Phenotypic Mutation 'sooni' (pdf version)
Allelesooni
Mutation Type missense
Chromosome19
Coordinate41,327,909 bp (GRCm38)
Base Change A ⇒ G (forward strand)
Gene Pik3ap1
Gene Name phosphoinositide-3-kinase adaptor protein 1
Synonym(s) BCAP, 1810044J04Rik
Chromosomal Location 41,274,218-41,385,070 bp (-)
MGI Phenotype PHENOTYPE: Mice homozygous for disruptions in this gene have abnormalities in B cell maturation. [provided by MGI curators]
Accession Number

NCBI Refseq: NM_031376.3; MGI:1933177

Mapped Yes 
Limits of the Critical Region 41274218 - 41385070 bp
Amino Acid Change Serine changed to Proline
Institutional SourceBeutler Lab
Gene Model predicted gene model for protein(s): [ENSMUSP00000052777]
SMART Domains Protein: ENSMUSP00000052777
Gene: ENSMUSG00000025017
AA Change: S305P

DomainStartEndE-ValueType
DBB 180 319 8.55e-75 SMART
SCOP:d1bd8__ 331 396 8e-5 SMART
Blast:ANK 336 365 1e-7 BLAST
low complexity region 533 552 N/A INTRINSIC
low complexity region 716 740 N/A INTRINSIC
low complexity region 802 808 N/A INTRINSIC
Predicted Effect probably damaging

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
(Using ENSMUST00000059672)
Meta Mutation Damage Score 0.9099 question?
Is this an essential gene? Non Essential (E-score: 0.000) question?
Phenotypic Category
Phenotypequestion? Literature verified References
FACS B1a cells in B1 cells - decreased 12833156
FACS B1b cells in B1 cells - increased
T-independent B cell response defect- decreased TNP-specific IgM to TNP-Ficoll immunization
Candidate Explorer Status CE: excellent candidate; human score: -0.5; ML prob: 0.556
Single pedigree
Linkage Analysis Data
Penetrance  
Alleles Listed at MGI

All Mutations and Alleles(6) :  Chemically induced (ENU)(2) Targeted(4)

Lab Alleles
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01412:Pik3ap1 APN 19 41375890 missense possibly damaging 0.95
IGL01697:Pik3ap1 APN 19 41324579 missense probably damaging 1.00
IGL01743:Pik3ap1 APN 19 41292828 splice site probably benign
IGL02006:Pik3ap1 APN 19 41302593 missense probably benign
IGL02507:Pik3ap1 APN 19 41282012 splice site probably benign
IGL02601:Pik3ap1 APN 19 41302442 missense probably benign 0.08
Pintail UTSW 19 41376146 missense probably benign 0.00
sothe UTSW 19 41356683 intron probably benign
FR4449:Pik3ap1 UTSW 19 41281946 small insertion probably benign
FR4548:Pik3ap1 UTSW 19 41281945 small insertion probably benign
FR4976:Pik3ap1 UTSW 19 41281945 small insertion probably benign
R0504:Pik3ap1 UTSW 19 41287490 missense probably damaging 1.00
R0505:Pik3ap1 UTSW 19 41324564 missense probably damaging 1.00
R0736:Pik3ap1 UTSW 19 41332319 missense possibly damaging 0.56
R0926:Pik3ap1 UTSW 19 41302525 missense probably benign 0.00
R1521:Pik3ap1 UTSW 19 41321558 missense probably damaging 1.00
R1681:Pik3ap1 UTSW 19 41308529 missense probably damaging 1.00
R1779:Pik3ap1 UTSW 19 41332234 missense probably damaging 1.00
R1924:Pik3ap1 UTSW 19 41302614 missense possibly damaging 0.79
R1945:Pik3ap1 UTSW 19 41274337 missense probably benign
R2327:Pik3ap1 UTSW 19 41296389 missense probably damaging 0.99
R2891:Pik3ap1 UTSW 19 41376061 missense probably benign 0.00
R2892:Pik3ap1 UTSW 19 41376061 missense probably benign 0.00
R2893:Pik3ap1 UTSW 19 41376061 missense probably benign 0.00
R2894:Pik3ap1 UTSW 19 41376061 missense probably benign 0.00
R2918:Pik3ap1 UTSW 19 41302531 missense probably benign 0.00
R4424:Pik3ap1 UTSW 19 41375881 missense probably benign 0.00
R4654:Pik3ap1 UTSW 19 41327909 missense probably damaging 1.00
R4811:Pik3ap1 UTSW 19 41302497 missense possibly damaging 0.67
R4855:Pik3ap1 UTSW 19 41327845 missense probably benign 0.13
R4885:Pik3ap1 UTSW 19 41375926 missense probably benign 0.28
R5119:Pik3ap1 UTSW 19 41281976 missense probably benign 0.18
R5261:Pik3ap1 UTSW 19 41376106 missense probably damaging 1.00
R5274:Pik3ap1 UTSW 19 41281952 missense possibly damaging 0.67
R5655:Pik3ap1 UTSW 19 41298241 missense possibly damaging 0.65
R5862:Pik3ap1 UTSW 19 41332345 missense probably damaging 1.00
R5924:Pik3ap1 UTSW 19 41296456 missense probably damaging 1.00
R6015:Pik3ap1 UTSW 19 41328201 missense probably benign 0.22
R6018:Pik3ap1 UTSW 19 41385016 start gained probably benign
R6515:Pik3ap1 UTSW 19 41376146 missense probably benign 0.00
R6792:Pik3ap1 UTSW 19 41321626 missense probably benign 0.14
R7135:Pik3ap1 UTSW 19 41332321 missense probably damaging 1.00
R7162:Pik3ap1 UTSW 19 41321526 missense probably benign 0.03
R7175:Pik3ap1 UTSW 19 41287490 missense probably damaging 0.98
R7313:Pik3ap1 UTSW 19 41296376 missense possibly damaging 0.93
R7664:Pik3ap1 UTSW 19 41321630
Mode of Inheritance Autosomal Recessive
Local Stock Sperm
Repository
Last Updated 2019-09-04 9:42 PM by Diantha La Vine
Record Created 2016-08-26 6:27 PM by Jin Huk Choi
Record Posted 2016-12-13
Phenotypic Description

Figure 1. Sooni mice exhibit diminished T-independent IgM responses to NP-Ficoll. IgM levels were determined by ELISA. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The sooni phenotype was identified among N-ethyl-N-nitrosourea (ENU)-mutagenized G3 mice of the pedigree R4654, some of which exhibited a diminished T-independent antibody (IgM) response to NP-Ficoll (Figure 1).

Nature of Mutation

Figure 2. Linkage mapping of the reduced T-independent response to NP-Ficoll using a recessive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 97 mutations (X-axis) identified in the G1 male of pedigree R4654. Normalized phenotype data are shown for single locus linkage analysis without consideration of G2 dam identity. Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 97 mutations. The diminished T-independent antibody (IgM) response to NP-Ficoll was linked to a mutation in Pik3ap1: a T to C transition at base pair 41,327,909 (v38) on chromosome 19, or base pair 57,162 in the GenBank genomic region NC_000085 encoding Pik3ap1. Linkage was found with a recessive model of inheritance, wherein seven variant homozygotes departed phenotypically from 11 homozygous reference mice and 19 heterozygous mice with a P value of 2.4 x 10-5 (Figure 2). A substantial semidominant effect was also observed (P = 4.06 x 10-5).

 

The mutation corresponds to residue 1,014 in the NM_031376.3 mRNA sequence in exon 6 of 17 total exons. 


 

999 AAACTGCTCACCGAGTCCCTGAAGAACAACATC

300 -K--L--L--T--E--S--L--K--N--N--I-

 

The mutated nucleotide is indicated in red.  The mutation results in a serine (S) to proline (P) substitution at position 305 (S305P) in the B cell adaptor protein (BCAP) protein, and is strongly predicted by PolyPhen-2 to be damaging (score = 0.999).

Protein Prediction

Figure 3. The domain structure of BCAP.  BCAP has a Dof/BCAP/BANK (DBB) domain (aa 182-318), an ankyrin repeat-like sequence (aa 333-401), a coiled-coil sequence (aa 636-669), and proline-rich sequences (aa 530-552, 760-808).  Tyrosinses within YxNx (Y387), YxxV (Y513) and YxxM (Y264, Y420, Y445 and Y460) sequences are phosphorylated upon B-cell receptor activation and facilitate the binding of BCAP to Grb2, SHP-2 and BTK/Syk, respectively.  The sooni mutation is a serine (S) to proline (P) substitution at position 305 (S305P). This image is interactive. Other mutations found in BCAP are noted in red. Click on each mutation for more information.

BCAP shares several structural features with other adaptor proteins including BANK (B-cell scaffold protein with ankyrin repeats), an adaptor for CD40, a protein present on antigen presenting cells (see walla, a mutation in CD40 ligand) and with the Drosophila protein Dof (Downstream of FGF receptor), an adaptor that is essential in FGF-mediated signaling (1;2). The domains of BCAP include:  an ankyrin repeat-like sequence (aa 333-401), a predicted coiled-coil forming sequence (aa 636-669), proline-rich sequences (3 in mouse; aa 530-552, 760-808) and a region designated the Dof/BCAP/BANK (DBB) domain (aa 182-318) (3-6) (Figure 3). The proline-rich region at the C-terminus of BCAP facilitates interaction between BCAP and the N-terminal SH3 domains of Src protein tyrosine kinases (PTKs), PLC-γ, and Grb2 (7).  Tyrosine motifs (YxNx, YxxV, and YxxM) facilitate the binding of BCAP to Grb2, SHP-2 and BTK/Syk, respectively.  Following B cell activation, BCAP is phosphorylated at four tyrosine residues (Y264, Y420, Y445 and Y460) within 4 respective YxxM motifs by BTK and Syk activation (3;8;9)

 

The sooni mutation results in a serine (S) to proline (P) substitution at position 305 (S305P); residue 305 is within the DBB domain. The function DBB domain remains unknown. The DBB domain may be important for the subcellular localization of BCAP through interactions with other proteins (7).  In Drosophila development, the DBB domain of Dof was required for FGF-dependent signal transduction (4). In yeast two-hybrid assays, the DBB domain was required for Dof to interact with the Drosophila FGF receptor, Heartless, and for Dof to homodimerize (3)

 

For more information about Pik3ap1, please see the record for sothe.

Putative Mechanism

In B cell receptor (BCR)-mediated signaling, either transmembrane (i.e. CD19) or cytosolic adaptors (i.e. TC21, Cbl, Gab, B-cell linker (BLNK (see busy) or SLP-65), and BCAP are tyrosine phosphorylated on their YxxM motifs by protein tyrosine kinases (i.e. Btk, Syk and/or Lyn) and subsequently associate with PI3K to amplify and integrate several signaling pathways (6;7;10-13).  Upon activation of BCR-mediated signaling, Syk initiates BCAP phosphorylation, while Btk sustains it.  Lyn negatively regulates BCAP phosphorylation by initiating the phosphorylation of immunoreceptor tyrosine-based inhibition motifs (ITIMS) on inhibitory receptor proteins CD22 and PIRB (7;14).  BCAP and CD19 have a complementary role in P13K activation:  upon BCAP binding to PI3K, there is an upregulation in PI3K activity and PI3K translocates to CD19-bearing lipid rafts rich in PI(4,5)P2 (15;16)

 

The canonical Pik3ap1 variant, negatively regulates interleukin (IL)-6 (a pro-inflammatory cytokine) and IL-10 (an anti-inflammatory cytokine) production mediated by lipopolysaccharides in T cell-independent B cell immune responses (8). Similar to sothe and BCAP deficient mice, the sooni mice are unable to mount a T-independent B cell response (6). Similarity between the sooni and BCAP-deficient phenotypes is consistent with a strongly hypomorphic or null effect of S305P.

Primers PCR Primer
sooni_pcr_F: TGTGTCATGGCAGCAGCATC
sooni_pcr_R: AGGAGAAGACCCGAGCTTTC

Sequencing Primer
sooni_seq_F: ATGGCAGCAGCATCCTCCTATG
sooni_seq_R: AAGACCCGAGCTTTCTGGACATG
Genotyping

PCR program

1) 94°C 2:00
2) 94°C 0:30
3) 55°C 0:30
4) 72°C 1:00
5) repeat steps (2-4) 40x
6) 72°C 10:00
7) 4°C hold


The following sequence of 408 nucleotides is amplified (chromosome 19, - strand):


1   aggagaagac ccgagctttc tggacatggg aattgtacat ggggctattc agctttaacc
61  ttgactggca ggcgctagct ggatttgaaa cctgaccgtc ttcactgttt tatgtaggcc
121 tttaaaatcg tgccctacaa cacagagact ctcgataaac tgctcaccga gtccctgaag
181 aacaacatcc ccgcaagtgg actgcacctc tttgggatca accaactgga agaagacgat
241 atgatgacaa gtatgtcagc ggtcatttca gtcgtagatg gtgtggcctg ccacacaact
301 gggccatgtg atctggggag ggcatagctt catccgccag caccaaggtg aaccgaaaga
361 caggattaaa ctaagcaaca cataggagga tgctgctgcc atgacaca


Primer binding sites are underlined and the sequencing primers are highlighted; the mutated nucleotide is shown in red.

References
Science Writers Anne Murray
Illustrators Katherine Timer
AuthorsJin Huk Choi, James Butler, Bruce Beutler