Phenotypic Mutation 'mecro' (pdf version)
List |< first << previous [record 48 of 74] next >> last >|
Allelemecro
Mutation Type critical splice donor site
Chromosome8
Coordinate111,319,716 bp (GRCm38)
Base Change C ⇒ G (forward strand)
Gene Mlkl
Gene Name mixed lineage kinase domain-like
Synonym(s) 9130019I15Rik
Chromosomal Location 111,311,797-111,338,177 bp (-)
MGI Phenotype FUNCTION: This gene belongs to the protein kinase superfamily. The encoded protein contains a protein kinase-like domain; however, is thought to lack protein kinase activity. This protein plays a critical role in tumor necrosis factor (TNF)-induced necroptosis, a programmed cell death process, via interaction with receptor-interacting protein 3 (Rip3), which is a key signaling molecule in necroptosis pathway. Knockout of this gene in mice showed that it is essential for necroptosis. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Sep 2015]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit imapired macrophage and mouse embryonic fibroblast necroptosis. [provided by MGI curators]
Accession Number

NCBI RefSeq: NM_001310613 (isoform 1) NM_029005 (isoform 2); MGI:1921818

Mapped Yes 
Amino Acid Change
Institutional SourceBeutler Lab
Gene Model predicted gene model for protein(s): [ENSMUSP00000055521] [ENSMUSP00000113718]
PDB Structure
Structure of MLKL [X-RAY DIFFRACTION]
Crystal structure of the mouse MLKL kinase-like domain [X-RAY DIFFRACTION]
Crystal structure of the mouse RIP3-MLKL complex [X-RAY DIFFRACTION]
SMART Domains Protein: ENSMUSP00000055521
Gene: ENSMUSG00000012519

DomainStartEndE-ValueType
low complexity region 109 115 N/A INTRINSIC
Pfam:Pkinase_Tyr 195 448 2.7e-41 PFAM
Pfam:Pkinase 200 450 2.1e-30 PFAM
Pfam:Kinase-like 270 438 1.6e-7 PFAM
Predicted Effect probably null
SMART Domains Protein: ENSMUSP00000113718
Gene: ENSMUSG00000012519

DomainStartEndE-ValueType
low complexity region 109 115 N/A INTRINSIC
Pfam:Pkinase_Tyr 195 453 3.3e-42 PFAM
Pfam:Pkinase 196 453 1.4e-33 PFAM
Pfam:Kinase-like 270 438 8.9e-8 PFAM
Predicted Effect probably null
Phenotypic Category
Phenotypequestion? Literature verified References
LPS-induced Necroptosis - decreased 22265413
Macrophage necroptosis: low 22265413
Penetrance  
Alleles Listed at MGI

All Mutations and Alleles(4) : Chemically induced (ENU)(1) Endonuclease-mediated(1) Gene trapped(1) Targeted(1)

Lab Alleles
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Mlkl APN 8 111319428 nonsense probably null
IGL01376:Mlkl APN 8 111319747 missense probably damaging 1.00
IGL02801:Mlkl APN 8 111316432 missense probably benign 0.18
IGL02965:Mlkl APN 8 111331837 missense probably benign 0.31
IGL03121:Mlkl APN 8 111314980 missense probably damaging 1.00
necro UTSW 8 111312100 intron unknown
secro UTSW 8 111315567 intron noncoding transcript
R0133:Mlkl UTSW 8 111327948 missense probably damaging 1.00
R0230:Mlkl UTSW 8 111315062 missense probably benign 0.07
R0387:Mlkl UTSW 8 111333350 missense probably damaging 1.00
R0497:Mlkl UTSW 8 111327873 missense probably damaging 1.00
R0735:Mlkl UTSW 8 111327801 unclassified probably benign
R1733:Mlkl UTSW 8 111322748 missense probably damaging 1.00
R1761:Mlkl UTSW 8 111333723 missense possibly damaging 0.81
R1911:Mlkl UTSW 8 111312100 intron probably benign
R2057:Mlkl UTSW 8 111333610 missense probably benign 0.07
R2921:Mlkl UTSW 8 111316447 missense probably benign 0.02
R3745:Mlkl UTSW 8 111315567 intron probably benign
R4760:Mlkl UTSW 8 111319716 critical splice donor site probably null
R5377:Mlkl UTSW 8 111327937 missense probably benign 0.23
Mode of Inheritance Autosomal Recessive
Local Stock
Repository
Last Updated 2017-04-11 3:06 PM by Katherine Timer
Record Created 2016-08-15 9:58 AM by Ying Wang
Record Posted 2016-09-19
Phenotypic Description
Figure 1. Mecro mice exhibited resistance to necroptosis in response to TLR4 ligand, LPS. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The mecro phenotype was identified among N-ethyl-N-nitrosourea (ENU)-mutagenized G3 mice of the pedigree R4760, some of which exhibited resistance to lipopolysaccharide (LPS)-induced necroptosis (Figure 1).

Nature of Mutation

Figure 2. Linkage mapping of the resistance to LPS-induced necroptosis using a recessive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 89 mutations (X-axis) identified in the G1 male of pedigree R4760. Normalized phenotype data are shown for single locus linkage analysis without consideration of G2 dam identity. Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 89 mutations. The necroptosis phenotype was linked by continuous variable mapping to a mutation in Mlkl: a G to C transversion at base pair 111,319,716 (v38) on chromosome 8, or base pair 18,741 in the GenBank genomic region NC_000074. Linkage was found with a recessive model of inheritance, wherein two variant homozygotes departed phenotypically from four homozygous reference mice and six heterozygous mice with a P value of 3.982 x 10-11 (Figure 2). A substantial semidominant effect was observed, but the mutation is preponderantly recessive. 

 

The mecro mutation is within the splice donor site of intron 6, one base pair away from exon 6 (out of 11 total exons). The effect of the mecro mutation on the mRNA sequence and MLKLmecro protein expression is unknown.   In the event of exon 6 skipping, the aberrant transcript would have a deletion of the 136 base pair exon 6 (corresponding to amino acids 263-308), a frame-shift, and coding of 29 aberrant amino acids followed by a premature stop codon (within exon 8) after amino acid 291.

 

              <--exon 5        <--exon 6 intron 6-->         exon 7-->              <--exon 8
15739 ……TGCATTGATCAAACA ……AGAGGCTTATACAG gtatcggagggtcaaac…… GCTACACCATTC…… ……GCTTGCAGGATTTGA…… 21956 
258   ……-C--I--D--Q--T- ……-R--G--L--Y--R                     -A--T--P--F-…… ……-A--C--R--I--*- 
           correct          deleted                                     aberrant
 

Genomic numbering corresponds to NC_000074. The mutated nucleotide is indicated in red, the splice donor site is in green, and the splice acceptor site is in blue. 

Protein Prediction

Mlkl encodes mixed lineage kinase domain-like (MLKL), a pseudokinase and member of the protein kinase superfamily. MLKL has a pseudokinase domain (amino acids 171-464), but does not exhibit kinase activity (1) (Figure 3). Similar to kinases, MLKL has a (Val-Ala-Ile-Lys) motif, which positions the α- and β-phosphates of ATP during phosphoryl transfer, but does not have a catalytic loop or an activation loop. The pseudokinase domain has a kinase fold with N- and C-lobes (1-3). The N-lobe has an antiparallel, five-stranded β-sheet and an α-helix (helix αC), whereas the C-lobe contains seven α-helices and a pair of β-strands (4). MLKL has an N-terminal four-helical bundle (amino acids 1-130) followed by a two-helix linker (termed brace; amino acids 131-170) that tethers the N-terminus to a pseudokinase domain (1).

 

The mecro mutation is predicted to result in skipping of exon 6, resulting in deletion of amino acids 263-308 encoded by exon 6, a frame-shift, and coding of 29 aberrant amino acids and a premature stop codon after amino acid 291. The mecro mutation would affect the pseudokinase domain.

For more information about Mlkl, please see the record for necro.

Putative Mechanism

Necroptosis is a pro-inflammatory form of cell death regulated by the kinases RIP1 and RIP3. Necroptosis occurs after stimulation of the DNA receptor, DNA-dependent activator of interferon regulatory factors (DAI), or activation of death receptors [e.g., TNF receptor 1 (TNFR1; see the record PanR1 for information about TNF) and Fas (see the record for cherry)], Toll-like receptors [TLRs; e.g., TLR3 and TLR4 (see the record for lps3)], T-cell antigen receptor (TCR), or interferon receptor [IFNAR1 (see the record for macro-1) and IFNAR2 (see the record for macro-2)] signaling. During necroptosis, RIP3 binds RIP1 through their respective RIP homotypic interaction motif domains, forming the necroptosome. RIP1 and RIP3 phosphorylation in the necroptosome leads to the recruitment of MLKL (5;6). MLKL is essential for necroptosis (2;4-6). Inhibition of MLKL function using necrosulfonamide prevents necrosome formation and subsequent necropototic signaling (5;6). Mouse dermal fibroblasts (MDFs), mouse embryonic fibroblasts (MEFs), and bone-marrow-derived macrophages (BMDMs) derived from the Mlkl-/- mice were resistant to TNF-induced necroptotic cell death (1).  

 

The mecro mice exhibit resistance to LPS-induced necroptosis; necroptosis downstream of TNF has not been examined in the mecro mice. The phenotype of the mecro mice indicates loss of MLKLmecro function.

Primers PCR Primer
mecro(F):5'- ATGGGATCGCGAGACATTCTAG -3'
mecro(R):5'- TGGGGCTGGATCTTTACAATACC -3'

Sequencing Primer
mecro_seq(F):5'- TGGCGATCTGTGGGCAAC -3'
mecro_seq(R):5'- GCTGGATCTTTACAATACCTTGCTTC -3'
References
Science Writers Anne Murray
Illustrators Peter Jurek
AuthorsYing Wang and Bruce Beutler
List |< first << previous [record 48 of 74] next >> last >|