Phenotypic Mutation 'Bernie' (pdf version)
Allele | Bernie |
Mutation Type |
missense
|
Chromosome | 14 |
Coordinate | 99,539,666 bp (GRCm39) |
Base Change | C ⇒ T (forward strand) |
Gene |
Klf5
|
Gene Name | Kruppel-like transcription factor 5 |
Synonym(s) | IKLF, Bteb2, 4930520J07Rik, CKLF |
Chromosomal Location |
99,536,127-99,550,848 bp (+) (GRCm39)
|
MGI Phenotype |
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Kruppel-like factor subfamily of zinc finger proteins. The encoded protein is a transcriptional activator that binds directly to a specific recognition motif in the promoters of target genes. This protein acts downstream of multiple different signaling pathways and is regulated by post-translational modification. It may participate in both promoting and suppressing cell proliferation. Expression of this gene may be changed in a variety of different cancers and in cardiovascular disease. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2013] PHENOTYPE: Homozygous null mice die during gestation, while heterozygotes exhibit abnormal cardiovascular remodeling after external stress. Mice homozygous for a floxed allele activated in the prostate exhibit increased cell proliferation and hyperplasia in the prostate without neoplasia. [provided by MGI curators]
|
Accession Number | NCBI RefSeq: NM_009769; MGI:1338056
|
Mapped | Yes |
Amino Acid Change |
Arginine changed to Cysteine
|
Institutional Source | Beutler Lab |
Gene Model |
predicted gene model for protein(s):
[ENSMUSP00000005279]
[ENSMUSP00000154786]
|
AlphaFold |
Q9Z0Z7 |
SMART Domains |
Protein: ENSMUSP00000005279 Gene: ENSMUSG00000005148 AA Change: R360C
Domain | Start | End | E-Value | Type |
low complexity region
|
53 |
65 |
N/A |
INTRINSIC |
low complexity region
|
166 |
173 |
N/A |
INTRINSIC |
low complexity region
|
290 |
301 |
N/A |
INTRINSIC |
ZnF_C2H2
|
362 |
386 |
3.83e-2 |
SMART |
ZnF_C2H2
|
392 |
416 |
2.47e-5 |
SMART |
ZnF_C2H2
|
422 |
444 |
1.2e-3 |
SMART |
|
Predicted Effect |
probably damaging
PolyPhen 2
Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
(Using ENSMUST00000005279)
|
Predicted Effect |
probably damaging
PolyPhen 2
Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
(Using ENSMUST00000226784)
|
Meta Mutation Damage Score |
0.9055 |
Is this an essential gene? |
Essential (E-score: 1.000) |
Phenotypic Category |
Autosomal Semidominant |
Candidate Explorer Status |
loading ... |
Single pedigree Linkage Analysis Data
|
|
Penetrance | |
Alleles Listed at MGI | All Mutations and Alleles(37) : Chemically induced (other)(1) Gene trapped(28) Targeted(8)
|
Lab Alleles |
Allele | Source | Chr | Coord | Type | Predicted Effect | PPH Score |
IGL01295:Klf5
|
APN |
14 |
99539157 |
missense |
probably benign |
0.01 |
IGL02380:Klf5
|
APN |
14 |
99538894 |
missense |
possibly damaging |
0.67 |
I0000:Klf5
|
UTSW |
14 |
99540911 |
missense |
probably damaging |
1.00 |
R0133:Klf5
|
UTSW |
14 |
99539318 |
missense |
probably benign |
|
R1672:Klf5
|
UTSW |
14 |
99538986 |
missense |
probably damaging |
0.98 |
R1914:Klf5
|
UTSW |
14 |
99539357 |
missense |
probably benign |
0.01 |
R2193:Klf5
|
UTSW |
14 |
99536406 |
unclassified |
probably benign |
|
R3892:Klf5
|
UTSW |
14 |
99536509 |
missense |
probably benign |
0.00 |
R4446:Klf5
|
UTSW |
14 |
99539666 |
missense |
probably damaging |
1.00 |
R5437:Klf5
|
UTSW |
14 |
99538895 |
nonsense |
probably null |
|
R5707:Klf5
|
UTSW |
14 |
99538944 |
missense |
probably benign |
|
R6475:Klf5
|
UTSW |
14 |
99538817 |
missense |
probably benign |
0.00 |
R6552:Klf5
|
UTSW |
14 |
99539078 |
missense |
probably benign |
|
R6982:Klf5
|
UTSW |
14 |
99550671 |
missense |
probably damaging |
1.00 |
R7250:Klf5
|
UTSW |
14 |
99536455 |
missense |
probably benign |
0.00 |
R7643:Klf5
|
UTSW |
14 |
99550614 |
missense |
possibly damaging |
0.88 |
R7938:Klf5
|
UTSW |
14 |
99536444 |
missense |
probably damaging |
0.98 |
R8272:Klf5
|
UTSW |
14 |
99539540 |
missense |
possibly damaging |
0.67 |
R8396:Klf5
|
UTSW |
14 |
99539670 |
missense |
possibly damaging |
0.95 |
R8898:Klf5
|
UTSW |
14 |
99538922 |
missense |
probably damaging |
0.99 |
R9015:Klf5
|
UTSW |
14 |
99540919 |
makesense |
probably null |
|
R9251:Klf5
|
UTSW |
14 |
99538824 |
missense |
possibly damaging |
0.95 |
R9560:Klf5
|
UTSW |
14 |
99539034 |
missense |
probably benign |
0.06 |
R9717:Klf5
|
UTSW |
14 |
99539189 |
missense |
probably damaging |
1.00 |
|
Mode of Inheritance |
Autosomal Semidominant |
Local Stock | |
Repository | |
Last Updated |
2018-08-08 8:46 AM
by Anne Murray
|
Record Created |
2016-08-23 3:17 PM
|
Record Posted |
2018-08-08 |
Phenotypic Description |
The Bernie phenotype was identified among N-ethyl-N-nitrosourea (ENU)-mutagenized G3 mice of the pedigree R4446, some of which showed susceptibility to dextran sodium sulfate (DSS)-induced colitis at 7 (Figure 1) and 10 days (Figure 2) after DSS exposure; weight loss is used to measure DSS susceptibility.
|
Nature of Mutation |
Whole exome HiSeq sequencing of the G1 grandsire identified 45 mutations. The DSS sensitivity phenotype was linked by continuous variable mapping to a mutation in Klf5: a C to T transition at base pair 99,302,230 (v38) on chromosome 14, or base pair 3,540 in the GenBank genomic region NC_000080 encoding Klf5. The strongest association was found with an additive model of inheritance to the DSS susceptibility phenotype at day 10, wherein five variant homozygotes departed phenotypically from 24 homozygous reference mice and 29 heterozygous mice with a P value of 3.635 x 10-7 (Figure 3). The mutation corresponds to residue 1,382 in the mRNA sequence NM_009769 within exon 2 of 4 total exons.
1367 GATCTGGAGAAGCGACGTATCCACTTCTGCGAT
355 -D--L--E--K--R--R--I--H--F--C--D-
|
The mutated nucleotide is indicated in red. The mutation results in an arginine (R) to cysteine (C) substitution at position 360 (R360C) in the KLF5 protein, and is strongly predicted by PolyPhen-2 to be damaging (score = 1.000).
|
Illustration of Mutations in
Gene & Protein |
|
---|
Protein Prediction |
Krüppel-like factor 5 (KLF5; alternatively, basic transcription element binding protein 2 [BTEB2] or intestinal Krüppel-like factor [IKLF]) is a member of the KLF subfamily of zinc finger proteins. KLF5 has a proline-rich transactivation domain (TAD) at the N-terminus, a short basic region, and three consecutive Cys2–His2 zinc fingers near the C-terminus (1;2) (Figure 4). The basic region and zinc fingers regulate DNA binding; the KLF proteins bind to GC boxes within the promoters of target genes (3). KLF5 interacts with several proteins, including post-translational modifiers (e.g., PKC, HDAC1/2, SET, and p300), transcriptional co-regulators (e.g., CBP, CEBPα/β/δ, NK-κB, PPARδ, SREBP1, FOXO3, SMAD2/3/4, NCoR1/2, ERβ, MYC, JUN, and p53), and basal transcriptional components (e.g., TFIIβ, TFIIEβ, TFIIFβ, and TBP) [reviewed in (4;5)]. KLF5 undergoes several posttranslational modifications. KLF5 phosphorylation increased the transactivation ability of KLF5. For example, PKC-mediated phosphorylation of Ser153 enhances the KLF—CBP interaction (1). KLF5 is phosphorylated on Ser406 downstream of the MEK/ERK and p38 signaling pathways. MEK/ERK/p38-associated phosphorylation of KLF5 enhances the interaction of KLF5 with c-JUN (6). Ser406 phosphorylation also increases the interaction with unliganded RARα(7;8). KLF5 can also be phosphorylated on Ser303, Thr234, and Thr323. KLF5 is acetylated at Lys369 by p300 in response to PMA stimulation in vascular smooth muscle cells; p300-mediated acetylation of KLF5 increases the expression of target genes (e.g., Pdgfa) (9-12). In epithelial keratinocytes, TGFβ stimulates acetyl-KLF5/p300 to recruit SMADS2/3/4 and FOXO3 to form a complex on the Cdkn2b promoter, inhibiting cell proliferation (9;10). The oncogenic regulator SET and the histone deacetylase HDAC1 can bind KLF5 to prevent p300-associated acetylation and activation (11;12). A PY2 motif within the transactivation domain mediates association of KLF5 and the E3 ubiquitin ligase WWP1 (13); WWP1 promotes the polyubiquitination and subsequent degradation of KLF5 via the ubiquitin proteasome (14-16). KLF5 is SUMOylated on Lys152 and Lys209. SUMOylation of KLF5 inactivates the KLF5 nuclear export signal, facilitating KLF5 nuclear localization (17;18). The Bernie mutation results in an arginine (R) to cysteine (C) substitution at position 360 (R360C) in the KLF5 protein; amino acid 360 immediate precedes the first zinc finger motif.
|
Expression/Localization | KLF5 is highly expressed in intestinal epithelial cells as well as in vascular smooth muscle cells, adipocytes, neural cells, and leukocytes (19-23). KLF5 is expressed at lower levels in the reproductive organs, prostate, pancreas, skeletal muscle, and lung (5). KLF5 expression is induced after physical injury, exposure to bacterial pathogens, or irradiation. Several signaling pathways (e.g., Ras/MAPK, PKC, and TGFβ) promote KLF5 expression, including growth factor-stimulated Ras/MAPK signaling pathways as well as the Wnt- and angiotensin II-stimulated PKC signaling pathways [reviewed in (5)]. KLF5 primarily localizes to the nucleus.
|
Background |
KLF5 can function as both a transcriptional activator and a repressor, and as either an oncogene or a tumor suppressor in a cell type-specific manner (5) (Figure 5). KLF5 activates at least 88 targets and represses at least 300 targets [reviewed in (5)]. Select targets of KLF5 are listed in Table 1. Table 1. Select KLF5 target genes. Table was adapted from (5).
Target genes
|
Downstream functions
|
References
|
Tcl1, Nr0b1, Bmp4, Tgfβ2, Otx2, Pitx2, Gdnf, Nanog, and Oct3/4
|
Promotes embryonic stem cell stemness and self-renewal
|
(24-27)
|
Cyclin D1, cyclin B, Cdc2, p15, p27
|
Accelerates the G1/S and G2/M cell cycle progression
|
(28)
|
Pdgfα, Vegfα
|
Regulates angiogenesis
|
(29-31)
|
Survivin, Pim1
|
Promotes cell survival (Survivin); promotes apoptosis (Pim1)
|
(32;33)
|
NF-κB, Mcp-1
|
Regulates inflammation
|
(34;35)
|
Ilk
|
Promotes epithelial cell migration
|
(36)
|
Mmp9
|
Promotes cartilage degradation
|
(37)
|
SM22a, PAI-1, Egr-1, Pparγ, iNOS
|
Promotes epithelial cell, smooth muscle cell, and adipocyte differentiation
|
(19;20;38;39)
|
Cpt1b, Ucp2, Ucp3, FASN, PPARδ
|
Regulates fatty acid metabolism
|
(18;40)
|
KLF5 functions in embryonic development (24-26;29), apoptosis (32;33;41), cell survival through the inhibition of apoptotic pathways (32;33), cell proliferation by accelerating G1/S and G2/M cell cycle transition (42-46), epithelial cell migration in the gut and skin (36), adipocyte differentiation (19), angiogenesis (29-31), muscle differentiation (47), skeletal development (37), intestinal development (43;48-50), cardiovascular remodeling (29;41;48;51;52), inflammatory stress responses (34;35), and energy metabolism (18;40). KLF5 also functions in reprogramming of somatic cells toward pluripotent stem cells (53) and in the maintenance of embryonic stem cell self-renewal (24). KLF5 maintains embryonic stem cells in an undifferentiated state by regulating the transcription of transcription factors Nanog and Oct3/4 (Pou5f1) transcription (24), which are known factors in embryonic stem cell self-renewal (54;55). KLF5 can also inhibit the proliferation of intestine (56), prostate (57), and esophageal (58) cancer cell lines. KLF5 is aberrantly expressed in several human cancer cell lines [reviewed in (5)]. KLF5 expression is upregulated in cancer cell lines of the bladder (46), esophageal (58), and salivary gland (59) as well as in gastric carcinomas (60), some leukemia cell lines (33), and prostate cancers (57;61). In contrast, KLF5 expression is reduced in colon/intestine (45;56), breast (62;63), and nasopharyngeal (64) cancers as well as in melanomas (65). KLF5 regulates the expression of SM22α, Egf-1, and PDGF. KLF5-mediated regulation of these genes putatively linking KLF5 to the development of vascular smooth muscle cells-related diseases, such as atherosclerosis, restenosis after angioplasty, cardiac hypertrophy, and hypertension [reviewed in (5)]. Also, KLF5 regulates factors in inflammation (34), obesity (18), schizophrenia (21), and ulcerative colitis (66). Klf5-deficient (Klf5-/-) mice exhibited embryonic lethality between embryonic day (E) 6.5 and E8.5 putatively due to defects in signaling that promotes the specification of trophoblast versus inner cell mass fate during the transition from morula to blastocyst stages (27;29;67). Klf5+/- mice exhibited reduced response to injury, skeletal growth retardation, and defects in adipocyte differentiation (19;29;37). Klf5+/- mice exhibited shorter intestinal crypts and villi and decreased thickening of arterial walls (48). Klf5+/- mice showed resistance to high fat-induced obesity, hypercholesterolemia, and glucose intolerance putatively due to increased energy expenditure (18). Klf5+/- mice also exhibited reduced angiogenesis, cardiac hypertrophy, and interstitial fibrosis after low-intensity transverse aortic constriction compared to wild-type mice (29;48). Homozygous mice with conditional knockout of KLF5 in respiratory epithelial cells in the fetal lung died of respiratory distress immediately after birth, showing aberrant lung maturation and morphogenesis (68). Homozygous mice with hematopoietic-specific knockout of KLF5 showed increased numbers of short-term hematopoietic stem cells and multipotent progenitors in the spleen, reduction in the fraction of neutrophils in peripheral blood and bone marrow, and increased frequency of eosinophils in the peripheral blood, bone marrow, and lung (69). Homozygous mice with ocular surface-specific knockout of KLF5 showed abnormal eyelids with malformed meibomian glands and a conjunctiva devoid of mucin-producing goblet cells (70). Mice overexpressing KLF5 in the basal layer of the epidermis showed disrupted epithelial-mesenchymal interactions, exencephaly, craniofacial defects, ectodermal dysplasia, hypolastic epidermis, and abdominal herniation (71).
|
Putative Mechanism |
The intestinal epithelium is a single layer of cells that are renewed every four to five days throughout the life of a mouse (Figure 6). Stem cells at the base of the crypts divide, differentiate, and migrate up the villi to replace the shedding epithelium. The NOTCH, WNT, BMP, EphB1, EphB2, and EphB3 pathways control the stem cell self-renewal, differentiation, amplification, and migration. KLF5 functions in crypt/epithelial proliferation and migration in the colon. Loss of KLF5 expression in mice with DSS-induced colitis resulted in increased disease severity due to loss of cell proliferation and migration in the colon (49;72).
|
Primers |
PCR Primer
Bernie_pcr_F: GTCCCGATAGACAAGCTGAGATG
Bernie_pcr_R: TGTAGCCCAGGTTAGTTTGAACG
Sequencing Primer
Bernie_seq_F: ATGCTGCAGAATCTCACCCC
Bernie_seq_R: ACGTGTAATCTTCCTGTCTC
|
Genotyping | PCR program 1) 94°C 2:00 2) 94°C 0:30 3) 55°C 0:30 4) 72°C 1:00 5) repeat steps (2-4) 40x 6) 72°C 10:00 7) 4°C hold
The following sequence of 425 nucleotides is amplified (chromosome 14, + strand):
1 gtcccgatag acaagctgag atgctgcaga atctcacccc acctccgtcc tatgccgcta 61 caattgcttc caaactggcg attcacaacc caaatttacc tgccactctg ccagttaatt 121 cgccaactct cccacctgtc agatacaaca gaaggagtaa cccggatctg gagaagcgac 181 gtatccactt ctgcgattat aatggtatgt ggtctgtgtg ctcagggcat caggagggtt 241 tcatgttcca gagtgccaat aggtagggta tacctgacag ttaaagaaat cacctattcg 301 taatatttct gtgttttatg ctgatgtata atggcataaa acaccagcca tggcaattca 361 tgcctttaat cttagcaatg aggccgagac aggaagatta cacgttcaaa ctaacctggg 421 ctaca
Primer binding sites are underlined and the sequencing primers are highlighted; the mutated nucleotide is shown in red. |
References |
2. Kojima, S., Kobayashi, A., Gotoh, O., Ohkuma, Y., Fujii-Kuriyama, Y., and Sogawa, K. (1997) Transcriptional Activation Domain of Human BTEB2, a GC Box-Binding Factor. J Biochem. 121, 389-396.
3. Sogawa, K., Imataka, H., Yamasaki, Y., Kusume, H., Abe, H., and Fujii-Kuriyama, Y. (1993) CDNA Cloning and Transcriptional Properties of a Novel GC Box-Binding Protein, BTEB2. Nucleic Acids Res. 21, 1527-1532.
6. Liu, Y., Wen, J. K., Dong, L. H., Zheng, B., and Han, M. (2010) Kruppel-Like Factor (KLF) 5 Mediates Cyclin D1 Expression and Cell Proliferation Via Interaction with c-Jun in Ang II-Induced VSMCs. Acta Pharmacol Sin. 31, 10-18.
7. Kada, N., Suzuki, T., Aizawa, K., Munemasa, Y., Matsumura, T., Sawaki, D., and Nagai, R. (2008) Acyclic Retinoid Inhibits Functional Interaction of Transcription Factors Kruppel-Like Factor 5 and Retinoic Acid Receptor-Alpha. FEBS Lett. 582, 1755-1760.
8. Zhang, X. H., Zheng, B., Han, M., Miao, S. B., and Wen, J. K. (2009) Synthetic Retinoid Am80 Inhibits Interaction of KLF5 with RAR Alpha through Inducing KLF5 Dephosphorylation Mediated by the PI3K/Akt Signaling in Vascular Smooth Muscle Cells. FEBS Lett. 583, 1231-1236.
9. Guo, P., Dong, X. Y., Zhang, X., Zhao, K. W., Sun, X., Li, Q., and Dong, J. T. (2009) Pro-Proliferative Factor KLF5 Becomes Anti-Proliferative in Epithelial Homeostasis upon Signaling-Mediated Modification. J Biol Chem. 284, 6071-6078.
10. Guo, P., Zhao, K. W., Dong, X. Y., Sun, X., and Dong, J. T. (2009) Acetylation of KLF5 Alters the Assembly of p15 Transcription Factors in Transforming Growth Factor-Beta-Mediated Induction in Epithelial Cells. J Biol Chem. 284, 18184-18193.
11. Matsumura, T., Suzuki, T., Aizawa, K., Munemasa, Y., Muto, S., Horikoshi, M., and Nagai, R. (2005) The Deacetylase HDAC1 Negatively Regulates the Cardiovascular Transcription Factor Kruppel-Like Factor 5 through Direct Interaction. J Biol Chem. 280, 12123-12129.
12. Miyamoto, S., Suzuki, T., Muto, S., Aizawa, K., Kimura, A., Mizuno, Y., Nagino, T., Imai, Y., Adachi, N., Horikoshi, M., and Nagai, R. (2003) Positive and Negative Regulation of the Cardiovascular Transcription Factor KLF5 by p300 and the Oncogenic Regulator SET through Interaction and Acetylation on the DNA-Binding Domain. Mol Cell Biol. 23, 8528-8541.
13. Chen, C., Sun, X., Guo, P., Dong, X. Y., Sethi, P., Zhou, W., Zhou, Z., Petros, J., Frierson, H. F.,Jr, Vessella, R. L., Atfi, A., and Dong, J. T. (2007) Ubiquitin E3 Ligase WWP1 as an Oncogenic Factor in Human Prostate Cancer. Oncogene. 26, 2386-2394.
14. Chen, C., Sun, X., Ran, Q., Wilkinson, K. D., Murphy, T. J., Simons, J. W., and Dong, J. T. (2005) Ubiquitin-Proteasome Degradation of KLF5 Transcription Factor in Cancer and Untransformed Epithelial Cells. Oncogene. 24, 3319-3327.
18. Oishi, Y., Manabe, I., Tobe, K., Ohsugi, M., Kubota, T., Fujiu, K., Maemura, K., Kubota, N., Kadowaki, T., and Nagai, R. (2008) SUMOylation of Kruppel-Like Transcription Factor 5 Acts as a Molecular Switch in Transcriptional Programs of Lipid Metabolism Involving PPAR-Delta. Nat Med. 14, 656-666.
19. Oishi, Y., Manabe, I., Tobe, K., Tsushima, K., Shindo, T., Fujiu, K., Nishimura, G., Maemura, K., Yamauchi, T., Kubota, N., Suzuki, R., Kitamura, T., Akira, S., Kadowaki, T., and Nagai, R. (2005) Kruppel-Like Transcription Factor KLF5 is a Key Regulator of Adipocyte Differentiation. Cell Metab. 1, 27-39.
20. Watanabe, N., Kurabayashi, M., Shimomura, Y., Kawai-Kowase, K., Hoshino, Y., Manabe, I., Watanabe, M., Aikawa, M., Kuro-o, M., Suzuki, T., Yazaki, Y., and Nagai, R. (1999) BTEB2, a Kruppel-Like Transcription Factor, Regulates Expression of the SMemb/Nonmuscle Myosin Heavy Chain B (SMemb/NMHC-B) Gene. Circ Res. 85, 182-191.
21. Yanagi, M., Hashimoto, T., Kitamura, N., Fukutake, M., Komure, O., Nishiguchi, N., Kawamata, T., Maeda, K., and Shirakawa, O. (2008) Expression of Kruppel-Like Factor 5 Gene in Human Brain and Association of the Gene with the Susceptibility to Schizophrenia. Schizophr Res. 100, 291-301.
24. Parisi, S., Passaro, F., Aloia, L., Manabe, I., Nagai, R., Pastore, L., and Russo, T. (2008) Klf5 is Involved in Self-Renewal of Mouse Embryonic Stem Cells. J Cell Sci. 121, 2629-2634.
25. Parisi, S., Cozzuto, L., Tarantino, C., Passaro, F., Ciriello, S., Aloia, L., Antonini, D., De Simone, V., Pastore, L., and Russo, T. (2010) Direct Targets of Klf5 Transcription Factor Contribute to the Maintenance of Mouse Embryonic Stem Cell Undifferentiated State. BMC Biol. 8, 128-7007-8-128.
26. Jiang, J., Chan, Y. S., Loh, Y. H., Cai, J., Tong, G. Q., Lim, C. A., Robson, P., Zhong, S., and Ng, H. H. (2008) A Core Klf Circuitry Regulates Self-Renewal of Embryonic Stem Cells. Nat Cell Biol. 10, 353-360.
27. Ema, M., Mori, D., Niwa, H., Hasegawa, Y., Yamanaka, Y., Hitoshi, S., Mimura, J., Kawabe, Y., Hosoya, T., Morita, M., Shimosato, D., Uchida, K., Suzuki, N., Yanagisawa, J., Sogawa, K., Rossant, J., Yamamoto, M., Takahashi, S., and Fujii-Kuriyama, Y. (2008) Kruppel-Like Factor 5 is Essential for Blastocyst Development and the Normal Self-Renewal of Mouse ESCs. Cell Stem Cell. 3, 555-567.
29. Shindo, T., Manabe, I., Fukushima, Y., Tobe, K., Aizawa, K., Miyamoto, S., Kawai-Kowase, K., Moriyama, N., Imai, Y., Kawakami, H., Nishimatsu, H., Ishikawa, T., Suzuki, T., Morita, H., Maemura, K., Sata, M., Hirata, Y., Komukai, M., Kagechika, H., Kadowaki, T., Kurabayashi, M., and Nagai, R. (2002) Kruppel-Like Zinc-Finger Transcription Factor KLF5/BTEB2 is a Target for Angiotensin II Signaling and an Essential Regulator of Cardiovascular Remodeling. Nat Med. 8, 856-863.
30. Usui, S., Sugimoto, N., Takuwa, N., Sakagami, S., Takata, S., Kaneko, S., and Takuwa, Y. (2004) Blood Lipid Mediator Sphingosine 1-Phosphate Potently Stimulates Platelet-Derived Growth Factor-A and -B Chain Expression through S1P1-Gi-Ras-MAPK-Dependent Induction of Kruppel-Like Factor 5. J Biol Chem. 279, 12300-12311.
31. Aizawa, K., Suzuki, T., Kada, N., Ishihara, A., Kawai-Kowase, K., Matsumura, T., Sasaki, K., Munemasa, Y., Manabe, I., Kurabayashi, M., Collins, T., and Nagai, R. (2004) Regulation of Platelet-Derived Growth Factor-A Chain by Kruppel-Like Factor 5: New Pathway of Cooperative Activation with Nuclear Factor-kappaB. J Biol Chem. 279, 70-76.
32. Zhao, Y., Hamza, M. S., Leong, H. S., Lim, C. B., Pan, Y. F., Cheung, E., Soo, K. C., and Iyer, N. G. (2008) Kruppel-Like Factor 5 Modulates p53-Independent Apoptosis through Pim1 Survival Kinase in Cancer Cells. Oncogene. 27, 1-8.
33. Zhu, N., Gu, L., Findley, H. W., Chen, C., Dong, J. T., Yang, L., and Zhou, M. (2006) KLF5 Interacts with p53 in Regulating Survivin Expression in Acute Lymphoblastic Leukemia. J Biol Chem. 281, 14711-14718.
34. Chanchevalap, S., Nandan, M. O., McConnell, B. B., Charrier, L., Merlin, D., Katz, J. P., and Yang, V. W. (2006) Kruppel-Like Factor 5 is an Important Mediator for Lipopolysaccharide-Induced Proinflammatory Response in Intestinal Epithelial Cells. Nucleic Acids Res. 34, 1216-1223.
35. Kumekawa, M., Fukuda, G., Shimizu, S., Konno, K., and Odawara, M. (2008) Inhibition of Monocyte Chemoattractant Protein-1 by Kruppel-Like Factor 5 Small Interfering RNA in the Tumor Necrosis Factor- Alpha-Activated Human Umbilical Vein Endothelial Cells. Biol Pharm Bull. 31, 1609-1613.
36. Yang, Y., Tetreault, M. P., Yermolina, Y. A., Goldstein, B. G., and Katz, J. P. (2008) Kruppel-Like Factor 5 Controls Keratinocyte Migration Via the Integrin-Linked Kinase. J Biol Chem. 283, 18812-18820.
37. Shinoda, Y., Ogata, N., Higashikawa, A., Manabe, I., Shindo, T., Yamada, T., Kugimiya, F., Ikeda, T., Kawamura, N., Kawasaki, Y., Tsushima, K., Takeda, N., Nagai, R., Hoshi, K., Nakamura, K., Chung, U. I., and Kawaguchi, H. (2008) Kruppel-Like Factor 5 Causes Cartilage Degradation through Transactivation of Matrix Metalloproteinase 9. J Biol Chem. 283, 24682-24689.
40. Lee, M. Y., Moon, J. S., Park, S. W., Koh, Y. K., Ahn, Y. H., and Kim, K. S. (2009) KLF5 Enhances SREBP-1 Action in Androgen-Dependent Induction of Fatty Acid Synthase in Prostate Cancer Cells. Biochem J. 417, 313-322.
41. Suzuki, T., Sawaki, D., Aizawa, K., Munemasa, Y., Matsumura, T., Ishida, J., and Nagai, R. (2009) Kruppel-Like Factor 5 shows Proliferation-Specific Roles in Vascular Remodeling, Direct Stimulation of Cell Growth, and Inhibition of Apoptosis. J Biol Chem. 284, 9549-9557.
45. Nandan, M. O., McConnell, B. B., Ghaleb, A. M., Bialkowska, A. B., Sheng, H., Shao, J., Babbin, B. A., Robine, S., and Yang, V. W. (2008) Kruppel-Like Factor 5 Mediates Cellular Transformation during Oncogenic KRAS-Induced Intestinal Tumorigenesis. Gastroenterology. 134, 120-130.
46. Chen, C., Benjamin, M. S., Sun, X., Otto, K. B., Guo, P., Dong, X. Y., Bao, Y., Zhou, Z., Cheng, X., Simons, J. W., and Dong, J. T. (2006) KLF5 Promotes Cell Proliferation and Tumorigenesis through Gene Regulation and the TSU-Pr1 Human Bladder Cancer Cell Line. Int J Cancer. 118, 1346-1355.
47. Hayashi, S., Manabe, I., Suzuki, Y., Relaix, F., and Oishi, Y. (2016) Klf5 Regulates Muscle Differentiation by Directly Targeting Muscle-Specific Genes in Cooperation with MyoD in Mice. Elife. 5, 10.7554/eLife.17462.
48. Nagai, R., Suzuki, T., Aizawa, K., Miyamoto, S., Amaki, T., Kawai-Kowase, K., Sekiguchi, K. I., and Kurabayashi, M. (2001) Phenotypic Modulation of Vascular Smooth Muscle Cells: Dissection of Transcriptional Regulatory Mechanisms. Ann N Y Acad Sci. 947, 56-66; discussion 66-7.
49. McConnell, B. B., Kim, S. S., Bialkowska, A. B., Yu, K., Sitaraman, S. V., and Yang, V. W. (2011) Kruppel-Like Factor 5 Protects Against Dextran Sulfate Sodium-Induced Colonic Injury in Mice by Promoting Epithelial Repair. Gastroenterology. 140, 540-549.e2.
50. Bell, S. M., Zhang, L., Xu, Y., Besnard, V., Wert, S. E., Shroyer, N., and Whitsett, J. A. (2013) Kruppel-Like Factor 5 Controls Villus Formation and Initiation of Cytodifferentiation in the Embryonic Intestinal Epithelium. Dev Biol. 375, 128-139.
51. Li, X., He, Y., Xu, Y., Huang, X., Liu, J., Xie, M., and Liu, X. (2016) KLF5 Mediates Vascular Remodeling Via HIF-1alpha in Hypoxic Pulmonary Hypertension. Am J Physiol Lung Cell Mol Physiol. 310, L299-310.
52. Nagai, R., Shindo, T., Manabe, I., Suzuki, T., and Kurabayashi, M. (2003) KLF5/BTEB2, a Kruppel-Like Zinc-Finger Type Transcription Factor, Mediates both Smooth Muscle Cell Activation and Cardiac Hypertrophy. Adv Exp Med Biol. 538, 57-65; discussion 66.
53. Nakagawa, M., Koyanagi, M., Tanabe, K., Takahashi, K., Ichisaka, T., Aoi, T., Okita, K., Mochiduki, Y., Takizawa, N., and Yamanaka, S. (2008) Generation of Induced Pluripotent Stem Cells without Myc from Mouse and Human Fibroblasts. Nat Biotechnol. 26, 101-106.
54. Mitsui, K., Tokuzawa, Y., Itoh, H., Segawa, K., Murakami, M., Takahashi, K., Maruyama, M., Maeda, M., and Yamanaka, S. (2003) The Homeoprotein Nanog is Required for Maintenance of Pluripotency in Mouse Epiblast and ES Cells. Cell. 113, 631-642.
55. Nichols, J., Zevnik, B., Anastassiadis, K., Niwa, H., Klewe-Nebenius, D., Chambers, I., Scholer, H., and Smith, A. (1998) Formation of Pluripotent Stem Cells in the Mammalian Embryo Depends on the POU Transcription Factor Oct4. Cell. 95, 379-391.
56. Bateman, N. W., Tan, D., Pestell, R. G., Black, J. D., and Black, A. R. (2004) Intestinal Tumor Progression is Associated with Altered Function of KLF5. J Biol Chem. 279, 12093-12101.
59. Giefing, M., Wierzbicka, M., Rydzanicz, M., Cegla, R., Kujawski, M., and Szyfter, K. (2008) Chromosomal Gains and Losses Indicate Oncogene and Tumor Suppressor Gene Candidates in Salivary Gland Tumors. Neoplasma. 55, 55-60.
60. Kwak, M. K., Lee, H. J., Hur, K., Park, D. J., Lee, H. S., Kim, W. H., Lee, K. U., Choe, K. J., Guilford, P., and Yang, H. K. (2008) Expression of Kruppel-Like Factor 5 in Human Gastric Carcinomas. J Cancer Res Clin Oncol. 134, 163-167.
63. Tong, D., Czerwenka, K., Heinze, G., Ryffel, M., Schuster, E., Witt, A., Leodolter, S., and Zeillinger, R. (2006) Expression of KLF5 is a Prognostic Factor for Disease-Free Survival and overall Survival in Patients with Breast Cancer. Clin Cancer Res. 12, 2442-2448.
64. Fang, W., Li, X., Jiang, Q., Liu, Z., Yang, H., Wang, S., Xie, S., Liu, Q., Liu, T., Huang, J., Xie, W., Li, Z., Zhao, Y., Wang, E., Marincola, F. M., and Yao, K. (2008) Transcriptional Patterns, Biomarkers and Pathways Characterizing Nasopharyngeal Carcinoma of Southern China. J Transl Med. 6, 32-5876-6-32.
65. Bloethner, S., Chen, B., Hemminki, K., Muller-Berghaus, J., Ugurel, S., Schadendorf, D., and Kumar, R. (2005) Effect of Common B-RAF and N-RAS Mutations on Global Gene Expression in Melanoma Cell Lines. Carcinogenesis. 26, 1224-1232.
66. Wu, F., Dassopoulos, T., Cope, L., Maitra, A., Brant, S. R., Harris, M. L., Bayless, T. M., Parmigiani, G., and Chakravarti, S. (2007) Genome-Wide Gene Expression Differences in Crohn's Disease and Ulcerative Colitis from Endoscopic Pinch Biopsies: Insights into Distinctive Pathogenesis. Inflamm Bowel Dis. 13, 807-821.
68. Wan, H., Luo, F., Wert, S. E., Zhang, L., Xu, Y., Ikegami, M., Maeda, Y., Bell, S. M., and Whitsett, J. A. (2008) Kruppel-Like Factor 5 is Required for Perinatal Lung Morphogenesis and Function. Development. 135, 2563-2572.
69. Shahrin, N. H., Diakiw, S., Dent, L. A., Brown, A. L., and D'Andrea, R. J. (2016) Conditional Knockout Mice Demonstrate Function of Klf5 as a Myeloid Transcription Factor. Blood. 128, 55-59.
70. Kenchegowda, D., Swamynathan, S., Gupta, D., Wan, H., Whitsett, J., and Swamynathan, S. K. (2011) Conditional Disruption of Mouse Klf5 Results in Defective Eyelids with Malformed Meibomian Glands, Abnormal Cornea and Loss of Conjunctival Goblet Cells. Dev Biol. 356, 5-18.
71. Sur, I., Rozell, B., Jaks, V., Bergstrom, A., and Toftgard, R. (2006) Epidermal and Craniofacial Defects in Mice Overexpressing Klf5 in the Basal Layer of the Epidermis. J Cell Sci. 119, 3593-3601.
|
Science Writers | Anne Murray |
Illustrators | Diantha La Vine |
Authors | Emre Turer, Kuan-Wen Wang, William McAlpine, and Bruce Beutler |