Phenotypic Mutation 'trinity'

• Allele: trinity
• Mutation Type: critical splice donor site
• Chromosome: 11
• Coordinate: 54,830,422 bp (GRCm39)
• Base Change: A ⇒ G (forward strand)
• Gene: Tnip1
• Gene Name: TNFAIP3 interacting protein 1
• Synonym(s): ABIN1, VAN, Nef, A20-binding inhibitor of NF-kappa B activation
• Chromosomal Location: 54,801,611-54,853,743 bp (-) (GRCm39)
• MGI Phenotype: FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an A20-binding protein which plays a role in autoimmunity and tissue homeostasis through the regulation of nuclear factor kappa-B activation. Mutations in this gene have been associated with psoriatic arthritis, rheumatoid arthritis, and systemic lupus erythematosus. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2011] ; PHENOTYPE: Mice homozygous for a null allele exhibit perinatal lethality associated with anemia and focal apoptosis in the fetal liver. Mice homozygous for a gene trap allele exhibit partial prenatal lethality and SLE-like inflammatory disease. [provided by MGI curators]
• Mapped: Yes
• Institutional Source: Beutler Lab
• Gene Model: predicted gene model for protein(s): [ENSMUSP00000018482 ^†] [ENSMUSP00000099791 ^†] [ENSMUSP00000099792 ^†] [ENSMUSP00000104513 ^†] [ENSMUSP00000104514 ^†] [ENSMUSP00000104517 ^†] [ENSMUSP00000116721 ^†] [ENSMUSP00000122836 ^†] † probably from a misspliced transcript
• AlphaFold: no structure available at present
• SMART Domains: Protein: ENSMUSP00000018482; Gene: ENSMUSG00000020400

Domain	Start	End	E-Value	Type
coiled coil region	42	71	N/A	INTRINSIC
low complexity region	102	115	N/A	INTRINSIC
coiled coil region	215	266	N/A	INTRINSIC
low complexity region	284	296	N/A	INTRINSIC
SCOP:d1bg1a1	342	511	2e-4	SMART
low complexity region	519	543	N/A	INTRINSIC
low complexity region	560	577	N/A	INTRINSIC
low complexity region	586	599	N/A	INTRINSIC

• Predicted Effect: probably null
• SMART Domains: Protein: ENSMUSP00000099791; Gene: ENSMUSG00000020400

Domain	Start	End	E-Value	Type
coiled coil region	42	71	N/A	INTRINSIC
low complexity region	102	115	N/A	INTRINSIC
coiled coil region	215	266	N/A	INTRINSIC
low complexity region	284	296	N/A	INTRINSIC
SCOP:d1bg1a1	342	511	3e-4	SMART
low complexity region	519	543	N/A	INTRINSIC
low complexity region	560	577	N/A	INTRINSIC
low complexity region	586	599	N/A	INTRINSIC
low complexity region	627	640	N/A	INTRINSIC

• Predicted Effect: probably null
• SMART Domains: Protein: ENSMUSP00000099791; Gene: ENSMUSG00000020400

Domain	Start	End	E-Value	Type
coiled coil region	42	71	N/A	INTRINSIC
low complexity region	102	115	N/A	INTRINSIC
coiled coil region	215	266	N/A	INTRINSIC
low complexity region	284	296	N/A	INTRINSIC
SCOP:d1bg1a1	342	511	3e-4	SMART
low complexity region	519	543	N/A	INTRINSIC
low complexity region	560	577	N/A	INTRINSIC
low complexity region	586	599	N/A	INTRINSIC
low complexity region	627	640	N/A	INTRINSIC

• Predicted Effect: probably null
• SMART Domains: Protein: ENSMUSP00000099792; Gene: ENSMUSG00000020400

Domain	Start	End	E-Value	Type
coiled coil region	42	71	N/A	INTRINSIC
low complexity region	102	115	N/A	INTRINSIC
coiled coil region	215	266	N/A	INTRINSIC
low complexity region	284	296	N/A	INTRINSIC
SCOP:d1bg1a1	342	511	2e-4	SMART
low complexity region	519	543	N/A	INTRINSIC
low complexity region	560	577	N/A	INTRINSIC
low complexity region	586	599	N/A	INTRINSIC

• Predicted Effect: probably null
• SMART Domains: Protein: ENSMUSP00000099792; Gene: ENSMUSG00000020400

Domain	Start	End	E-Value	Type
coiled coil region	42	71	N/A	INTRINSIC
low complexity region	102	115	N/A	INTRINSIC
coiled coil region	215	266	N/A	INTRINSIC
low complexity region	284	296	N/A	INTRINSIC
SCOP:d1bg1a1	342	511	2e-4	SMART
low complexity region	519	543	N/A	INTRINSIC
low complexity region	560	577	N/A	INTRINSIC
low complexity region	586	599	N/A	INTRINSIC

• Predicted Effect: probably null
• SMART Domains: Protein: ENSMUSP00000104513; Gene: ENSMUSG00000020400

Domain	Start	End	E-Value	Type
low complexity region	49	62	N/A	INTRINSIC
coiled coil region	162	213	N/A	INTRINSIC
low complexity region	231	243	N/A	INTRINSIC
SCOP:d1bg1a1	289	458	5e-4	SMART
low complexity region	466	490	N/A	INTRINSIC
low complexity region	507	524	N/A	INTRINSIC
low complexity region	533	546	N/A	INTRINSIC

• Predicted Effect: probably null
• SMART Domains: Protein: ENSMUSP00000104513; Gene: ENSMUSG00000020400

Domain	Start	End	E-Value	Type
low complexity region	49	62	N/A	INTRINSIC
coiled coil region	162	213	N/A	INTRINSIC
low complexity region	231	243	N/A	INTRINSIC
SCOP:d1bg1a1	289	458	5e-4	SMART
low complexity region	466	490	N/A	INTRINSIC
low complexity region	507	524	N/A	INTRINSIC
low complexity region	533	546	N/A	INTRINSIC

• Predicted Effect: probably null
• SMART Domains: Protein: ENSMUSP00000104514; Gene: ENSMUSG00000020400

Domain	Start	End	E-Value	Type
low complexity region	49	62	N/A	INTRINSIC
coiled coil region	162	213	N/A	INTRINSIC
low complexity region	231	243	N/A	INTRINSIC
SCOP:d1bg1a1	289	458	5e-4	SMART
low complexity region	466	490	N/A	INTRINSIC
low complexity region	507	524	N/A	INTRINSIC
low complexity region	533	546	N/A	INTRINSIC

• Predicted Effect: probably null
• SMART Domains: Protein: ENSMUSP00000104514; Gene: ENSMUSG00000020400

Domain	Start	End	E-Value	Type
low complexity region	49	62	N/A	INTRINSIC
coiled coil region	162	213	N/A	INTRINSIC
low complexity region	231	243	N/A	INTRINSIC
SCOP:d1bg1a1	289	458	5e-4	SMART
low complexity region	466	490	N/A	INTRINSIC
low complexity region	507	524	N/A	INTRINSIC
low complexity region	533	546	N/A	INTRINSIC

• Predicted Effect: probably null
• SMART Domains: Protein: ENSMUSP00000104517; Gene: ENSMUSG00000020400

Domain	Start	End	E-Value	Type
coiled coil region	42	71	N/A	INTRINSIC
low complexity region	102	115	N/A	INTRINSIC
coiled coil region	215	266	N/A	INTRINSIC
low complexity region	284	296	N/A	INTRINSIC
SCOP:d1bg1a1	342	511	2e-4	SMART
low complexity region	519	543	N/A	INTRINSIC
low complexity region	560	577	N/A	INTRINSIC
low complexity region	586	599	N/A	INTRINSIC

• Predicted Effect: probably null
• SMART Domains: Protein: ENSMUSP00000116721; Gene: ENSMUSG00000020400

Domain	Start	End	E-Value	Type
coiled coil region	42	71	N/A	INTRINSIC
low complexity region	102	115	N/A	INTRINSIC

• Predicted Effect: probably null
• SMART Domains: Protein: ENSMUSP00000116721; Gene: ENSMUSG00000020400

Domain	Start	End	E-Value	Type
coiled coil region	42	71	N/A	INTRINSIC
low complexity region	102	115	N/A	INTRINSIC

• Predicted Effect: probably null
• SMART Domains: Protein: ENSMUSP00000122836; Gene: ENSMUSG00000020400

Domain	Start	End	E-Value	Type
low complexity region	49	62	N/A	INTRINSIC
coiled coil region	162	213	N/A	INTRINSIC
low complexity region	231	243	N/A	INTRINSIC

• Predicted Effect: probably null
• SMART Domains: Protein: ENSMUSP00000122836; Gene: ENSMUSG00000020400

Domain	Start	End	E-Value	Type
low complexity region	49	62	N/A	INTRINSIC
coiled coil region	162	213	N/A	INTRINSIC
low complexity region	231	243	N/A	INTRINSIC

• Predicted Effect: probably null
• Meta Mutation Damage Score: 0.9502
• Is this an essential gene?: Non Essential (E-score: 0.000)
• Phenotypic Category: Autosomal Recessive
• Mode of Inheritance: Autosomal Recessive
• Last Updated: 2018-10-02 3:51 PM by External Program
• Record Created: 2016-07-12 9:26 PM by Tao Yue
• Record Posted: 2018-07-30
• Science Writers: Anne Murray
• Illustrators: Diantha La Vine
• Authors: Tao Yue, Xue Zhong, Jin Huk Choi, Takuma Misawa, Emre Turer, and Bruce Beutler

Accession Number

NCBI RefSeq: NM_021327 (variant 1), NM_001199275 (variant 2), NM_001199276 (variant 3), NM_001271455 (variant 4), NM_001271456 (variant 5); MGI:1926194

Alleles Listed at MGI

All Mutations and Alleles(71) : Chemically induced (other)(1) Gene trapped(61) Targeted(9)

Phenotypic Description

Figure 1. Trinity mice exhibit decreased frequencies of peripheral B2 cells. Flow cytometric analysis of peripheral blood was utilized to determine B2 cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 2. Trinity mice exhibit increased frequencies of peripheral B1a cells. Flow cytometric analysis of peripheral blood was utilized to determine B1a cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 3. Trinity mice exhibit increased frequencies of peripheral B1b cells. Flow cytometric analysis of peripheral blood was utilized to determine B1b cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 4. Trinity mice exhibit increased frequencies of peripheral CD11c+ DCs. Flow cytometric analysis of peripheral blood was utilized to determine B1a cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 5. Trinity mice exhibited susceptibility to dextran sodium sulfate-induced colitis at 7 days post-DSS treatment. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 6. Trinity mice exhibited susceptibility to dextran sodium sulfate-induced colitis at 10 days post-DSS treatment. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 7. Trinity mice exhibited increased levels of OVA-specific IgE levels in the serum after OVA/alum administration. IgE levels were determined by ELISA. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The trinity phenotype was identified among N-ethyl-N-nitrosourea (ENU)-mutagenized G3 mice of the pedigree R4475, some of which showed reduced frequencies of B2 cells (Figure 1) with concomitant increased frequencies of B1a cells (Figure 2), B1b cells (Figure 3), and CD11c+ dendritic cells (Figure 4). Some mice showed susceptibility to dextran sodium sulfate-induced colitis at 7 (Figure 5) and 10 days (Figure 6) post-DSS treatment. The level of OVA-specific IgE after OVA/alum administration was increased (Figure 7).

The causative mutation for the above phenotypes was validated to be in Pi4ka by CRISPR-mediated targeting of the Tnip1.

Nature of Mutation

Figure 8. Linkage mapping of the total IgE phenotype using a recessive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 39 mutations (X-axis) identified in the G1 male of pedigree R4475. Normalized phenotype data are shown for single locus linkage analysis without consideration of G2 dam identity. Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 39 mutations. All of the above phenotypes were linked by continuous variable mapping to a mutation in Tnip1: a T to C transition at base pair 54,939,596 (v38) on chromosome 11, or base pair 23,345 in the GenBank genomic region NC_000077 within the donor splice site of intron 3. The strongest association was found with a recessive model of inheritance to the total IgE phenotype, wherein three variant homozygotes departed phenotypically from 13 homozygous reference mice and 16 heterozygous mice with a P value of 1.169 x 10^-29 (Figure 8).  

The effect of the mutation at the cDNA and protein levels have not examined, but the mutation is predicted to result in skipping of the 138-base pair exon 3. Skipping of exon 3 would result in an in-frame deletion of 46 amino acids beginning after amino acid 46 of the protein, which is normally 647 amino acids long.

<--exon 2      <--exon 3 intron 3-->      exon 4-->         <--exon 18 22218 ……ATAAAGATGTTAG ……GCTGAGCTCACAG gtaccagaagagt…… GACAGGATACA…… ……GGGCCCCAGTGA 42    ……-I--K--M--L-- ……-A--E--L--T--                 G--Q--D--T-…… ……-G--P--Q--*-            correct        deleted                               correct

Genomic numbering corresponds to NC_000077. The donor splice site of intron 3, which is destroyed by the trinity mutation, is indicated in blue lettering and the mutated nucleotide is indicated in red.

Protein Prediction

Figure 9. Domain organization of mouse ABIN1. AHD, ABIN homology domains; NR, nuclear receptor; CC, coiled-coil; CoRNR, corepressor. The trinity mutation destroys the donor splice site of intron 3.

Tnip1 encodes ABIN1 (A20-binding inhibitors of NF-κB activation-1; alternatively, TNIP1 or NAF1 [NEF-associated factor-1]). ABIN1 is a member of the ABIN family, which also includes ABIN2 and ABIN3.

ABIN1 has four ABIN homology domains (AHDs), three coiled-coil regions (amino acids 39-72, 209-270, and 311-551), a nuclear localization signal (amino acids 537-543), a proline-rich C-terminus (amino acids 552-647), and nuclear receptor (NR) interaction motifs (Figure 9) (1). ABIN1 has several nuclear receptor (NR) interaction motifs, including two putative NR boxes (LXXLL [L = leucine, X = any amino acid]; amino acids 45-49 and amino acids 260-264) and two corepressor (CoRNR) boxes (LXXX^I/_LXXX^I/_L [I = isoleucine]; amino acids 235-243 and 432-440).  Amino acids 95 to 425 are required for ABIN1 interaction with Nef, while amino acids 444 to 601 are required for NEMO binding and ABIN1’s inhibitory activity towards TNF-induced NF-κB activation.

The AHDs are regions of high homology between the members of the ABIN family. AHD1 mediates A20 binding and AHD2 is responsible for NF-κB activation. AHD2 corresponds to a ubiquitin-binding domain (UBD; alternatively, UBAN [UBD in ABIN proteins and NEMO] domain) that shares sequence homology with UBDs in NEMO and the NEMO-like protein, optineurin (2). The functions of the AHD3 and AHD4 domains are unknown.

The ubiquitin binding domain of ABIN1 is required for interaction of ABIN1 with TBK1(see the record for pioneer)/IKKi as well as the ABIN1-mediated inhibition of IFN-β production upon poly(I:C) transfection or virus infection (3). Ubiquitination of ABIN1 prevents autoimmunity by regulating the strength of TLR-MyD88-associated signaling (4). Mice expressing a mutant ABIN1^Asp485Asn that did not bind either K63-linked or linear polyubiquitin chains exhibited enlarged spleens, lymph nodes, and Peyer’s Patches as well as spontaneous formation of germinal centers, isotype switching, and production of autoreactive antibodies.

The human and mouse TNIP1 genes undergo alternative splicing to generate several variants (1). See Table 1 for a list of the human ABIN1 variants. Mouse Tnip1 produces two splice variants that generate proteins that have different N-termini due to translation initiation from two different methionines (5-7).

Table 1. Human ABIN1 isoforms

Transcript	Description of change	Expression	References
ABIN1	Canonical isoform	Main transcript in leukemia–lymphoma, solid tumor cell lines and cells from acute myeloid leukemia patients	(7)
ABIN1α	Use of an alternative splice acceptor site within exon 18 and can both be transcribed from alternative promoters (1A and 1B)	Several leukemia-lymphoma cell lines; not expressed in human peripheral blood mononucleocytes from healthy patients	(1)
ABIN1β		Acute myelogenous leukemia blasts; not expressed in peripheral and bone-marrow cells from healthy patients
ABIN1α2	Lacks exon 16	Dominant transcript in peripheral blood mononucleocytes from healthy donors; several leukemia-lymphoma cell lines	(7)
ABIN1β2		Acute myelogenous leukemia blasts; not expressed in peripheral and bone-marrow cells from healthy patients
ABIN1α3	Lacks exon 16, but contains insertion of 100-bp between exons 15 and 17; leads to premature termination	Higher expression than full-length in acute myeloid leukemia patients
ABIN1β3		Higher expression than full-length in acute myeloid leukemia patients
ABIN-1α4	Lacks exons 16 and 17	Lower expression length in acute myeloid leukemia patients compared to peripheral blood mononuclear cells from healthy persons

The trinity mutation is predicted to result in skipping of the 138-base pair exon 3. Skipping of exon 3 would result in an in-frame deletion of 46 amino acids beginning after amino acid 46 of the protein; exon 3 encodes the N-terminal AHD domain.

Expression/Localization

TNIP1 is ubiquitously expressed, with high expression in peripheral blood lymphocytes, spleen, and skeletal muscle (2). ABIN-1 is predominantly cytoplasmic, but can putatively shuttle between the cytosol and the nucleus (8;9). The human TNIP1 splice variants show variation in expression (Table 1).

Background

Figure 10. Inhibition of NF-κB signaling by A20 ubiquitination. CD40 receptors bind to TRAFs to regulate NIK activity. TRAF3 and TRAF2 are recruited to the receptor along with cIAP1/2. TRAF2 undergoes K63 self-ubiquitination (lavender) and is responsible for the K63 ubiquitination of cIAP1/2. TRAF3 is degraded by K48 ubiquitination (light blue), and enhanced by the K63 ubiquitination of TRAF2 and cIAP1/2. (Gray arrows represent ubiquitination dependence.) As TRAF levels decrease, NIK is released and phosphorylates IKKa which phosphorylates p100. Phosphorylation and ubiquitination of p100 leads to the proteasomal degradation of p100  (small green circles) and the processing of p52. RelB and p52 are released for translocation into the nucleus. Stimulation of the B-cell receptor (BCR) results in the recruitment of Src and Syk family kinases. These kinases activate a phosphorylation cascade which leads to the activation of protein kinase C (PKC). The phosphorylation of CARMA1 (CARD (caspase-recruitment domain)-MAGUK (membrane-associated guanylate kinase) protein 1) recruits BCL 10 (B-cell lymphoma 10) and MALT1 (mucosa-associated lymphoid tissue lymphoma translocation gene 1), forming the CBM complex and activating the IKK complex. TNFR, TLR4, and IL-1R signal through kinases and adaptors (TRAFs), resulting in IKK activation. This activation occurs after the K63 ubiquitination of TRAFs and RIP. TAK1 and its adaptor proteins TAB1 and TAB2 bind ubiquitin chains to TRAF and NEMO (IKKγ) resulting in the activation of the IKK complex (NEMO, IKKa and IKKb). Activated NOD2 recruits RIP which also activates the IKK complex. The IKK complex phosphorylates both IκB, p105 and TPL2 (or MAP3K8), resulting in IkB and p105 ubiquitination and degradation (small pink circles). Degradation of IκB releases activated NF-κB dimers for translocation to the nucleus. A20 is a deubiquitinating enzyme that inhibits NF-κB signaling by disassembling K63-linked ubiquitin chains from RIP, TRAF6, and NEMO. The K63 chains are replaced with K48-linked ubiquitin chains, targeting them for degradation. ABIN1 is an A20-binding protein. This image is interactive. Click on the image to view mutations in the pathway (red) and the genes affected by these mutations (black). Click on the mutations for more specific information.

The rapid and transient activation of NF-κB complexes in response to a wide range of stimuli such as proinflammatory cytokines, DNA damaging agents, TLR agonists, and viruses is typically regulated by the canonical NF-κB pathway (Figure 10). These signals are mediated by various cell surface or intracellular receptors including the TNF receptor (TNFR) superfamily, the TIR domain family, BCR, TCR, nucleotide binding oligomerization domain (NOD)-like receptors and retinoic acid-inducible gene 1 (RIG-1) like helicases (RLHs).  Receptor activation promotes the recruitment of adaptor proteins resulting in specific signaling complexes that converge on and activate the IKK complex composed of IKK-1, IKK-2 and NEMO [for review see (10;11)].  In the resting cell, NF-κB dimers are kept inactive in the cytoplasm through their association with the IκB inhibitory molecules IκBα, IκBβ, and IκBε (12).  In response to stimulation, the IκB proteins are phosphorylated by the IKK complex at conserved serine residues resulting in K48-linked polyubiquitination of IκB molecules and subsequent proteolysis.  Degradation of IκBs allows the NF-κB dimers to translocate into the nucleus, where they are able to activate the transcription of target genes (10;11).  Genetic studies have demonstrated that the IKK-2 and NEMO subunits of the IKK complex are required for canonical NF-κB activation (13), while IKK-1 and the NF-κB inducing kinase (NIK; see the record for lucky) are required for the non-canonical or alternative NF-κB pathway (14).  The non-canonical NF-κB pathway drives the post-translational processing of p100 to mature p52, and results in the activation of p52/RelB heterodimers (10;15-17).

ABIN1 is an A20 (see the record for lasvegas)-binding protein that regulates NF-κB activation through its association with A20. A20 plays a key role in the negative regulation of inflammation and immunity by regulating the nuclear factor (NF)-κB pathway as well as programmed cell death [reviewed in (18-20)]. A20 interacts with several proteins known to participate in NF-κB signaling pathways, including RIP1 and TRAF2 downstream of TNFR1; TRAF6 downstream of the TLRs and IL-1R; RIP2 downstream of NOD2; and NEMO (18-20).  ABIN1 also inhibits p105 processing, which potentiates the NF-κB activity of ABIN1 (21). A20 is thought to inhibit NF-κB activity through both its deubiquitinating and ubiquitinating activities (22).  In the case of RIP1, A20 first removes the activating K63-linked polyubiquitin chain, and then adds K48-polyubiquitin chains to target RIP1 for proteasomal degradation (22).  A20 is also known to deubiquitinate TRAF6 (23), RIP2 (24) and NEMO, although the role of NEMO ubiquitination in NF-κB activation remains unclear (25;26).  However, none of these proteins are targets of A20 K48-linked ubiquitination (19;20).  A20 also inhibits NF-κB activation by targeting the RIP1 associated molecule TRAF2 to the lysosomes for degradation, an activity that does not require its ubiquitin modifying property (27).  Other mechanisms A20 employs to interfere with the NF-κB pathway include TRAF6 binding, which prevents TRAF6 from interacting with the E2 conjugating enzymes UBCH13 and UBCH5 and inhibits its E3 ligase function.  A20 also disrupts the interaction between UBCH13 and the E3 ubiquitin ligases cIAP1 (cellular inhibitor of apoptosis protein 1) and TRAF2 upon TNF stimulation. A20 is also required for K48-linked ubiquitination and subsequent degradation of UBCH13 and UBCH5 (28).  In B and T cells that express A20 constitutively, activation of the NF-κB pathway in response to BCR and TCR stimulation requires A20 inactivation.  This occurs via proteolytic processing by MALT1, as well as proteasomal degradation (29;30).

In addition to inhibiting NF-κB activity, A20 further affects inflammation by inhibiting interferon (IFN) regulator factor 3 (IRF3) activation downstream of RIG-I and TLR3, which normally results in the production of IFN-β (31;32).  A20 appears to affect IRF3 activation at the level of TBK1 and IKK-ε, which are required for IRF3 activation (31).  A20 also may negatively regulate mitogen activated protein kinase (MAPK) signaling downstream of TNF, IL-1, and LPS stimulation (33-35), although this activity appears to be cell specific.  Finally, A20 is also important in apopotosis and cell survival by protecting certain cell types from TNF-induced apoptosis (33;36), Fas-induced apoptosis (37) and p53-induced apoptosis following viral infection (38).  In addition, A20 downregulation may be important in activation-induced cell death (AICD) in T cells (39).  The ubiquitin-editing activity of A20 is likely important in its anti-apoptotic role as A20 can deubiquitinate K63-linked caspase-8, which is a common component of both TNF- and Fas-induced apoptosis.  Caspase-8 ubiquitination is required for caspase-8 aggregation, leading to its full activation and processing (40).  A20 can also inhibit necrosis.  In some cell types, A20 overexpression has been reported to be pro-apoptotic.  These paradoxical effects may be due to a balance that exists between the direct anti-apoptotic effect of A20 and an indirect pro-apoptotic effect caused by its NF-κB inhibitory function (19). 

In TNF (see the record for Panr1)-associated signaling, ligand binding promotes TNFR-1 binding to TNFR-associated death domain (TRADD) protein. TNF receptor-associated factor 2 (TRAF2) and/or TRAF5 as well as the Ser/Thr kinase receptor-interacting protein (RIP) are subsequently recruited to the receptor complex. Activation of the TAB2/TAK1 complex activates the IKK complex to phosphorylate IκB, resulting in release of NF-κB for translocation to the nucleus and activation of gene expression. TNFR1 activates JNK through sequential recruitment of TRAF2, MEKK1 and MKK7. MAPK activation involves signaling through TRADD, RIP and MKK3. TRADD recruitment to TNFR1 also leads to the induction of apoptosis through FAS-associated death domain (FADD) protein, caspase-8 and caspase-3. ABIN1 inhibits caspase 8 recruitment to FADD subsequently preventing caspase 8 cleavage and programmed cell death.

ABIN1 is also a negative regulator of antiviral signaling (4). Reduced expression of ABIN1 caused increased IFN-β production upon virus infection. ABIN1 associates with TAX1BP1 and A20 to recruit these proteins to the noncanonical IκB kinases TBK1 and IKKi in response to poly(I:C) transfection. The ABIN1 and TAX1BP1 complex disrupted interactions between the E3 ubiquitin ligase TRAF3 (see the record for Hulk) and TBK1/IKKi to attenuate lysine 63-linked polyubiquitination of TBK1/IKKi.

ABIN1 is also an atypical nuclear receptor coregulator (41;42). ABIN1 targets agonist-bound PPARα, subsequently reducing PPARα transcriptional activity. ABIN1 is also a corepressor of ligand-bound retinoic acid receptors, RARα and RARγ (42).

Figure 11. ABIN1 involvement in MAPK/ERK pathway. Several ligands including EGF, TGFα, β-cellulin, and epiregulin bind to EGFR, causing it to homodimerize or to heterodimerize with Erb2, Erb3, or Erb4. EGF-dependent Ras activation requires the adapter protein GRB2, which associates with the guanine nucleotide exchange factor SOS in unstimulated cells.  Upon EGFR activation, the GRB2/SOS complex relocates to the receptor (either directly or by binding to SHC) at the plasma membrane, allowing SOS to activate RAS.  The GRB2/SOS complex dissociates upon phosphorylation of SOS by MAPK. GRB2 has also been shown to complex with FAK, dynamin, Cb1, Dab-2, SOCS1, and SHIP1. 

ABIN1 can inhibit EGFR (see the record for Velvet)-associated signaling by interacting with ERK2 and subsequently blocking ERK1 (see the record for wabasha)/ERK2 nuclear translocation. In EGFR signaling, ligand binding induces the formation of EGFR homo- or heterodimers and the activation of intrinsic receptor tyrosine kinase activity, resulting in trans-phosphorylation of cytoplasmic tyrosine residues (Figure 11). Trans-phosphorylation of receptor tyrosines creates binding sites for SH2 domain- and PTB domain-containing proteins, which recruit complexes that propagate downstream signaling. These proteins include the adapters Grb2, Nck, Crk, and Shc, phosphatases PTP-1B and SHP-1 (see the record for spin), tyrosine kinases Src and Abl, PLC-γ, and p120RasGAP [reviewed in (43)]. Their binding leads to substrate phosphorylation and the activation of multiple pathways, including the Ras-MAPK, Src and Abl family kinase, JNK, STAT and PLC-γ pathways. These in turn regulate transcriptional programs controlling cell proliferation, death and differentiation, as well as signaling cascades controlling cell adhesion, motility and migration.

ABIN1 regulates HIV-1 infection by preventing CD40-mediated downregulation of HIV-Nef (2). Nef enhances HIV replication and infectivity in T cells by down-regulating cell surface expression of CD4 and major histocompatibility complex class I molecules. ABIN1 also interacts with the HIV-1 protein Matrix (8). Matrix is a component of the HIV pre-integration complex (PIC). ABIN1 putatively regulates the nuclear import of the PIC as well as nuclear export of the gag precursor polyprotein and viral genomic RNA during virion production.

ABIN1 interacts with and negatively regulates μ-opioid receptor (MOR) (44). The MOR is a G_i/o protein-coupled receptor that mediates analgesic, euphoric, and reward effects. The receptor-mediated phosphorylation, ubiquitination, and internalization of MOR was reduced in cells that coexpressed MOR and ABIN-1.

Mutations in and/or aberrant expression of human TNIP1 are associated with psoriasis (45), psoriatic arthritis (46), rheumatoid arthritis (47), asthma, systemic lupus erythematosus (48), systemic sclerosis (49), and leukemia-lymphoma.

Putative Mechanism

Tnip1-deficient and Tnip1-mutant mice exhibited prenatal lethality (incomplete penetrance) due to fetal liver apoptosis, hypoplasia, and anemia (50;51). Surviving mice exhibited increased numbers of neutrophil in the peripheral blood and spleen, B cell numbers in the spleen and lymph node and monocytes in the blood as well as increased immunoglobulin (IgA, IgG, IgM, and IgE) levels, increased susceptibility to systemic lupus erythematosus, increased anti-double stranded DNA antibody levels, glomerulonephritis, anemia, and reduced body weights compared to wild-type controls (50-52). Cells from the Tnip1-deficient mice showed hypersensitivity to TNF-induced cell death. Tnip1 mutant mice exhibited increased numbers of B cell numbers in the spleen and lymph node and monocytes in the blood.

The trinity phenotype indicates loss of ABIN1^trinity function.

Primers

PCR Primer
trinity_pcr_F: TGAGTCACTGCAGTCTTCTG
trinity_pcr_R: ATGAAGTCAGTCCGTAGCCAGG

Sequencing Primer
trinity_seq_F: TCTGCAGTCCCCAGAAGATCTG
trinity_seq_R: AAGTCAGTCCGTAGCCAGGTTTAG

Genotyping

Genotyping is performed by amplifying the region containing the mutation using PCR, followed by sequencing of the amplified region to detect the mutation.

PCR Primers

trinity_PCR_F: 5’- TGAGTCACTGCAGTCTTCTG-3’

trinity_PCR_R: 5’- ATGAAGTCAGTCCGTAGCCAGG-3’

Sequencing Primers

trinity_SEQ_F: 5’- TCTGCAGTCCCCAGAAGATCTG-3’
 

trinity_SEQ_R: 5’- AAGTCAGTCCGTAGCCAGGTTTAG-3’
 

PCR program

1) 94°C             2:00

2) 94°C             0:30

3) 55°C             0:30

4) 72°C             1:00

5) repeat steps (2-4) 40X

6) 72°C             10:00

7) 4°C               hold

The following sequence of 401 nucleotides is amplified:

tgagtcactg cagtcttctg cagtccccag aagatctgac tttctatgga tgctgtaacc       

aaaagatgta cacagggaaa aggtctgcat gggaatgggt aggccctgtg gtgttcaggg      

cctgggcagg ctgtattcag agaaggcagg gcttctggac tcttctggta cctgtgagct      

cagccaggtc atcaaaggag accaaggagg gggcagatgt cggtggtgac agctcgctgt      

ccttgaccag ctcctctgcc ttctgccgga gtctggacgc ttccatctga gactcctcca      

gaagctcccc tagagacaag gcggagaagc acaggattta tccagcccaa agcacggctc      

tccccatccc tgccctaaac ctggctacgg actgacttca t

Primer binding sites are underlined and the sequencing primer is highlighted; the mutated nucleotide is shown in red text (Chr. (+) = A>G).

References

  1. Wagner, S., Carpentier, I., Rogov, V., Kreike, M., Ikeda, F., Lohr, F., Wu, C. J., Ashwell, J. D., Dotsch, V., Dikic, I., and Beyaert, R. (2008) Ubiquitin Binding Mediates the NF-kappaB Inhibitory Potential of ABIN Proteins. Oncogene. 27, 3739-3745.

  2. Fukushi, M., Dixon, J., Kimura, T., Tsurutani, N., Dixon, M. J., and Yamamoto, N. (1999) Identification and Cloning of a Novel Cellular Protein Naf1, Nef-Associated Factor 1, that Increases Cell Surface CD4 Expression. FEBS Lett. 442, 83-88.

  3. Nanda, S. K., Venigalla, R. K., Ordureau, A., Patterson-Kane, J. C., Powell, D. W., Toth, R., Arthur, J. S., and Cohen, P. (2011) Polyubiquitin Binding to ABIN1 is Required to Prevent Autoimmunity. J Exp Med. 208, 1215-1228.

  4. Gao, L., Coope, H., Grant, S., Ma, A., Ley, S. C., and Harhaj, E. W. (2011) ABIN1 Protein Cooperates with TAX1BP1 and A20 Proteins to Inhibit Antiviral Signaling. J Biol Chem. 286, 36592-36602.

  5. Heyninck, K., De Valck, D., Vanden Berghe, W., Van Criekinge, W., Contreras, R., Fiers, W., Haegeman, G., and Beyaert, R. (1999) The Zinc Finger Protein A20 Inhibits TNF-Induced NF-kappaB-Dependent Gene Expression by Interfering with an RIP- Or TRAF2-Mediated Transactivation Signal and Directly Binds to a Novel NF-kappaB-Inhibiting Protein ABIN. J Cell Biol. 145, 1471-1482.

  6. Favre, M., Butticaz, C., Stevenson, B., Jongeneel, C. V., and Telenti, A. (2003) High Frequency of Alternative Splicing of Human Genes Participating in the HIV-1 Life Cycle: A Model using TSG101, betaTrCP, PPIA, INI1, NAF1, and PML. J Acquir Immune Defic Syndr. 34, 127-133.

  7. Shiote, Y., Ouchida, M., Jitsumori, Y., Ogama, Y., Matsuo, Y., Ishimaru, F., Tanimoto, M., and Shimizu, K. (2006) Multiple Splicing Variants of Naf1/ABIN-1 Transcripts and their Alterations in Hematopoietic Tumors. Int J Mol Med. 18, 917-923.

  8. Gupta, K., Ott, D., Hope, T. J., Siliciano, R. F., and Boeke, J. D. (2000) A Human Nuclear Shuttling Protein that Interacts with Human Immunodeficiency Virus Type 1 Matrix is Packaged into Virions. J Virol. 74, 11811-11824.

  9. Gurevich, I., Zhang, C., Francis, N., and Aneskievich, B. J. (2011) TNIP1, a Retinoic Acid Receptor Corepressor and A20-Binding Inhibitor of NF-kappaB, Distributes to both Nuclear and Cytoplasmic Locations. J Histochem Cytochem. 59, 1101-1112.

  10. Vallabhapurapu, S., and Karin, M. (2009) Regulation and Function of NF-kappaB Transcription Factors in the Immune System. Annu Rev Immunol. 27, 693-733.

  11. Hayden, M. S., and Ghosh, S. (2008) Shared Principles in NF-kappaB Signaling. Cell. 132, 344-362.

  12. Tergaonkar, V., Correa, R. G., Ikawa, M., and Verma, I. M. (2005) Distinct Roles of IkappaB Proteins in Regulating Constitutive NF-kappaB Activity. Nat Cell Biol. 7, 921-923.

  13. Gerondakis, S., Grumont, R., Gugasyan, R., Wong, L., Isomura, I., Ho, W., and Banerjee, A. (2006) Unravelling the Complexities of the NF-kappaB Signalling Pathway using Mouse Knockout and Transgenic Models. Oncogene. 25, 6781-6799.

  14. Dejardin, E. (2006) The Alternative NF-kappaB Pathway from Biochemistry to Biology: Pitfalls and Promises for Future Drug Development. Biochem Pharmacol. 72, 1161-1179.

  15. Dejardin, E., Droin, N. M., Delhase, M., Haas, E., Cao, Y., Makris, C., Li, Z. W., Karin, M., Ware, C. F., and Green, D. R. (2002) The Lymphotoxin-Beta Receptor Induces Different Patterns of Gene Expression Via Two NF-kappaB Pathways. Immunity. 17, 525-535.

  16. Senftleben, U., Cao, Y., Xiao, G., Greten, F. R., Krahn, G., Bonizzi, G., Chen, Y., Hu, Y., Fong, A., Sun, S. C., and Karin, M. (2001) Activation by IKKalpha of a Second, Evolutionary Conserved, NF-Kappa B Signaling Pathway. Science. 293, 1495-1499.

  17. Yilmaz, Z. B., Weih, D. S., Sivakumar, V., and Weih, F. (2003) RelB is Required for Peyer's Patch Development: Differential Regulation of p52-RelB by Lymphotoxin and TNF. EMBO J. 22, 121-130.

  18. Vereecke, L., Beyaert, R., and van Loo, G. (2009) The Ubiquitin-Editing Enzyme A20 (TNFAIP3) is a Central Regulator of Immunopathology. Trends Immunol. 30, 383-391.

  19. Verstrepen, L., Verhelst, K., van Loo, G., Carpentier, I., Ley, S. C., and Beyaert, R. (2010) Expression, Biological Activities and Mechanisms of Action of A20 (TNFAIP3). Biochem Pharmacol. 80, 2009-2020.

  20. Hymowitz, S. G., and Wertz, I. E. (2010) A20: From Ubiquitin Editing to Tumour Suppression. Nat Rev Cancer. 10, 332-341.

  21. Cohen, S., Ciechanover, A., Kravtsova-Ivantsiv, Y., Lapid, D., and Lahav-Baratz, S. (2009) ABIN-1 Negatively Regulates NF-kappaB by Inhibiting Processing of the p105 Precursor. Biochem Biophys Res Commun. 389, 205-210.

  22. Wertz, I. E., O'Rourke, K. M., Zhou, H., Eby, M., Aravind, L., Seshagiri, S., Wu, P., Wiesmann, C., Baker, R., Boone, D. L., Ma, A., Koonin, E. V., and Dixit, V. M. (2004) De-Ubiquitination and Ubiquitin Ligase Domains of A20 Downregulate NF-kappaB Signalling. Nature. 430, 694-699.

  23. Boone, D. L., Turer, E. E., Lee, E. G., Ahmad, R. C., Wheeler, M. T., Tsui, C., Hurley, P., Chien, M., Chai, S., Hitotsumatsu, O., McNally, E., Pickart, C., and Ma, A. (2004) The Ubiquitin-Modifying Enzyme A20 is Required for Termination of Toll-Like Receptor Responses. Nat Immunol. 5, 1052-1060.

  24. Hitotsumatsu, O., Ahmad, R. C., Tavares, R., Wang, M., Philpott, D., Turer, E. E., Lee, B. L., Shiffin, N., Advincula, R., Malynn, B. A., Werts, C., and Ma, A. (2008) The Ubiquitin-Editing Enzyme A20 Restricts Nucleotide-Binding Oligomerization Domain Containing 2-Triggered Signals. Immunity. 28, 381-390.

  25. Mauro, C., Pacifico, F., Lavorgna, A., Mellone, S., Iannetti, A., Acquaviva, R., Formisano, S., Vito, P., and Leonardi, A. (2006) ABIN-1 Binds to NEMO/IKKgamma and Co-Operates with A20 in Inhibiting NF-kappaB. J Biol Chem. 281, 18482-18488.

  26. Stilo, R., Varricchio, E., Liguoro, D., Leonardi, A., and Vito, P. (2008) A20 is a Negative Regulator of BCL10- and CARMA3-Mediated Activation of NF-kappaB. J Cell Sci. 121, 1165-1171.

  27. Li, L., Soetandyo, N., Wang, Q., and Ye, Y. (2009) The Zinc Finger Protein A20 Targets TRAF2 to the Lysosomes for Degradation. Biochim Biophys Acta. 1793, 346-353.

  28. Shembade, N., Ma, A., and Harhaj, E. W. (2010) Inhibition of NF-kappaB Signaling by A20 through Disruption of Ubiquitin Enzyme Complexes. Science. 327, 1135-1139.

  29. Duwel, M., Welteke, V., Oeckinghaus, A., Baens, M., Kloo, B., Ferch, U., Darnay, B. G., Ruland, J., Marynen, P., and Krappmann, D. (2009) A20 Negatively Regulates T Cell Receptor Signaling to NF-kappaB by Cleaving Malt1 Ubiquitin Chains. J Immunol. 182, 7718-7728.

  30. Coornaert, B., Baens, M., Heyninck, K., Bekaert, T., Haegman, M., Staal, J., Sun, L., Chen, Z. J., Marynen, P., and Beyaert, R. (2008) T Cell Antigen Receptor Stimulation Induces MALT1 Paracaspase-Mediated Cleavage of the NF-kappaB Inhibitor A20. Nat Immunol. 9, 263-271.

  31. Wang, Y. Y., Li, L., Han, K. J., Zhai, Z., and Shu, H. B. (2004) A20 is a Potent Inhibitor of TLR3- and Sendai Virus-Induced Activation of NF-kappaB and ISRE and IFN-Beta Promoter. FEBS Lett. 576, 86-90.

  32. Lin, R., Yang, L., Nakhaei, P., Sun, Q., Sharif-Askari, E., Julkunen, I., and Hiscott, J. (2006) Negative Regulation of the Retinoic Acid-Inducible Gene I-Induced Antiviral State by the Ubiquitin-Editing Protein A20. J Biol Chem. 281, 2095-2103.

  33. Lee, E. G., Boone, D. L., Chai, S., Libby, S. L., Chien, M., Lodolce, J. P., and Ma, A. (2000) Failure to Regulate TNF-Induced NF-kappaB and Cell Death Responses in A20-Deficient Mice. Science. 289, 2350-2354.

  34. Jaattela, M., Mouritzen, H., Elling, F., and Bastholm, L. (1996) A20 Zinc Finger Protein Inhibits TNF and IL-1 Signaling. J Immunol. 156, 1166-1173.

  35. O'Reilly, S. M., and Moynagh, P. N. (2003) Regulation of Toll-Like Receptor 4 Signalling by A20 Zinc Finger Protein. Biochem Biophys Res Commun. 303, 586-593.

  36. Opipari, A. W.,Jr, Hu, H. M., Yabkowitz, R., and Dixit, V. M. (1992) The A20 Zinc Finger Protein Protects Cells from Tumor Necrosis Factor Cytotoxicity. J Biol Chem. 267, 12424-12427.

  37. Daniel, S., Arvelo, M. B., Patel, V. I., Longo, C. R., Shrikhande, G., Shukri, T., Mahiou, J., Sun, D. W., Mottley, C., Grey, S. T., and Ferran, C. (2004) A20 Protects Endothelial Cells from TNF-, Fas-, and NK-Mediated Cell Death by Inhibiting Caspase 8 Activation. Blood. 104, 2376-2384.

  38. Fries, K. L., Miller, W. E., and Raab-Traub, N. (1996) Epstein-Barr Virus Latent Membrane Protein 1 Blocks p53-Mediated Apoptosis through the Induction of the A20 Gene. J Virol. 70, 8653-8659.

  39. Malewicz, M., Zeller, N., Yilmaz, Z. B., and Weih, F. (2003) NF Kappa B Controls the Balance between Fas and Tumor Necrosis Factor Cell Death Pathways during T Cell Receptor-Induced Apoptosis Via the Expression of its Target Gene A20. J Biol Chem. 278, 32825-32833.

  40. Jin, Z., Li, Y., Pitti, R., Lawrence, D., Pham, V. C., Lill, J. R., and Ashkenazi, A. (2009) Cullin3-Based Polyubiquitination and p62-Dependent Aggregation of Caspase-8 Mediate Extrinsic Apoptosis Signaling. Cell. 137, 721-735.

  41. Flores, A. M., Gurevich, I., Zhang, C., Ramirez, V. P., Devens, T. R., and Aneskievich, B. J. (2011) TNIP1 is a Corepressor of Agonist-Bound PPARs. Arch Biochem Biophys. 516, 58-66.

  42. Gurevich, I., and Aneskievich, B. J. (2009) Liganded RARalpha and RARgamma Interact with but are Repressed by TNIP1. Biochem Biophys Res Commun. 389, 409-414.

  43. Jorissen, R. N., Walker, F., Pouliot, N., Garrett, T. P., Ward, C. W., and Burgess, A. W. (2003) Epidermal Growth Factor Receptor: Mechanisms of Activation and Signalling. Exp Cell Res. 284, 31-53.

  44. Zhou, P., Jiang, J., Yan, H., Li, Y., Zhao, J., Wang, X., Su, R., and Gong, Z. (2018) ABIN-1 Negatively Regulates Mu-Opioid Receptor Function. Mol Pharmacol. 93, 36-48.

  45. Indhumathi, S., Rajappa, M., Chandrashekar, L., Ananthanarayanan, P. H., Thappa, D. M., and Negi, V. S. (2015) TNFAIP3 and TNIP1 Polymorphisms Confer Psoriasis Risk in South Indian Tamils. Br J Biomed Sci. 72, 168-173.

  46. Bowes, J., Orozco, G., Flynn, E., Ho, P., Brier, R., Marzo-Ortega, H., Coates, L., McManus, R., Ryan, A. W., Kane, D., Korendowych, E., McHugh, N., FitzGerald, O., Packham, J., Morgan, A. W., Bruce, I. N., and Barton, A. (2011) Confirmation of TNIP1 and IL23A as Susceptibility Loci for Psoriatic Arthritis. Ann Rheum Dis. 70, 1641-1644.

  47. Gallagher, J., Howlin, J., McCarthy, C., Murphy, E. P., Bresnihan, B., FitzGerald, O., Godson, C., Brady, H. R., and Martin, F. (2003) Identification of Naf1/ABIN-1 among TNF-Alpha-Induced Expressed Genes in Human Synoviocytes using Oligonucleotide Microarrays. FEBS Lett. 551, 8-12.

  48. Adrianto, I., Wang, S., Wiley, G. B., Lessard, C. J., Kelly, J. A., Adler, A. J., Glenn, S. B., Williams, A. H., Ziegler, J. T., Comeau, M. E., Marion, M. C., Wakeland, B. E., Liang, C., Kaufman, K. M., Guthridge, J. M., Alarcon-Riquelme, M. E., BIOLUPUS and GENLES Networks, Alarcon, G. S., Anaya, J. M., Bae, S. C., Kim, J. H., Joo, Y. B., Boackle, S. A., Brown, E. E., Petri, M. A., Ramsey-Goldman, R., Reveille, J. D., Vila, L. M., Criswell, L. A., Edberg, J. C., Freedman, B. I., Gilkeson, G. S., Jacob, C. O., James, J. A., Kamen, D. L., Kimberly, R. P., Martin, J., Merrill, J. T., Niewold, T. B., Pons-Estel, B. A., Scofield, R. H., Stevens, A. M., Tsao, B. P., Vyse, T. J., Langefeld, C. D., Harley, J. B., Wakeland, E. K., Moser, K. L., Montgomery, C. G., and Gaffney, P. M. (2012) Association of Two Independent Functional Risk Haplotypes in TNIP1 with Systemic Lupus Erythematosus. Arthritis Rheum. 64, 3695-3705.

  49. Bossini-Castillo, L., Martin, J. E., Broen, J., Simeon, C. P., Beretta, L., Gorlova, O. Y., Vonk, M. C., Ortego-Centeno, N., Espinosa, G., Carreira, P., Garcia de la Pena, P., Oreiro, N., Roman-Ivorra, J. A., Castillo, M. J., Gonzalez-Gay, M. A., Saez-Comet, L., Castellvi, I., Schuerwegh, A. J., Voskuyl, A. E., Hoffmann-Vold, A. M., Hesselstrand, R., Nordin, A., Lunardi, C., Scorza, R., van Laar, J. M., Shiels, P. G., Herrick, A., Worthington, J., Fonseca, C., Denton, C., Tan, F. K., Arnett, F. C., Assassi, S., Koeleman, B. P., Mayes, M. D., Radstake, T. R., Martin, J., and Spanish Scleroderma Group. (2013) Confirmation of TNIP1 but Not RHOB and PSORS1C1 as Systemic Sclerosis Risk Factors in a Large Independent Replication Study. Ann Rheum Dis. 72, 602-607.

  50. Zhou, J., Wu, R., High, A. A., Slaughter, C. A., Finkelstein, D., Rehg, J. E., Redecke, V., and Hacker, H. (2011) A20-Binding Inhibitor of NF-kappaB (ABIN1) Controls Toll-Like Receptor-Mediated CCAAT/enhancer-Binding Protein Beta Activation and Protects from Inflammatory Disease. Proc Natl Acad Sci U S A. 108, E998-1006.

  51. Oshima, S., Turer, E. E., Callahan, J. A., Chai, S., Advincula, R., Barrera, J., Shifrin, N., Lee, B., Benedict Yen, T. S., Woo, T., Malynn, B. A., and Ma, A. (2009) ABIN-1 is a Ubiquitin Sensor that Restricts Cell Death and Sustains Embryonic Development. Nature. 457, 906-909.

  52. Nanda, S. K., Venigalla, R. K., Ordureau, A., Patterson-Kane, J. C., Powell, D. W., Toth, R., Arthur, J. S., and Cohen, P. (2011) Polyubiquitin Binding to ABIN1 is Required to Prevent Autoimmunity. J Exp Med. 208, 1215-1228.