Phenotypic Mutation 'poliwag' (pdf version)
List |< first << previous [record 30 of 132] next >> last >|
Allelepoliwag
Mutation Type nonsense
Chromosome15
Coordinate94,394,622 bp (GRCm38)
Base Change A ⇒ T (forward strand)
Gene Adamts20
Gene Name a disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 20
Synonym(s) ADAMTS-20, bt
Chromosomal Location 94,270,163-94,465,418 bp (-)
MGI Phenotype FUNCTION: This gene encodes a member of "a disintegrin and metalloproteinase with thrombospondin motifs" (ADAMTS) family of multi-domain matrix-associated metalloendopeptidases that have diverse roles in tissue morphogenesis and pathophysiological remodeling, in inflammation and in vascular biology. The encoded preproprotein undergoes proteolytic processing to generate an active protease. Certain mutations in this gene cause defective development of neural crest-derived melanoblasts resulting in a "belted" phenotype that is characterized by white spots in the lumbar region. [provided by RefSeq, Jul 2016]
PHENOTYPE: Mice homozygous for spontaneous or ENU-induced mutations exhibit abnormal coat/hair pigmentation, including a typical white belt phenotype. [provided by MGI curators]
Accession Number

NCBI RefSeq: NM_177431 (variant 1), NM_001164785 (variant 2), NM_001164786 (variant 3); MGI: 2260628

Mapped Yes 
Amino Acid Change Cysteine changed to Stop codon
Institutional SourceBeutler Lab
Gene Model predicted gene model for protein(s): [ENSMUSP00000036330] [ENSMUSP00000121696]
SMART Domains Protein: ENSMUSP00000036330
Gene: ENSMUSG00000022449
AA Change: C202*

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:Pep_M12B_propep 41 186 1.4e-30 PFAM
Pfam:Reprolysin_5 253 445 3.6e-13 PFAM
Pfam:Reprolysin_4 253 460 1.1e-7 PFAM
Pfam:Reprolysin 255 464 1.5e-26 PFAM
Pfam:Reprolysin_2 272 454 1.8e-10 PFAM
Pfam:Reprolysin_3 276 410 5.8e-10 PFAM
TSP1 556 608 7.73e-11 SMART
Pfam:ADAM_spacer1 718 836 2.6e-34 PFAM
TSP1 846 901 1.47e-1 SMART
TSP1 904 958 2.83e0 SMART
TSP1 965 1019 4.28e-4 SMART
TSP1 1020 1074 1.89e-5 SMART
TSP1 1075 1131 4.87e-8 SMART
TSP1 1152 1201 6.05e-4 SMART
TSP1 1204 1260 1.22e-8 SMART
TSP1 1304 1356 1.37e-2 SMART
TSP1 1357 1411 6e-8 SMART
TSP1 1416 1470 1.69e-2 SMART
TSP1 1471 1526 2.3e0 SMART
TSP1 1530 1579 1.23e0 SMART
TSP1 1653 1706 5.27e-4 SMART
Pfam:GON 1708 1905 5.8e-80 PFAM
Predicted Effect probably null
SMART Domains Protein: ENSMUSP00000121696
Gene: ENSMUSG00000022449
AA Change: C202*

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:Pep_M12B_propep 40 186 1e-31 PFAM
Pfam:Reprolysin_5 253 445 2.7e-13 PFAM
Pfam:Reprolysin_4 253 460 7.2e-8 PFAM
Pfam:Reprolysin 255 464 2.4e-28 PFAM
Pfam:Reprolysin_2 272 454 4e-10 PFAM
Pfam:Reprolysin_3 276 410 1.1e-10 PFAM
TSP1 556 608 7.73e-11 SMART
Pfam:ADAM_spacer1 718 836 2e-34 PFAM
TSP1 846 901 1.47e-1 SMART
TSP1 904 958 2.83e0 SMART
TSP1 965 1019 4.28e-4 SMART
TSP1 1020 1074 1.89e-5 SMART
TSP1 1075 1131 4.87e-8 SMART
TSP1 1152 1201 6.05e-4 SMART
TSP1 1204 1260 1.22e-8 SMART
TSP1 1304 1356 1.37e-2 SMART
TSP1 1357 1411 6e-8 SMART
Predicted Effect probably null
Phenotypic Category
Phenotypequestion? Literature verified References
pigmentation 14138974
skin/coat/nails 14138974
Penetrance  
Alleles Listed at MGI

All Mutations and Alleles(24) : Chemically induced (ENU)(8) Chemically induced(1) Radiation induced(2) Spontaneous(12) Targeted(1)

Lab Alleles
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00433:Adamts20 APN 15 94394641 missense probably benign
IGL00491:Adamts20 APN 15 94273232 missense possibly damaging 0.89
IGL00502:Adamts20 APN 15 94403397 missense probably damaging 0.99
IGL00672:Adamts20 APN 15 94341105 missense probably damaging 0.99
IGL00840:Adamts20 APN 15 94282482 missense probably damaging 1.00
IGL00909:Adamts20 APN 15 94379813 missense probably damaging 1.00
IGL01101:Adamts20 APN 15 94344042 missense probably damaging 1.00
IGL01137:Adamts20 APN 15 94394611 critical splice donor site probably null
IGL01457:Adamts20 APN 15 94331448 missense probably damaging 0.97
IGL01685:Adamts20 APN 15 94403446 missense possibly damaging 0.81
IGL01949:Adamts20 APN 15 94326106 missense probably benign 0.08
IGL02525:Adamts20 APN 15 94283078 splice site probably null
IGL03088:Adamts20 APN 15 94329914 critical splice donor site probably null
IGL03175:Adamts20 APN 15 94273255 nonsense probably null
belt UTSW 15 94345990 missense probably damaging 1.00
buckeye UTSW 15 94341087 missense probably damaging 1.00
jack_white UTSW 15 unclassified
Meowth UTSW 15 94331458 missense probably damaging 1.00
nidoking UTSW 15 94403445 missense probably damaging 1.00
panda UTSW 15 94326699 nonsense
pikachu UTSW 15 94345990 missense probably damaging 1.00
splotch2 UTSW 15 94335561 splice acceptor site
wash UTSW 15 94347670 nonsense probably null
whitebelly UTSW 15 unclassified
whopper UTSW 15 94347810 missense
R0483:Adamts20 UTSW 15 94353571 missense probably benign 0.00
R0514:Adamts20 UTSW 15 94270376 missense probably damaging 1.00
R0568:Adamts20 UTSW 15 94291713 splice site probably benign
R0730:Adamts20 UTSW 15 94347690 missense probably benign 0.00
R0973:Adamts20 UTSW 15 94286371 missense probably benign 0.00
R1339:Adamts20 UTSW 15 94322896 missense probably benign 0.19
R1721:Adamts20 UTSW 15 94338459 missense probably benign 0.44
R1809:Adamts20 UTSW 15 94341087 missense probably damaging 1.00
R1832:Adamts20 UTSW 15 94286344 missense probably benign 0.00
R1846:Adamts20 UTSW 15 94345990 missense probably damaging 1.00
R1867:Adamts20 UTSW 15 94338459 missense probably benign 0.44
R1875:Adamts20 UTSW 15 94331396 missense probably benign 0.01
R1930:Adamts20 UTSW 15 94404010 missense probably benign 0.03
R1931:Adamts20 UTSW 15 94404010 missense probably benign 0.03
R1932:Adamts20 UTSW 15 94404010 missense probably benign 0.03
R2001:Adamts20 UTSW 15 94347718 missense possibly damaging 0.96
R2116:Adamts20 UTSW 15 94355362 missense probably damaging 1.00
R2162:Adamts20 UTSW 15 94331458 missense probably damaging 1.00
R2350:Adamts20 UTSW 15 94283916 missense probably damaging 1.00
R2887:Adamts20 UTSW 15 94330578 missense probably benign 0.00
R2889:Adamts20 UTSW 15 94330578 missense probably benign 0.00
R2890:Adamts20 UTSW 15 94330578 missense probably benign 0.00
R3109:Adamts20 UTSW 15 94345904 splice site probably benign
R3719:Adamts20 UTSW 15 94361838 missense probably damaging 0.99
R3832:Adamts20 UTSW 15 94331458 missense probably damaging 1.00
R3901:Adamts20 UTSW 15 94328845 missense possibly damaging 0.81
R4398:Adamts20 UTSW 15 94333695 missense possibly damaging 0.93
R4402:Adamts20 UTSW 15 94379946 missense probably benign
R4431:Adamts20 UTSW 15 94344043 missense probably damaging 1.00
R4479:Adamts20 UTSW 15 94403445 missense probably damaging 1.00
R4482:Adamts20 UTSW 15 94345920 missense probably damaging 1.00
R4503:Adamts20 UTSW 15 94379750 missense probably damaging 0.99
R4671:Adamts20 UTSW 15 94403325 missense possibly damaging 0.48
R4700:Adamts20 UTSW 15 94394622 nonsense probably null
R4707:Adamts20 UTSW 15 94333647 missense possibly damaging 0.53
R4725:Adamts20 UTSW 15 94351762 missense probably damaging 0.99
R4771:Adamts20 UTSW 15 94351635 splice site probably null
R4829:Adamts20 UTSW 15 94326396 missense probably benign 0.01
R4937:Adamts20 UTSW 15 94379775 missense probably benign
R4960:Adamts20 UTSW 15 94379774 missense probably benign
R5270:Adamts20 UTSW 15 94282519 missense probably benign 0.00
R5388:Adamts20 UTSW 15 94345778 missense possibly damaging 0.81
R5410:Adamts20 UTSW 15 94281957 missense possibly damaging 0.94
R5453:Adamts20 UTSW 15 94326088 missense possibly damaging 0.69
R5611:Adamts20 UTSW 15 94273280 missense possibly damaging 0.65
R5687:Adamts20 UTSW 15 94325971 missense probably benign 0.36
R5758:Adamts20 UTSW 15 94394650 missense probably benign 0.00
R5801:Adamts20 UTSW 15 94347670 nonsense probably null
R5834:Adamts20 UTSW 15 94353584 missense probably damaging 0.99
R5993:Adamts20 UTSW 15 94338723 missense probably damaging 0.99
R5997:Adamts20 UTSW 15 94379747 missense probably damaging 1.00
R6044:Adamts20 UTSW 15 94282483 missense probably damaging 1.00
R6058:Adamts20 UTSW 15 94330047 nonsense probably null
R6217:Adamts20 UTSW 15 94338715 missense probably benign 0.00
R6283:Adamts20 UTSW 15 94351721 missense probably benign
R6354:Adamts20 UTSW 15 94347810 missense probably damaging 1.00
R6415:Adamts20 UTSW 15 94324659 critical splice donor site probably null
R6419:Adamts20 UTSW 15 94333675 missense possibly damaging 0.84
R6476:Adamts20 UTSW 15 94361810 missense probably benign 0.22
R6485:Adamts20 UTSW 15 94343971 missense probably benign 0.17
R6517:Adamts20 UTSW 15 94283104 intron probably null
R6675:Adamts20 UTSW 15 94331316 critical splice donor site probably null
R6863:Adamts20 UTSW 15 94379746 nonsense probably null
Mode of Inheritance Autosomal Recessive
Local Stock Live Mice
Repository
Last Updated 2018-10-05 4:15 PM by Diantha La Vine
Record Created 2016-08-02 2:24 PM by Jamie Russell
Record Posted 2016-09-19
Phenotypic Description
Figure 1. The poliwag mice exhibit a variable belted phenotype. Two poliwag mice are shown (middle and bottom) along with a wild-type littermate (top).
Figure 2. The poliwag mice exhibit a variable belted phenotype.

The poliwag phenotype was identified among N-ethyl-N-nitrosourea (ENU)-induced G3 mice of the pedigree 4700, some of which exhibited a variable belted phenotype (Figure 1 & 2).

Nature of Mutation

Figure 3. Linkage mapping of the pigmentation phenotype using a recessive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 121 mutations (X-axis) identified in the G1 male of pedigree R4700. Binary phenotype data are shown for single locus linkage analysis without consideration of G2 dam identity. Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 121 mutations. The pigmentation phenotype was linked to a mutation in Adamts20: a T to A transversion at base pair 94,394,622 (v38) on chromosome 15, or base pair 37,453 in the GenBank genomic region NC_000081. Linkage was found with a recessive model of inheritance (P = 1.11 x 10-4), wherein 5 affected mice were homozygous (N = 4) for the variant allele (the additional affected mouse was not genotyped), and 17 unaffected mice were either heterozygous (N = 11) or homozygous for the reference allele (N = 6) (Figure 3).

 

The mutation corresponds to residue 867 in the mRNA sequence NM_177431 within exon 3 of 28 total exons. 


 

853 TCTCACAAGCCTTGTGAAGTTTCAGAAAAT

198 -S--H--K--P--C--E--V--S--E--N-
 
 

The mutated nucleotide is indicated in red. The mutation results in substitution of cysteine (C) 202 for a premature stop codon (C202*) in both ADAMTS-20 protein variants.

Protein Prediction
Figure 4. Domain structure of ADAMTS20. The poliwag mutation results in substitution of cysteine (C) 202 for a premature stop codon (C202*) in the ADAMTS20 protein. SP, Signal peptide; MP, Metalloprotease; DL, Disintegrin-like; CRR, Cystein-rich region. TSP-type domains are yellow and numbered. Other mutations found in ADAMTS20 are noted in red. Click on each mututation for more specific information.

ADAMTS-20 is a 1,906 amino acid protein of the large family of secreted zinc-dependent metalloproteases known as the ADAMTS (a disintegrin and metalloprotease domain, with thrombospondin type-1 repeats) family (Figure 3). ADAMTS-20 has an N-terminal signal peptide and a propeptide domain which contains three conserved Cys residues and ends in a basic region (aa 246-259). Following the prodomain, ADAMTS-20 contains the zinc-coordinating catalytic sequence HELGHVFNVPHD (aa 399-410) that is closely related to sequences found in metalloproteases. The catalytic domain of ADAMTS-20 is followed by a disintegrin-like domain similar in size and structure amongst all ADAMTS proteins (76 residues) and includes eight conserved Cys residues. The disintegrin domain precedes a single thrombospondin type I repeat (TSP1) which is well-conserved and similar to a domain in Thrombospondin I. The first TSP1 repeat is followed by a cysteine (Cys)-rich domain that has ten conserved Cys residues as well as a spacer characteristic of ADAMTS family members. The spacer domain contains a putative sequence for glycosaminoglycan attachment and may be important in substrate recognition and ECM association (1;2). C-terminal to the spacer region, ADAMTS proteins have a highly variable number of TSP1 repeats. The full-length ADAMTS-20 protein contains fourteen of these motifs with linker sequences between the fifth and sixth repeat and the seventh and eighth repeat. The smaller splice variant for mouse ADAMTS-20 contains nine instead of 14 TSP1 motifs at the C-terminal domain while the human splice variant contains 11 instead of 14 TSP1 domains (1;3-5). The poliwag mutation results in substitution of cysteine (C) 202 for a premature stop codon (C202*) within the propeptide domain of ADAMTS-20. The propeptide domain is a putative protein-convertase recognition site to generate the mature enzyme.

 

Please see the record for splotch2 for more information about Adamts20.

Putative Mechanism

The ADAMTS proteins are predicted to interact with the extracellular matrix (ECM) and play a wide role in normal and pathological processes (1;3). White-spotting mutants are often the result of improper melanoblast development or survival. The lack of pigment in the adult reflects the absence of mature melanocytes in that area due to defects at various stages of melanocyte development including proliferation, survival, migration, invasion of the integument, hair follicle entry, and melanocyte stem cell renewal (6;7). Adamts20 is the gene mutated in belted and splotch2 mutant mice. Belted animals exhibit a mostly pigmented coat except for a region near the hindlimbs that resembles a belt (8). At least fifteen different belted alleles are in existence and four of these, including splotch2, have been sequenced. Two of the three previously described mutations result in single amino acid changes either in the Cys-rich domain or one of the C-terminal TSP1 repeats. The third mutation generates a premature stop codon, resulting in truncation of the protein and loss of eight C-terminal TSP1 domains. Deficient ADAMTS-20 activity may cause loss of melanoblast entry into the hair follicles (3). ADAMTS-20 may degrade specific peptide substrates, either ECM components or signaling molecules, and this degradation could be necessary for melanoblast migration to the proper areas. Examination of ADAMTS-20 function during melanoblast development determined that mice with mutations in Adamts20 had a normal distribution of melanoblasts during embryogenesis suggesting that melanoblast migration is normal in these animals. The phenotype of the poliwag mice resembles those of other Adamts20 alleles (see MGI for a list of Adamts20 alleles) indicating that the mutation results in impaired ADAMTS-20 function.

Primers PCR Primer
poliwag(F):5'- TGGTGCACATCTTTAGCATTGC -3'
poliwag(R):5'- GTGAATCCCTAGAGTGACTCTG -3'

Sequencing Primer
poliwag_seq(F):5'- GCTAATAATGGATGTTCTGCCACAG -3'
poliwag_seq(R):5'- GAATCCCTAGAGTGACTCTGGTTAAG -3'
References
  8. Murray, J. M., and Snell, G. D. (1945) Belted, A New 6Th Chromosome Mutation in the Mouse. J Hered. 36, 266-268.
Science Writers Anne Murray
Illustrators Peter Jurek, Katherine Timer
AuthorsLauren Prince, Carlos Reyna, Sara Ludwig, Jamie Russell, and Bruce Beutler
List |< first << previous [record 30 of 132] next >> last >|