Phenotypic Mutation 'spotty'

• Allele: spotty
• Mutation Type: missense
• Chromosome: 19
• Coordinate: 27,216,192 bp (GRCm39)
• Base Change: T ⇒ C (forward strand)
• Gene: Vldlr
• Gene Name: very low density lipoprotein receptor
• Chromosomal Location: 27,193,884-27,231,631 bp (+) (GRCm39)
• MGI Phenotype: FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The low density lipoprotein receptor (LDLR) gene family consists of cell surface proteins involved in receptor-mediated endocytosis of specific ligands. This gene encodes a lipoprotein receptor that is a member of the LDLR family and plays important roles in VLDL-triglyceride metabolism and the reelin signaling pathway. Mutations in this gene cause VLDLR-associated cerebellar hypoplasia. Alternative splicing generates multiple transcript variants encoding distinct isoforms for this gene. [provided by RefSeq, Aug 2009] ; PHENOTYPE: Homozygous null mutants exhibit modest reductions in body weight and adiposity. In behavioral tests, mutants display deficits in contextual fear conditioning and long term potentiation. [provided by MGI curators]
• Mapped: Yes
• Amino Acid Change: Cysteine changed to Arginine
• Institutional Source: Beutler Lab
• Gene Model: predicted gene model for protein(s): [ENSMUSP00000025866] [ENSMUSP00000049145] [ENSMUSP00000128193] [ENSMUSP00000130382] [ENSMUSP00000127329] [ENSMUSP00000126730]
• AlphaFold: P98156
• SMART Domains: Protein: ENSMUSP00000025866; Gene: ENSMUSG00000024924; AA Change: C338R

Domain	Start	End	E-Value	Type
signal peptide	1	23	N/A	INTRINSIC
EGF_like	32	68	7.38e1	SMART
LDLa	32	69	1.69e-16	SMART
LDLa	71	110	5.81e-15	SMART
LDLa	112	151	1.96e-12	SMART
LDLa	153	190	7.15e-15	SMART
LDLa	192	231	1.23e-13	SMART
LDLa	238	275	1.1e-15	SMART
LDLa	277	314	1.13e-12	SMART
LDLa	317	357	3.86e-11	SMART
EGF_CA	356	395	1e-5	SMART
EGF_CA	396	435	6.1e-10	SMART
Blast:LY	461	495	4e-15	BLAST

• Predicted Effect: probably damaging ; PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
  (Using ENSMUST00000025866)
• SMART Domains: Protein: ENSMUSP00000049145; Gene: ENSMUSG00000024924; AA Change: C297R

Domain	Start	End	E-Value	Type
signal peptide	1	23	N/A	INTRINSIC
EGF_like	32	68	7.38e1	SMART
LDLa	32	69	1.69e-16	SMART
LDLa	71	110	1.25e-14	SMART
LDLa	112	149	7.15e-15	SMART
LDLa	151	190	1.23e-13	SMART
LDLa	197	234	1.1e-15	SMART
LDLa	236	273	1.13e-12	SMART
LDLa	276	316	3.86e-11	SMART
EGF_CA	315	354	1e-5	SMART
EGF_CA	355	394	6.1e-10	SMART
LY	420	462	2.16e-1	SMART
LY	464	506	9.54e-12	SMART
LY	507	550	2.22e-12	SMART
LY	551	593	1.66e-11	SMART
LY	594	637	5.97e-4	SMART
EGF	664	709	2.16e-1	SMART
transmembrane domain	728	750	N/A	INTRINSIC

• Predicted Effect: probably damaging ; PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
  (Using ENSMUST00000047645)
• SMART Domains: Protein: ENSMUSP00000128193; Gene: ENSMUSG00000024924

Domain	Start	End	E-Value	Type
signal peptide	1	23	N/A	INTRINSIC
LDLa	32	69	1.69e-16	SMART

• Predicted Effect: probably benign
• SMART Domains: Protein: ENSMUSP00000130382; Gene: ENSMUSG00000024924; AA Change: C7R

Domain	Start	End	E-Value	Type
LDLa	1	26	1.58e0	SMART
EGF	28	64	4e-5	SMART
LY	88	130	2.16e-1	SMART
LY	132	174	9.54e-12	SMART
LY	175	218	2.22e-12	SMART
LY	219	258	3.25e-5	SMART

• Predicted Effect: probably damaging ; PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
  (Using ENSMUST00000165761)
• SMART Domains: Protein: ENSMUSP00000127329; Gene: ENSMUSG00000024924; AA Change: C338R

Domain	Start	End	E-Value	Type
signal peptide	1	23	N/A	INTRINSIC
EGF_like	32	68	7.38e1	SMART
LDLa	32	69	1.69e-16	SMART
LDLa	71	110	5.81e-15	SMART
LDLa	112	151	1.96e-12	SMART
LDLa	153	190	7.15e-15	SMART
LDLa	192	231	1.23e-13	SMART
LDLa	238	275	1.1e-15	SMART
LDLa	277	314	1.13e-12	SMART
LDLa	317	357	3.86e-11	SMART
EGF_CA	356	395	1e-5	SMART
EGF_CA	396	435	6.1e-10	SMART
LY	461	503	2.16e-1	SMART
LY	505	547	9.54e-12	SMART
LY	548	591	2.22e-12	SMART
LY	592	634	1.66e-11	SMART
LY	635	678	5.97e-4	SMART
EGF	705	750	2.16e-1	SMART
transmembrane domain	797	819	N/A	INTRINSIC

• Predicted Effect: probably damaging ; PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
  (Using ENSMUST00000167487)
• SMART Domains: Protein: ENSMUSP00000126730; Gene: ENSMUSG00000024924; AA Change: C338R

Domain	Start	End	E-Value	Type
signal peptide	1	23	N/A	INTRINSIC
EGF_like	32	68	7.38e1	SMART
LDLa	32	69	1.69e-16	SMART
LDLa	71	110	5.81e-15	SMART
LDLa	112	151	1.96e-12	SMART
LDLa	153	190	7.15e-15	SMART
LDLa	192	231	1.23e-13	SMART
LDLa	238	275	1.1e-15	SMART
LDLa	277	314	1.13e-12	SMART
LDLa	317	357	3.86e-11	SMART
EGF_CA	356	395	1e-5	SMART
EGF_CA	396	435	6.1e-10	SMART
LY	461	503	2.16e-1	SMART
LY	505	547	9.54e-12	SMART
LY	548	591	2.22e-12	SMART
LY	592	634	1.66e-11	SMART
LY	635	678	5.97e-4	SMART
EGF	705	750	2.16e-1	SMART
transmembrane domain	769	791	N/A	INTRINSIC

• Predicted Effect: probably damaging ; PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
  (Using ENSMUST00000172302)
• Meta Mutation Damage Score: 0.9680
• Is this an essential gene?: Possibly nonessential (E-score: 0.285)
• Phenotypic Category: Autosomal Recessive
• Mode of Inheritance: Autosomal Recessive
• Last Updated: 2019-09-04 9:42 PM by Anne Murray
• Record Created: 2016-08-15 1:12 PM
• Record Posted: 2018-02-22
• Science Writers: Anne Murray
• Illustrators: Katherine Timer
• Authors: Rafael Ufret-Vincenty and Bruce Beutler

Accession Number

NCBI RefSeq: isoform 1 (NM_013703), isoform 2 (NM_001161420); MGI: 98935

Alleles Listed at MGI

All Mutations and Alleles(5) : Chemically induced (ENU)(1) Targeted(4)

Phenotypic Description

Figure 1. Spotty mice exhibit increased thickness of the outer retina (basement membrane of the RPE to the external limiting membrane). Retinal thickness was measured by optical coherence tomography. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 2. Spotty mice exhibit reduced thickness of the outer nuclear layer of the retina. Retinal thickness was measured by optical coherence tomography. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 3. Spotty mice exhibit cystic atrophy of the retina. Retina was evaluated by optical coherence tomography. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 4. Spotty mice exhibit chorioretinal lesions. Retina was evaluated by a fundus camera. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The spotty phenotype was identified among G3 mice of the pedigree R4541, some of which showed an increase in the thickness of the outer retina as measured from the basement membrane of the retinal pigment epithelium (RPE) to the external limiting membrane (Figure 1) and a decrease in the thickness of the outer nuclear layer (ONL) of the retina (Figure 2). Some mice also exhibited retinal cystic atrophy (Figure 3) and chorioretinal lesions (Figure 4).

Nature of Mutation

Figure 5. Linkage mapping of the chorioretinal lesions using a recessive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 48 mutations (X-axis) identified in the G1 male of pedigree R4541. Normalized phenotype data are shown for single locus linkage analysis without consideration of G2 dam identity. Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 48 mutations.  Both of the above anomalies were linked by continuous variable mapping to a mutation in Vldlr:  a T to C transition at base pair 27,238,792 (v38) on chromosome 19, or base pair 22,304 in the GenBank genomic region NC_000085 encoding Vldlr.  The strongest association was found with a recessive model of linkage to the normalized measurement of the chorioretinal lesions (scored as: normal (0), small lesion (1); multiple or large lesions (2); the scores of both eyes are added for a final score of 0-4), wherein four variant homozygotes departed phenotypically from two homozygous reference mice and 10 heterozygous mice with a P value of 4.896 x 10^-13 (Figure 5).  

The mutation corresponds to residue 1,607 in the mRNA sequence NM_013703 within exon 7 of 19 total exons, and residue 1,607 in the mRNA sequence NM_001161420 within exon 7 of 18 total exons.

1592 GACATGAGCAAAGTATGTGACCAGGAACAAGAC 333  -D--M--S--K--V--C--D--Q--E--Q--D-

The mutated nucleotide is indicated in red.  The mutation results in a cysteine (C) to arginine (R) substitution at position 338 (C338R) in both variants of the VLDLR protein, and is strongly predicted by PolyPhen-2 to be damaging (score = 1.000) (1).

Protein Prediction

Figure 6. Domain structure of VDLR. The spotty mutation results in conversion of cysteine 338 to an arginine in the encoded protein. SP, Signal peptide; R, LDLR class A domain; EGFL, EGF-like; B, LDLR class B domain; OD, O-linked sugar domain; TM, transmembrane domain; CT, cytoplasmic tail

VLDLR is a highly conserved 873 amino acid, single-pass (type 1) transmembrane receptor from the LDL receptor family. Structural characterization of the VLDLR protein has revealed 5 highly conserved domains (Figure 6). VLDLR’s N-terminus is an extracellular ligand-binding domain with cysteine-rich repeats, the first 27 amino acids of which serve as the signal peptide.  The cysteine-rich repeats are a part of LDLR class A domains that consist of approximately 40 amino acids.  VLDLR has eight class A domains. VLDLR has an extracellular epidermal growth factor (EGF) domain encoded by amino acids 356-750. This region of VLDLR contains three calcium-binding EGF-like repeats separated by six LDLR class B repeats (also named YWTD motifs after the most conserved region of the repeat). In each EGF-like repeat are six conserved core cysteines that form three disulfide bridges. An extracellular O-linked glycosylation domain is a 40 amino acid segment (aa 751-790) that is rich in serine and threonine resides. VLDLR’s single transmembrane domain is encoded by amino acids 798-819. VLDLR’s 54 amino acid cytoplasmic C-terminus contains an NPxY motif. 

The mouse Vldlr gene has nine splice variants, six of which are protein coding.  Two of the protein-coding variants have been validated, Vldlr-1 (NM_013703.2) and Vldlr-2 (NM_001161420.1). The 2622 bp Vldlr-1 transcript encodes an 873 aa protein from 19 exons; the 3855 bp Vldlr-2 transcript encodes an 845 aa protein variant from 18 exons (this variant lacks an in-frame exon in the 3’ coding region).

The spotty mutation results in a cysteine (C) to arginine (R) substitution at position 338 (C338R) in both validated variants of the VLDLR protein. Residue 338 resides within the ligand-binding domain in the eigth class A domain.

Please see (2) and the record r26 for more information about Vldlr.

Putative Mechanism

VLDLR is a lipid raft-sorting lipoprotein receptor that recognizes and mediates the uptake, via endocytosis, of apoE-containing VLDL, β-migrating VLDL (VLDL in which the proportions of triglycerides and cholesterol are altered by dietary challenge with cholesterol), and IDL (remnants of VLDL produced by lipolysis) (3). VLDLR interacts with several other proteins, including reelin, presenelin, apolipoprotein E (apoE), thrombospondin, and F-spondin. These proteins activate a number of cell signaling pathways and are responsible for essential cellular functions. VLDLR binds and/or internalizes its ligands or transduces extracellular signals across the cell membrane (4). VLDLR can interact with various ligands, contributing to its functional diversity, including lipoprotein lipase (LPL), receptor-associated protein (RAP), thrombospondin- 1, urokinase plasminogen activator/plasminogen activator inhibitor-1 complex, tissue factor pathway inhibitor (TFPI) (uPA/PAI-1), and several other proteinase-serpin complexes (4). Along with its role in fatty acid and cholesterol metabolism, VLDLR is also essential for cell proliferation, migration and differentiation (5-7).

VLDLR expression has been shown to be essential for maintaining vascular homeostasis during retinal development and in retinal pathologies such as diabetic retinopathy and retinal angiomatous proliferation, a subtype of age-related macular degeneration (2;8-10).  The Vldlr knock-out (Vldlr^-/-) mouse retina displays choroidal neovascularization through activation of the Wnt signaling pathway and subsequent upregulation of vascular endothelial growth factor (Vegf), an angiogenesis stimulator (2;8;9;11).

Similar to Vldlr^-/- (9) and r26 (2) mice, the spotty mice exhibit retinal abnormalities indicative of loss of VLDLR function.

Primers

PCR Primer
spotty_pcr_F: TGGCTCTGATGAAGTCAACTGC
spotty_pcr_R: TGTCATGGGCTAAAATTCCACTTTG

Sequencing Primer
spotty_seq_F: GCAAAAACGGTGAGGTTCTTTCTCC
spotty_seq_R: GGGCTAAAATTCCACTTTGAAATAC

Genotyping

PCR program

1) 94°C 2:00
2) 94°C 0:30
3) 55°C 0:30
4) 72°C 1:00
5) repeat steps (2-4) 40x
6) 72°C 10:00
7) 4°C hold

The following sequence of 407 nucleotides is amplified (chromosome 19, + strand):

1   tggctctgat gaagtcaact gcaaaaacgg tgaggttctt tctccattgt gtttggttag
61  gctattggct actcctgtca gaacagcagt ggaacttttc tcctgtgttt gaatttatag
121 tcaatcagtg cctgggccct ggaaagttca agtgcagaag cggggaatgc atagacatga
181 gcaaagtatg tgaccaggaa caagactgca gagactggag tgacgagccc ctgaaggaat
241 gccgtaagtg agagggaggc ttgctcgggg ccagagctga gaggttccat tcagccctaa
301 tgctgttttg gacacagctt agttctctgt tgaactcaga atgagctaat ttttaatagt
361 taagcttgaa gataaagtat ttcaaagtgg aattttagcc catgaca

Primer binding sites are underlined and the sequencing primers are highlighted; the mutated nucleotide is shown in red.

References

  1. Adzhubei, I. A., Schmidt, S., Peshkin, L., Ramensky, V. E., Gerasimova, A., Bork, P., Kondrashov, A. S., and Sunyaev, S. R. (2010) A Method and Server for Predicting Damaging Missense Mutations. Nat Methods. 7, 248-249.

  2. Xia, C. H., Lu, E., Liu, H., Du, X., Beutler, B., and Gong, X. (2011) The Role of Vldlr in Intraretinal Angiogenesis in Mice. Invest Ophthalmol Vis Sci. 52, 6572-6579.

  3. Takahashi, S., Kawarabayasi, Y., Nakai, T., Sakai, J., and Yamamoto, T. (1992) Rabbit very Low Density Lipoprotein Receptor: A Low Density Lipoprotein Receptor-Like Protein with Distinct Ligand Specificity. Proc Natl Acad Sci U S A. 89, 9252-9256.

  4. He, L., Lu, Y., Wang, P., Zhang, J., Yin, C., and Qu, S. (2010) Up-Regulated Expression of Type II very Low Density Lipoprotein Receptor Correlates with Cancer Metastasis and has a Potential Link to Beta-Catenin in Different Cancers. BMC Cancer. 10, 601.

  5. Reddy, S. S., Connor, T. E., Weeber, E. J., and Rebeck, W. (2011) Similarities and Differences in Structure, Expression, and Functions of VLDLR and ApoER2. Mol Neurodegener. 6, 30.

  6. Oka, K., Ishimura-Oka, K., Chu, M. J., Sullivan, M., Krushkal, J., Li, W. H., and Chan, L. (1994) Mouse very-Low-Density-Lipoprotein Receptor (VLDLR) cDNA Cloning, Tissue-Specific Expression and Evolutionary Relationship with the Low-Density-Lipoprotein Receptor. Eur J Biochem. 224, 975-982.

  7. Wang, C., Li, S. J., Yu, W. H., Xin, Q. W., Li, C., Feng, Y. P., Peng, X. L., and Gong, Y. Z. (2011) Cloning and Expression Profiling of the VLDLR Gene Associated with Egg Performance in Duck (Anas Platyrhynchos). Genet Sel Evol. 43, 29.

  8. Chen, Y., Hu, Y., Lu, K., Flannery, J. G., and Ma, J. X. (2007) Very Low Density Lipoprotein Receptor, a Negative Regulator of the Wnt Signaling Pathway and Choroidal Neovascularization. J Biol Chem. 282, 34420-34428.

  9. Chen, Y., Hu, Y., Moiseyev, G., Zhou, K. K., Chen, D., and Ma, J. X. (2009) Photoreceptor Degeneration and Retinal Inflammation Induced by very Low-Density Lipoprotein Receptor Deficiency. Microvasc Res. 78, 119-127.

  10. Haines, J. L., Schnetz-Boutaud, N., Schmidt, S., Scott, W. K., Agarwal, A., Postel, E. A., Olson, L., Kenealy, S. J., Hauser, M., Gilbert, J. R., and Pericak-Vance, M. A. (2006) Functional Candidate Genes in Age-Related Macular Degeneration: Significant Association with VEGF, VLDLR, and LRP6. Invest Ophthalmol Vis Sci. 47, 329-335.

  11. Dorrell, M. I., Aguilar, E., Jacobson, R., Yanes, O., Gariano, R., Heckenlively, J., Banin, E., Ramirez, G. A., Gasmi, M., Bird, A., Siuzdak, G., and Friedlander, M. (2009) Antioxidant Or Neurotrophic Factor Treatment Preserves Function in a Mouse Model of Neovascularization-Associated Oxidative Stress. J Clin Invest. 119, 611-623.