). The E122K mutation along with K367E/S386K, and R434Q mutations caused a complete loss of response to lipid IVa in the mouse (11). K122E, K125L, Y41F, and R69G mutations in human MD-2 promoted a response to lipid IVa.

 

An alternatively spliced isoform of human LY96, designated as MD-2s, does not have the region of the MD-2 protein encoded by exon 2 (amino acids 36 to 69) (12;13). MD-2s is a negative regulator of LPS-induced TLR4 signaling by inhibiting the binding of full-length MD-2 to TLR4 (13). MD-2s expression is upregulated by IFN-γ, IL-6, and TLR4 signaling (12). MD-2s exhibited beneficial effects on TLR4-mediated lung injury by reducing the number of inflammatory cells, myeloperoxidase activity, and IL-6 levels. A second alternatively spliced isoform of MD-2, MD-2B, lacks the first 54 bases of exon 3 leading to translation of a 142-amino acid protein with no frameshift plus one amino acid substitution at the junction between exons 2 and 3 (14). MD-2B suppressed LPS-induced NF-κB activity after overexpression with MD-2. MD-2B bound TLR4 with a comparable efficiency to full-length MD-2; however, MD-2B inhibited TLR4 from being expressed on the cell surface. A third alternatively spliced isoform of MD-2, MD-2-T3, lacks two exons of LY96 and subsequently encodes an 88-amino acid protein after an in-frame deletion of amino acids 39 to 110 and a D38G substitution (15). The protein encoded by the MD-2-T3 transcript is similar to canonical MD-2 in that is secreted and glycosylated.

 

The crystal structure of TLR4/MD-2/LPS has been solved (Figure 6; PDB:3VQ2) (16;17). MD-2 folds into two anti-parallel β-sheets that form a large cavity. The cavity is lined with hydrophobic amino acids and is the binding pocket for LPS (PDB:2E59) (2). One of the β-sheets contains three antiparallel β-strands, and the other consists of six antiparallel strands (2). The structure has two molecules of TLR4 and two molecules of MD-2. E. coli lipid A is mostly buried inside the hydrophobic pocket of MD-2 (16). The crystal structure of the TLR4 ectodomain reveals a horseshoe structure, but composed of distinct N-terminal, central and C-terminal domains (18). The β-sheet of the central domain has an unusually small radius and large twist angle (18). The concave N-terminal and central domains of the TLR4 ectodomain provide the binding surface for MD-2. In the human TLR4/MD-2/Ra-LPS, mouse TL4/MD-2/re-LPS, and mouse TLR4/MD-2/Lipid IVa complexes, MD-2 undergoes local structural changes in the Phe126 loop between the βG and βH strands (residues 123 to 129) by binding to LPS and through dimerization of TLR4/MD-2 (16;17). The Phe126 loop and the βE–βF loop (residues 82 to 85) forms the core of the dimerization interface with another TLR4/MD-2 molecule (17).

 

The pique mutation results in substitution of glutamic acid 49 (E49) for a premature stop codon (E49*); residue 49 is an undefined region of MD-2. Expression and localization of MD-2pique have not been assessed.

Expression/Localization

Ly96 is ubiquitously expressed (19). MD-2 binds to TLR4 in the Golgi and is also secreted as a soluble protein.

Background

FIgure 5. Toll-like receptor 4 (TLR4) signaling pathways. Once TLR4 homodimers recognize their ligands, they recruit combinations of adaptor proteins (MyD88, TICAM, TRAM, TIRAP) via homophilic TIR domain interactions. TLR4 signals through the MyD88-dependent pathway from the cell membrane to produce proinflammatory cytokines and is subsequently internalized into late endosomes to signal through the TICAM-dependent pathway to produce IFN. When bound to vesicular stomatitis virus glycoprotein G (VSV-G), TLR4 can signal through TRAM to induce IRF7 activation, a process that is partially dependent on TICAM.

TLR4 is served by the adapters MyD88 in combination with Mal (activating the MyD88-dependent pathway), and Trif in combination with Tram (activating the MyD88-independent pathway) [reviewed in (20;21)] (Figure 7). Stimulation of TLR4 by LPS activates two branches of signaling, one defined by early NF-κB activation (MyD88-dependent pathway, mediated by MyD88), and another distinguished by late NF-κB activation as well as interferon responsive factor (IRF)-3 activation leading to type I IFN production and costimulatory molecule upregulation (MyD88-independent pathway, mediated by Trif) (22;23). Upon activation, the MyD88-dependent pathway proceeds by recruitment of MyD88 to the receptor, where it functions as an adapter to recruit IRAK family proteins, first IRAK-4 and then IRAK-1, as well as TRAF6. The ensuing signaling pathway culminates in the activation of NF-κB-dependent transcription. Briefly, IRAK-1 and TRAF6 dissociate from the receptor complex, and freed TRAF6 interacts with TAK1, activating it to phosphorylate the IκB kinase (IKK) complex. The IKK complex phosphorylates IκB, targeting it for degradation and relieving its inhibition of NF-κB which translocates to the nucleus and activates expression of target genes including interleukin (IL)-6, IL-1, TNF, IL-12p40 and type I interferon, cytokines required for the inflammatory response.

 

The MyD88-independent pathway was evidenced by the intact (but slightly delayed) LPS-dependent activation of NF-κB, JNK and MAP kinases in MyD88-deficient macrophages (23). This pathway relies on the adapter Trif, and its hallmark is the production of type I IFN. Trif signals to TRAF3 and TBK1, both of which are required for IRF-3 activation and subsequent IFN induction downstream of TLR4.

 

While TLR4 is absolutely required for LPS sensing, the membrane-associated molecules CD14 (see heedless) and MD-2 have also been implicated in the TLR4-dependent LPS response (24). In MD-2-deficient fibroblasts, TLR4 is not properly localized at the plasma membrane, and MD-2-null mice do not respond to LPS (24).

Putative Mechanism

Ly96-deficient (Ly96-/-) mice are overtly healthy, but exhibit reduced responses to LPS (24;25). Ly96-/- mice did not produce TNF-α or IL-6 in response to lipid A stimulation or LTA, a membrane constituent of Gram-positive bacteria (24). TNF-α and IL-6 secretion was comparable between Ly96-/- and wild-type mice after stimulation with CpG or peptidoglycan.

 

The phenotype of the pique mice indicate loss of MD-2pique function in responding to LPS.

Primers PCR Primer
pique(F):5'- TCCTGCATGTGACCATAACAG -3'
pique(R):5'- AAGGCCCATGTATCCAACAG -3'

Sequencing Primer
pique_seq(F):5'- CATGTGACCATAACAGAGTGGACC -3'
pique_seq(R):5'- CTTTATAAGGGGCCCTGAATGAC -3'
References
Science Writers Anne Murray
Illustrators Diantha La Vine
AuthorsCristhiaan Ochoa, Ying Wang, Hexin Shi, Lei Sun, Jianhui Wang, Braden Hayse, Ming Zeng, Xue Zhong, and Bruce Beutler
List |< first << previous [record 42 of 132] next >> last >|