Phenotypic Mutation 'trinity' (pdf version)
List |< first << previous [record 6 of 74] next >> last >|
Alleletrinity
Mutation Type critical splice donor site
Chromosome11
Coordinate54,939,596 bp (GRCm38)
Base Change A ⇒ G (forward strand)
Gene Tnip1
Gene Name TNFAIP3 interacting protein 1
Synonym(s) ABIN1, VAN, A20-binding inhibitor of NF-kappa B activation, Nef
Chromosomal Location 54,910,785-54,962,917 bp (-)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an A20-binding protein which plays a role in autoimmunity and tissue homeostasis through the regulation of nuclear factor kappa-B activation. Mutations in this gene have been associated with psoriatic arthritis, rheumatoid arthritis, and systemic lupus erythematosus. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2011]
PHENOTYPE: Mice homozygous for a null allele exhibit perinatal lethality associated with anemia and focal apoptosis in the fetal liver. Mice homozygous for a gene trap allele exhibit partial prenatal lethality and SLE-like inflammatory disease. [provided by MGI curators]
Accession Number

NCBI RefSeq: NM_021327 (variant 1), NM_001199275 (variant 2), NM_001199276 (variant 3), NM_001271455 (variant 4), NM_001271456 (variant 5); MGI:1926194

Mapped Yes 
Amino Acid Change
Institutional SourceBeutler Lab
Gene Model predicted gene model for protein(s): [ENSMUSP00000018482] [ENSMUSP00000099791] [ENSMUSP00000099792] [ENSMUSP00000104513] [ENSMUSP00000104514] [ENSMUSP00000104517] [ENSMUSP00000122836] [ENSMUSP00000116721]
SMART Domains Protein: ENSMUSP00000018482
Gene: ENSMUSG00000020400

DomainStartEndE-ValueType
coiled coil region 42 71 N/A INTRINSIC
low complexity region 102 115 N/A INTRINSIC
coiled coil region 215 266 N/A INTRINSIC
low complexity region 284 296 N/A INTRINSIC
SCOP:d1bg1a1 342 511 2e-4 SMART
low complexity region 519 543 N/A INTRINSIC
low complexity region 560 577 N/A INTRINSIC
low complexity region 586 599 N/A INTRINSIC
Predicted Effect probably null
SMART Domains Protein: ENSMUSP00000099791
Gene: ENSMUSG00000020400

DomainStartEndE-ValueType
coiled coil region 42 71 N/A INTRINSIC
low complexity region 102 115 N/A INTRINSIC
coiled coil region 215 266 N/A INTRINSIC
low complexity region 284 296 N/A INTRINSIC
SCOP:d1bg1a1 342 511 3e-4 SMART
low complexity region 519 543 N/A INTRINSIC
low complexity region 560 577 N/A INTRINSIC
low complexity region 586 599 N/A INTRINSIC
low complexity region 627 640 N/A INTRINSIC
Predicted Effect probably null
SMART Domains Protein: ENSMUSP00000099792
Gene: ENSMUSG00000020400

DomainStartEndE-ValueType
coiled coil region 42 71 N/A INTRINSIC
low complexity region 102 115 N/A INTRINSIC
coiled coil region 215 266 N/A INTRINSIC
low complexity region 284 296 N/A INTRINSIC
SCOP:d1bg1a1 342 511 2e-4 SMART
low complexity region 519 543 N/A INTRINSIC
low complexity region 560 577 N/A INTRINSIC
low complexity region 586 599 N/A INTRINSIC
Predicted Effect probably null
SMART Domains Protein: ENSMUSP00000104513
Gene: ENSMUSG00000020400

DomainStartEndE-ValueType
low complexity region 49 62 N/A INTRINSIC
coiled coil region 162 213 N/A INTRINSIC
low complexity region 231 243 N/A INTRINSIC
SCOP:d1bg1a1 289 458 5e-4 SMART
low complexity region 466 490 N/A INTRINSIC
low complexity region 507 524 N/A INTRINSIC
low complexity region 533 546 N/A INTRINSIC
Predicted Effect probably null
SMART Domains Protein: ENSMUSP00000104514
Gene: ENSMUSG00000020400

DomainStartEndE-ValueType
low complexity region 49 62 N/A INTRINSIC
coiled coil region 162 213 N/A INTRINSIC
low complexity region 231 243 N/A INTRINSIC
SCOP:d1bg1a1 289 458 5e-4 SMART
low complexity region 466 490 N/A INTRINSIC
low complexity region 507 524 N/A INTRINSIC
low complexity region 533 546 N/A INTRINSIC
Predicted Effect probably null
SMART Domains Protein: ENSMUSP00000104517
Gene: ENSMUSG00000020400

DomainStartEndE-ValueType
coiled coil region 42 71 N/A INTRINSIC
low complexity region 102 115 N/A INTRINSIC
coiled coil region 215 266 N/A INTRINSIC
low complexity region 284 296 N/A INTRINSIC
SCOP:d1bg1a1 342 511 2e-4 SMART
low complexity region 519 543 N/A INTRINSIC
low complexity region 560 577 N/A INTRINSIC
low complexity region 586 599 N/A INTRINSIC
Predicted Effect probably null
SMART Domains Protein: ENSMUSP00000122836
Gene: ENSMUSG00000020400

DomainStartEndE-ValueType
low complexity region 49 62 N/A INTRINSIC
coiled coil region 162 213 N/A INTRINSIC
low complexity region 231 243 N/A INTRINSIC
Predicted Effect probably null
SMART Domains Protein: ENSMUSP00000116721
Gene: ENSMUSG00000020400

DomainStartEndE-ValueType
coiled coil region 42 71 N/A INTRINSIC
low complexity region 102 115 N/A INTRINSIC
Predicted Effect probably null
Phenotypic Category
Phenotypequestion? Literature verified References
DSS: sensitive day 10
FACS B cells - decreased
FACS B1 cells - increased
FACS B1a cells - increased
FACS B1b cells - increased
FACS B2 cells - decreased
FACS CD11c+ DCs - increased
FACS CD44+ CD8 MFI - increased
FACS central memory CD8 T cells in CD8 T cells - decreased
FACS IgD+ B cell percentage - decreased
FACS IgM MFI - decreased
FACS IgM+ B cells - decreased
FACS macrophages - increased
FACS NK cells - decreased
IgA response to 2nd OVA/Alum Challenge (day 7) - increased
LPS-induced Necroptosis - decreased
Macrophage necroptosis: low
NALP3 inflammasome signaling defect
NLRP3 inflammasome: high response
OVA-specific IgE - increased
total IgE level - increased 21606507
Penetrance  
Alleles Listed at MGI

All Mutations and Alleles(71) : Chemically induced (other)(1) Gene trapped(61) Targeted(9)

Lab Alleles
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00094:Tnip1 APN 11 54940817 nonsense probably null
IGL02045:Tnip1 APN 11 54911539 makesense probably null
IGL02227:Tnip1 APN 11 54936471 missense possibly damaging 0.90
IGL03093:Tnip1 APN 11 54940826 nonsense probably null
R0480:Tnip1 UTSW 11 54937994 missense probably damaging 0.96
R0511:Tnip1 UTSW 11 54917873 missense probably damaging 1.00
R2974:Tnip1 UTSW 11 54933983 unclassified probably benign
R4059:Tnip1 UTSW 11 54911569 missense probably benign 0.01
R4475:Tnip1 UTSW 11 54939596 critical splice donor site probably null
R4509:Tnip1 UTSW 11 54926790 missense probably benign 0.00
R4510:Tnip1 UTSW 11 54926790 missense probably benign 0.00
R4511:Tnip1 UTSW 11 54926790 missense probably benign 0.00
R4702:Tnip1 UTSW 11 54924402 missense probably benign 0.03
R4784:Tnip1 UTSW 11 54915539 missense possibly damaging 0.66
R5008:Tnip1 UTSW 11 54937984 missense probably benign 0.01
R5461:Tnip1 UTSW 11 54910799 unclassified probably benign
R6050:Tnip1 UTSW 11 54917877 missense probably damaging 1.00
Mode of Inheritance Autosomal Recessive
Local Stock
Repository
Last Updated 2018-10-02 3:51 PM by External Program
Record Created 2016-07-12 9:26 PM by Tao Yue
Record Posted 2018-07-30
Phenotypic Description
Figure 1. Trinity mice exhibit decreased frequencies of peripheral B2 cells. Flow cytometric analysis of peripheral blood was utilized to determine B2 cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 2. Trinity mice exhibit increased frequencies of peripheral B1a cells. Flow cytometric analysis of peripheral blood was utilized to determine B1a cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 3. Trinity mice exhibit increased frequencies of peripheral B1b cells. Flow cytometric analysis of peripheral blood was utilized to determine B1b cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 4. Trinity mice exhibit increased frequencies of peripheral CD11c+ DCs. Flow cytometric analysis of peripheral blood was utilized to determine B1a cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 5. Trinity mice exhibited susceptibility to dextran sodium sulfate-induced colitis at 7 days post-DSS treatment. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 6. Trinity mice exhibited susceptibility to dextran sodium sulfate-induced colitis at 10 days post-DSS treatment. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 7. Trinity mice exhibited increased levels of OVA-specific IgE levels in the serum after OVA/alum administration. IgE levels were determined by ELISA. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The trinity phenotype was identified among N-ethyl-N-nitrosourea (ENU)-mutagenized G3 mice of the pedigree R4475, some of which showed reduced frequencies of B2 cells (Figure 1) with concomitant increased frequencies of B1a cells (Figure 2), B1b cells (Figure 3), and CD11c+ dendritic cells (Figure 4). Some mice showed susceptibility to dextran sodium sulfate-induced colitis at 7 (Figure 5) and 10 days (Figure 6) post-DSS treatment. The level of OVA-specific IgE after OVA/alum administration was increased (Figure 7).

 

The causative mutation for the above phenotypes was validated to be in Pi4ka by CRISPR-mediated targeting of the Tnip1.

Nature of Mutation

Figure 8. Linkage mapping of the total IgE phenotype using a recessive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 39 mutations (X-axis) identified in the G1 male of pedigree R4475. Normalized phenotype data are shown for single locus linkage analysis without consideration of G2 dam identity. Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 39 mutations. All of the above phenotypes were linked by continuous variable mapping to a mutation in Tnip1: a T to C transition at base pair 54,939,596 (v38) on chromosome 11, or base pair 23,345 in the GenBank genomic region NC_000077 within the donor splice site of intron 3. The strongest association was found with a recessive model of inheritance to the total IgE phenotype, wherein three variant homozygotes departed phenotypically from 13 homozygous reference mice and 16 heterozygous mice with a P value of 1.169 x 10-29 (Figure 8).  

 

The effect of the mutation at the cDNA and protein levels have not examined, but the mutation is predicted to result in skipping of the 138-base pair exon 3. Skipping of exon 3 would result in an in-frame deletion of 46 amino acids beginning after amino acid 46 of the protein, which is normally 647 amino acids long.

 

            <--exon 2      <--exon 3 intron 3-->      exon 4-->         <--exon 18

22218 ……ATAAAGATGTTAG ……GCTGAGCTCACAG gtaccagaagagt…… GACAGGATACA…… ……GGGCCCCAGTGA
42    ……-I--K--M--L-- ……-A--E--L--T--                 G--Q--D--T-…… ……-G--P--Q--*-

           correct        deleted                               correct

 

Genomic numbering corresponds to NC_000077. The donor splice site of intron 3, which is destroyed by the trinity mutation, is indicated in blue lettering and the mutated nucleotide is indicated in red.

Protein Prediction
Figure 9. Domain organization of mouse ABIN1. AHD, ABIN homology domains; NR, nuclear receptor; CC, coiled-coil; CoRNR, corepressor. The trinity mutation destroys the donor splice site of intron 3. 

Tnip1 encodes ABIN1 (A20-binding inhibitors of NF-κB activation-1; alternatively, TNIP1 or NAF1 [NEF-associated factor-1]). ABIN1 is a member of the ABIN family, which also includes ABIN2 and ABIN3.

 

ABIN1 has four ABIN homology domains (AHDs), three coiled-coil regions (amino acids 39-72, 209-270, and 311-551), a nuclear localization signal (amino acids 537-543), a proline-rich C-terminus (amino acids 552-647), and nuclear receptor (NR) interaction motifs (Figure 9) (1). ABIN1 has several nuclear receptor (NR) interaction motifs, including two putative NR boxes (LXXLL [L = leucine, X = any amino acid]; amino acids 45-49 and amino acids 260-264) and two corepressor (CoRNR) boxes (LXXXI/LXXXI/L [I = isoleucine]; amino acids 235-243 and 432-440).  Amino acids 95 to 425 are required for ABIN1 interaction with Nef, while amino acids 444 to 601 are required for NEMO binding and ABIN1’s inhibitory activity towards TNF-induced NF-κB activation.

 

The AHDs are regions of high homology between the members of the ABIN family. AHD1 mediates A20 binding and AHD2 is responsible for NF-κB activation. AHD2 corresponds to a ubiquitin-binding domain (UBD; alternatively, UBAN [UBD in ABIN proteins and NEMO] domain) that shares sequence homology with UBDs in NEMO and the NEMO-like protein, optineurin (2). The functions of the AHD3 and AHD4 domains are unknown.

 

The ubiquitin binding domain of ABIN1 is required for interaction of ABIN1 with TBK1(see the record for pioneer)/IKKi as well as the ABIN1-mediated inhibition of IFN-β production upon poly(I:C) transfection or virus infection (3). Ubiquitination of ABIN1 prevents autoimmunity by regulating the strength of TLR-MyD88-associated signaling (4). Mice expressing a mutant ABIN1Asp485Asn that did not bind either K63-linked or linear polyubiquitin chains exhibited enlarged spleens, lymph nodes, and Peyer’s Patches as well as spontaneous formation of germinal centers, isotype switching, and production of autoreactive antibodies.

 

The human and mouse TNIP1 genes undergo alternative splicing to generate several variants (1). See Table 1 for a list of the human ABIN1 variants. Mouse Tnip1 produces two splice variants that generate proteins that have different N-termini due to translation initiation from two different methionines (5-7).

 

Table 1. Human ABIN1 isoforms

Transcript

Description of change

Expression

References

ABIN1

Canonical isoform

Main transcript in leukemia–lymphoma, solid tumor cell lines and cells from acute myeloid leukemia patients

(7)

ABIN1α

Use of an alternative splice acceptor site within exon 18 and can both be transcribed from alternative promoters (1A and 1B)

Several leukemia-lymphoma cell lines; not expressed in human peripheral blood mononucleocytes from healthy patients

(1)

ABIN1β

Acute myelogenous leukemia blasts; not expressed in peripheral and bone-marrow cells from healthy patients

ABIN1α2

Lacks exon 16

Dominant transcript in peripheral blood mononucleocytes from healthy donors; several leukemia-lymphoma cell lines

(7)

ABIN1β2

Acute myelogenous leukemia blasts; not expressed in peripheral and bone-marrow cells from healthy patients

ABIN1α3

Lacks exon 16, but contains insertion of 100-bp between exons 15 and 17; leads to premature termination

Higher expression than full-length in acute myeloid leukemia patients

ABIN1β3

Higher expression than full-length in acute myeloid leukemia patients

ABIN-1α4

Lacks exons 16 and 17

Lower expression length in acute myeloid leukemia patients compared to peripheral blood mononuclear cells from healthy persons

 

The trinity mutation is predicted to result in skipping of the 138-base pair exon 3. Skipping of exon 3 would result in an in-frame deletion of 46 amino acids beginning after amino acid 46 of the protein; exon 3 encodes the N-terminal AHD domain.

Expression/Localization

TNIP1 is ubiquitously expressed, with high expression in peripheral blood lymphocytes, spleen, and skeletal muscle (2). ABIN-1 is predominantly cytoplasmic, but can putatively shuttle between the cytosol and the nucleus (8;9). The human TNIP1 splice variants show variation in expression (Table 1).

Background
Figure 10. Inhibition of NF-κB signaling by A20 ubiquitination. CD40 receptors bind to TRAFs to regulate NIK activity. TRAF3 and TRAF2 are recruited to the receptor along with cIAP1/2. TRAF2 undergoes K63 self-ubiquitination (lavender) and is responsible for the K63 ubiquitination of cIAP1/2. TRAF3 is degraded by K48 ubiquitination (light blue), and enhanced by the K63 ubiquitination of TRAF2 and cIAP1/2. (Gray arrows represent ubiquitination dependence.) As TRAF levels decrease, NIK is released and phosphorylates IKKa which phosphorylates p100. Phosphorylation and ubiquitination of p100 leads to the proteasomal degradation of p100  (small green circles) and the processing of p52. RelB and p52 are released for translocation into the nucleus. Stimulation of the B-cell receptor (BCR) results in the recruitment of Src and Syk family kinases. These kinases activate a phosphorylation cascade which leads to the activation of protein kinase C (PKC). The phosphorylation of CARMA1 (CARD (caspase-recruitment domain)-MAGUK (membrane-associated guanylate kinase) protein 1) recruits BCL 10 (B-cell lymphoma 10) and MALT1 (mucosa-associated lymphoid tissue lymphoma translocation gene 1), forming the CBM complex and activating the IKK complex. TNFR, TLR4, and IL-1R signal through kinases and adaptors (TRAFs), resulting in IKK activation. This activation occurs after the K63 ubiquitination of TRAFs and RIP. TAK1 and its adaptor proteins TAB1 and TAB2 bind ubiquitin chains to TRAF and NEMO (IKKγ) resulting in the activation of the IKK complex (NEMO, IKKa and IKKb). Activated NOD2 recruits RIP which also activates the IKK complex. The IKK complex phosphorylates both IκB, p105 and TPL2 (or MAP3K8), resulting in IkB and p105 ubiquitination and degradation (small pink circles). Degradation of IκB releases activated NF-κB dimers for translocation to the nucleus. A20 is a deubiquitinating enzyme that inhibits NF-κB signaling by disassembling K63-linked ubiquitin chains from RIP, TRAF6, and NEMO. The K63 chains are replaced with K48-linked ubiquitin chains, targeting them for degradation. ABIN1 is an A20-binding protein. This image is interactive. Click on the image to view mutations in the pathway (red) and the genes affected by these mutations (black). Click on the mutations for more specific information.

The rapid and transient activation of NF-κB complexes in response to a wide range of stimuli such as proinflammatory cytokines, DNA damaging agents, TLR agonists, and viruses is typically regulated by the canonical NF-κB pathway (Figure 10). These signals are mediated by various cell surface or intracellular receptors including the TNF receptor (TNFR) superfamily, the TIR domain family, BCR, TCR, nucleotide binding oligomerization domain (NOD)-like receptors and retinoic acid-inducible gene 1 (RIG-1) like helicases (RLHs).  Receptor activation promotes the recruitment of adaptor proteins resulting in specific signaling complexes that converge on and activate the IKK complex composed of IKK-1, IKK-2 and NEMO [for review see (10;11)].  In the resting cell, NF-κB dimers are kept inactive in the cytoplasm through their association with the IκB inhibitory molecules IκBα, IκBβ, and IκBε (12).  In response to stimulation, the IκB proteins are phosphorylated by the IKK complex at conserved serine residues resulting in K48-linked polyubiquitination of IκB molecules and subsequent proteolysis.  Degradation of IκBs allows the NF-κB dimers to translocate into the nucleus, where they are able to activate the transcription of target genes (10;11).  Genetic studies have demonstrated that the IKK-2 and NEMO subunits of the IKK complex are required for canonical NF-κB activation (13), while IKK-1 and the NF-κB inducing kinase (NIK; see the record for lucky) are required for the non-canonical or alternative NF-κB pathway (14).  The non-canonical NF-κB pathway drives the post-translational processing of p100 to mature p52, and results in the activation of p52/RelB heterodimers (10;15-17).

 

ABIN1 is an A20 (see the record for lasvegas)-binding protein that regulates NF-κB activation through its association with A20. A20 plays a key role in the negative regulation of inflammation and immunity by regulating the nuclear factor (NF)-κB pathway as well as programmed cell death [reviewed in (18-20)]. A20 interacts with several proteins known to participate in NF-κB signaling pathways, including RIP1 and TRAF2 downstream of TNFR1; TRAF6 downstream of the TLRs and IL-1R; RIP2 downstream of NOD2; and NEMO (18-20).  ABIN1 also inhibits p105 processing, which potentiates the NF-κB activity of ABIN1 (21). A20 is thought to inhibit NF-κB activity through both its deubiquitinating and ubiquitinating activities (22).  In the case of RIP1, A20 first removes the activating K63-linked polyubiquitin chain, and then adds K48-polyubiquitin chains to target RIP1 for proteasomal degradation (22).  A20 is also known to deubiquitinate TRAF6 (23), RIP2 (24) and NEMO, although the role of NEMO ubiquitination in NF-κB activation remains unclear (25;26).  However, none of these proteins are targets of A20 K48-linked ubiquitination (19;20).  A20 also inhibits NF-κB activation by targeting the RIP1 associated molecule TRAF2 to the lysosomes for degradation, an activity that does not require its ubiquitin modifying property (27).  Other mechanisms A20 employs to interfere with the NF-κB pathway include TRAF6 binding, which prevents TRAF6 from interacting with the E2 conjugating enzymes UBCH13 and UBCH5 and inhibits its E3 ligase function.  A20 also disrupts the interaction between UBCH13 and the E3 ubiquitin ligases cIAP1 (cellular inhibitor of apoptosis protein 1) and TRAF2 upon TNF stimulation. A20 is also required for K48-linked ubiquitination and subsequent degradation of UBCH13 and UBCH5 (28).  In B and T cells that express A20 constitutively, activation of the NF-κB pathway in response to BCR and TCR stimulation requires A20 inactivation.  This occurs via proteolytic processing by MALT1, as well as proteasomal degradation (29;30).

 

In addition to inhibiting NF-κB activity, A20 further affects inflammation by inhibiting interferon (IFN) regulator factor 3 (IRF3) activation downstream of RIG-I and TLR3, which normally results in the production of IFN-β (31;32).  A20 appears to affect IRF3 activation at the level of TBK1 and IKK-ε, which are required for IRF3 activation (31).  A20 also may negatively regulate mitogen activated protein kinase (MAPK) signaling downstream of TNF, IL-1, and LPS stimulation (33-35), although this activity appears to be cell specific.  Finally, A20 is also important in apopotosis and cell survival by protecting certain cell types from TNF-induced apoptosis (33;36), Fas-induced apoptosis (37) and p53-induced apoptosis following viral infection (38).  In addition, A20 downregulation may be important in activation-induced cell death (AICD) in T cells (39).  The ubiquitin-editing activity of A20 is likely important in its anti-apoptotic role as A20 can deubiquitinate K63-linked caspase-8, which is a common component of both TNF- and Fas-induced apoptosis.  Caspase-8 ubiquitination is required for caspase-8 aggregation, leading to its full activation and processing (40).  A20 can also inhibit necrosis.  In some cell types, A20 overexpression has been reported to be pro-apoptotic.  These paradoxical effects may be due to a balance that exists between the direct anti-apoptotic effect of A20 and an indirect pro-apoptotic effect caused by its NF-κB inhibitory function (19)

 

In TNF (see the record for Panr1)-associated signaling, ligand binding promotes TNFR-1 binding to TNFR-associated death domain (TRADD) protein. TNF receptor-associated factor 2 (TRAF2) and/or TRAF5 as well as the Ser/Thr kinase receptor-interacting protein (RIP) are subsequently recruited to the receptor complex. Activation of the TAB2/TAK1 complex activates the IKK complex to phosphorylate IκB, resulting in release of NF-κB for translocation to the nucleus and activation of gene expression. TNFR1 activates JNK through sequential recruitment of TRAF2, MEKK1 and MKK7. MAPK activation involves signaling through TRADD, RIP and MKK3. TRADD recruitment to TNFR1 also leads to the induction of apoptosis through FAS-associated death domain (FADD) protein, caspase-8 and caspase-3. ABIN1 inhibits caspase 8 recruitment to FADD subsequently preventing caspase 8 cleavage and programmed cell death.

 

ABIN1 is also a negative regulator of antiviral signaling (4). Reduced expression of ABIN1 caused increased IFN-β production upon virus infection. ABIN1 associates with TAX1BP1 and A20 to recruit these proteins to the noncanonical IκB kinases TBK1 and IKKi in response to poly(I:C) transfection. The ABIN1 and TAX1BP1 complex disrupted interactions between the E3 ubiquitin ligase TRAF3 (see the record for Hulk) and TBK1/IKKi to attenuate lysine 63-linked polyubiquitination of TBK1/IKKi.

 

ABIN1 is also an atypical nuclear receptor coregulator (41;42). ABIN1 targets agonist-bound PPARα, subsequently reducing PPARα transcriptional activity. ABIN1 is also a corepressor of ligand-bound retinoic acid receptors, RARα and RARγ (42).

 

Figure 11. ABIN1 involvement in MAPK/ERK pathway. Several ligands including EGF, TGFα, β-cellulin, and epiregulin bind to EGFR, causing it to homodimerize or to heterodimerize with Erb2, Erb3, or Erb4. EGF-dependent Ras activation requires the adapter protein GRB2, which associates with the guanine nucleotide exchange factor SOS in unstimulated cells.  Upon EGFR activation, the GRB2/SOS complex relocates to the receptor (either directly or by binding to SHC) at the plasma membrane, allowing SOS to activate RAS.  The GRB2/SOS complex dissociates upon phosphorylation of SOS by MAPK. GRB2 has also been shown to complex with FAK, dynamin, Cb1, Dab-2, SOCS1, and SHIP1. 

ABIN1 can inhibit EGFR (see the record for Velvet)-associated signaling by interacting with ERK2 and subsequently blocking ERK1 (see the record for wabasha)/ERK2 nuclear translocation. In EGFR signaling, ligand binding induces the formation of EGFR homo- or heterodimers and the activation of intrinsic receptor tyrosine kinase activity, resulting in trans-phosphorylation of cytoplasmic tyrosine residues (Figure 11). Trans-phosphorylation of receptor tyrosines creates binding sites for SH2 domain- and PTB domain-containing proteins, which recruit complexes that propagate downstream signaling. These proteins include the adapters Grb2, Nck, Crk, and Shc, phosphatases PTP-1B and SHP-1 (see the record for spin), tyrosine kinases Src and Abl, PLC-γ, and p120RasGAP [reviewed in (43)]. Their binding leads to substrate phosphorylation and the activation of multiple pathways, including the Ras-MAPK, Src and Abl family kinase, JNK, STAT and PLC-γ pathways. These in turn regulate transcriptional programs controlling cell proliferation, death and differentiation, as well as signaling cascades controlling cell adhesion, motility and migration.

 

ABIN1 regulates HIV-1 infection by preventing CD40-mediated downregulation of HIV-Nef (2). Nef enhances HIV replication and infectivity in T cells by down-regulating cell surface expression of CD4 and major histocompatibility complex class I molecules. ABIN1 also interacts with the HIV-1 protein Matrix (8). Matrix is a component of the HIV pre-integration complex (PIC). ABIN1 putatively regulates the nuclear import of the PIC as well as nuclear export of the gag precursor polyprotein and viral genomic RNA during virion production.

 

ABIN1 interacts with and negatively regulates μ-opioid receptor (MOR) (44). The MOR is a Gi/o protein-coupled receptor that mediates analgesic, euphoric, and reward effects. The receptor-mediated phosphorylation, ubiquitination, and internalization of MOR was reduced in cells that coexpressed MOR and ABIN-1.

 

Mutations in and/or aberrant expression of human TNIP1 are associated with psoriasis (45), psoriatic arthritis (46), rheumatoid arthritis (47), asthma, systemic lupus erythematosus (48), systemic sclerosis (49), and leukemia-lymphoma.

Putative Mechanism

Tnip1-deficient and Tnip1-mutant mice exhibited prenatal lethality (incomplete penetrance) due to fetal liver apoptosis, hypoplasia, and anemia (50;51). Surviving mice exhibited increased numbers of neutrophil in the peripheral blood and spleen, B cell numbers in the spleen and lymph node and monocytes in the blood as well as increased immunoglobulin (IgA, IgG, IgM, and IgE) levels, increased susceptibility to systemic lupus erythematosus, increased anti-double stranded DNA antibody levels, glomerulonephritis, anemia, and reduced body weights compared to wild-type controls (50-52). Cells from the Tnip1-deficient mice showed hypersensitivity to TNF-induced cell death. Tnip1 mutant mice exhibited increased numbers of B cell numbers in the spleen and lymph node and monocytes in the blood.

 

The trinity phenotype indicates loss of ABIN1trinity function.

Primers PCR Primer
trinity(F):5'- TGAGTCACTGCAGTCTTCTG -3'
trinity(R):5'- ATGAAGTCAGTCCGTAGCCAGG -3'

Sequencing Primer
trinity_seq(F):5'- TCTGCAGTCCCCAGAAGATCTG -3'
trinity_seq(R):5'- AAGTCAGTCCGTAGCCAGGTTTAG -3'
Genotyping

Genotyping is performed by amplifying the region containing the mutation using PCR, followed by sequencing of the amplified region to detect the mutation.

PCR Primers

trinity_PCR_F: 5’- TGAGTCACTGCAGTCTTCTG-3’

trinity_PCR_R: 5’- ATGAAGTCAGTCCGTAGCCAGG-3’

 

Sequencing Primers

trinity_SEQ_F: 5’- TCTGCAGTCCCCAGAAGATCTG-3’
 

trinity_SEQ_R: 5’- AAGTCAGTCCGTAGCCAGGTTTAG-3’
 

 

PCR program

1) 94°C             2:00

2) 94°C             0:30

3) 55°C             0:30

4) 72°C             1:00

5) repeat steps (2-4) 40X

6) 72°C             10:00

7) 4°C               hold

 

The following sequence of 401 nucleotides is amplified:

 

tgagtcactg cagtcttctg cagtccccag aagatctgac tttctatgga tgctgtaacc       

aaaagatgta cacagggaaa aggtctgcat gggaatgggt aggccctgtg gtgttcaggg      

cctgggcagg ctgtattcag agaaggcagg gcttctggac tcttctggta cctgtgagct      

cagccaggtc atcaaaggag accaaggagg gggcagatgt cggtggtgac agctcgctgt      

ccttgaccag ctcctctgcc ttctgccgga gtctggacgc ttccatctga gactcctcca      

gaagctcccc tagagacaag gcggagaagc acaggattta tccagcccaa agcacggctc      

tccccatccc tgccctaaac ctggctacgg actgacttca t

 

Primer binding sites are underlined and the sequencing primer is highlighted; the mutated nucleotide is shown in red text (Chr. (+) = A>G).

References
  48. Adrianto, I., Wang, S., Wiley, G. B., Lessard, C. J., Kelly, J. A., Adler, A. J., Glenn, S. B., Williams, A. H., Ziegler, J. T., Comeau, M. E., Marion, M. C., Wakeland, B. E., Liang, C., Kaufman, K. M., Guthridge, J. M., Alarcon-Riquelme, M. E., BIOLUPUS and GENLES Networks, Alarcon, G. S., Anaya, J. M., Bae, S. C., Kim, J. H., Joo, Y. B., Boackle, S. A., Brown, E. E., Petri, M. A., Ramsey-Goldman, R., Reveille, J. D., Vila, L. M., Criswell, L. A., Edberg, J. C., Freedman, B. I., Gilkeson, G. S., Jacob, C. O., James, J. A., Kamen, D. L., Kimberly, R. P., Martin, J., Merrill, J. T., Niewold, T. B., Pons-Estel, B. A., Scofield, R. H., Stevens, A. M., Tsao, B. P., Vyse, T. J., Langefeld, C. D., Harley, J. B., Wakeland, E. K., Moser, K. L., Montgomery, C. G., and Gaffney, P. M. (2012) Association of Two Independent Functional Risk Haplotypes in TNIP1 with Systemic Lupus Erythematosus. Arthritis Rheum. 64, 3695-3705.
Science Writers Anne Murray
Illustrators Diantha La Vine
AuthorsTao Yue, Xue Zhong, Jin Huk Choi, Takuma Misawa, Emre Turer, and Bruce Beutler
List |< first << previous [record 6 of 74] next >> last >|