Phenotypic Mutation 'nibbler' (pdf version)
List |< first << previous [record 12 of 74] next >> last >|
Allelenibbler
Mutation Type critical splice donor site
Chromosome10
Coordinate77,561,216 bp (GRCm38)
Base Change G ⇒ A (forward strand)
Gene Itgb2
Gene Name integrin beta 2
Synonym(s) Mac-1 beta, Cd18, 2E6
Chromosomal Location 77,530,252-77,565,708 bp (+)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an integrin beta chain, which combines with multiple different alpha chains to form different integrin heterodimers. Integrins are integral cell-surface proteins that participate in cell adhesion as well as cell-surface mediated signalling. The encoded protein plays an important role in immune response and defects in this gene cause leukocyte adhesion deficiency. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2014]
PHENOTYPE: Homozygotes for targeted null and hypomorphic mutations are subject to granulocytosis, impaired inflammatory and immune responses, and chronic dermatitis. [provided by MGI curators]
Accession Number

NCBI RefSeq: NM_008404; MGI: 96611

Mapped Yes 
Limits of the Critical Region 77530252 - 77565708 bp
Amino Acid Change
Institutional SourceBeutler Lab
Gene Model predicted gene model for protein(s): [ENSMUSP00000000299] [ENSMUSP00000137734] [ENSMUSP00000137865]
SMART Domains Protein: ENSMUSP00000000299
Gene: ENSMUSG00000000290

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
PSI 24 74 6.91e-7 SMART
INB 32 447 1.98e-268 SMART
VWA 126 357 1.25e-1 SMART
internal_repeat_1 459 509 7.99e-5 PROSPERO
EGF_like 535 574 6.81e1 SMART
Integrin_B_tail 622 701 5.53e-22 SMART
transmembrane domain 702 724 N/A INTRINSIC
Integrin_b_cyt 725 770 1.58e-17 SMART
Predicted Effect probably null
SMART Domains Protein: ENSMUSP00000137734
Gene: ENSMUSG00000000290

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
PSI 24 74 6.91e-7 SMART
INB 32 447 1.98e-268 SMART
VWA 126 357 1.25e-1 SMART
Predicted Effect probably benign
SMART Domains Protein: ENSMUSP00000137865
Gene: ENSMUSG00000000290

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
PDB:2P28|A 23 49 9e-12 PDB
Blast:PSI 24 49 2e-11 BLAST
Predicted Effect probably benign
Phenotypic Category
Phenotypequestion? Literature verified References
CD8 response - decreased
CTL killing - decreased
CTL killing dominant epitope - decreased
FACS B cells - decreased
FACS B:T cells - decreased
FACS B1b cells - increased
FACS CD11b+ DCs (gated in CD11c+ cells) - decreased
FACS CD4:CD8 - increased
FACS CD4+ T cells - decreased
FACS CD4+ T cells in CD3+ T cells - decreased
FACS CD44+ T MFI - increased
FACS CD8+ T cells - decreased
FACS CD8+ T cells in CD3+ T cells - decreased
FACS effector memory CD4 T cells in CD4 T cells - increased
FACS IgD+ B cell percentage - decreased
FACS IgM+ B cells - decreased
FACS macrophages - decreased
FACS naive CD4 T cells in CD4 T cells - decreased
FACS naive CD8 T cells in CD8 T cells - decreased
FACS neutrophils - decreased
NK cell response - decreased
NK killing - decreased
total IgE level - increased
Penetrance  
Alleles Listed at MGI

All Mutations and Alleles(11) : Chemically induced (ENU)(1) Chemically induced (other)(1) Targeted(9)

Lab Alleles
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00332:Itgb2 APN 10 77557406 missense probably damaging 1.00
IGL00427:Itgb2 APN 10 77557956 missense probably benign 0.13
IGL00500:Itgb2 APN 10 77564724 missense probably damaging 1.00
IGL01019:Itgb2 APN 10 77542403 missense possibly damaging 0.94
IGL01104:Itgb2 APN 10 77547194 splice site probably null
IGL01111:Itgb2 APN 10 77542000 missense probably damaging 0.98
IGL01574:Itgb2 APN 10 77557964 missense possibly damaging 0.82
IGL02087:Itgb2 APN 10 77559696 missense possibly damaging 0.94
IGL02132:Itgb2 APN 10 77550061 missense probably damaging 1.00
IGL02325:Itgb2 APN 10 77547192 missense probably damaging 1.00
IGL02505:Itgb2 APN 10 77547218 missense probably damaging 1.00
IGL02590:Itgb2 APN 10 77559513 missense probably damaging 1.00
IGL02735:Itgb2 APN 10 77549999 missense possibly damaging 0.81
Joker UTSW 10 77549849 critical splice acceptor site
newhome UTSW 10 77559681 missense probably benign 0.00
R0217:Itgb2 UTSW 10 77548536 splice site probably benign
R0394:Itgb2 UTSW 10 77542475 missense probably damaging 1.00
R0396:Itgb2 UTSW 10 77561189 missense probably damaging 0.97
R1425:Itgb2 UTSW 10 77547296 missense probably null 1.00
R1499:Itgb2 UTSW 10 77546153 missense possibly damaging 0.62
R1542:Itgb2 UTSW 10 77559486 missense probably benign
R1803:Itgb2 UTSW 10 77564790 missense probably benign 0.15
R1889:Itgb2 UTSW 10 77548623 missense possibly damaging 0.74
R2035:Itgb2 UTSW 10 77547199 missense probably damaging 1.00
R2156:Itgb2 UTSW 10 77560248 missense probably benign 0.01
R2374:Itgb2 UTSW 10 77559681 missense probably benign 0.00
R3769:Itgb2 UTSW 10 77549968 missense possibly damaging 0.80
R3942:Itgb2 UTSW 10 77558033 missense probably benign 0.31
R4352:Itgb2 UTSW 10 77556167 missense probably benign 0.10
R4537:Itgb2 UTSW 10 77561216 critical splice donor site probably null
R4600:Itgb2 UTSW 10 77546115 missense probably benign
R4611:Itgb2 UTSW 10 77550050 missense probably damaging 1.00
R4685:Itgb2 UTSW 10 77550103 critical splice donor site probably null
R4717:Itgb2 UTSW 10 77546044 nonsense probably null
R5068:Itgb2 UTSW 10 77548761 missense probably damaging 1.00
R5297:Itgb2 UTSW 10 77564667 missense probably damaging 1.00
R5355:Itgb2 UTSW 10 77558052 missense probably benign
R5927:Itgb2 UTSW 10 77546034 missense probably damaging 1.00
R6371:Itgb2 UTSW 10 77548597 missense probably damaging 1.00
R6505:Itgb2 UTSW 10 77559673 missense probably damaging 1.00
Mode of Inheritance Autosomal Recessive
Local Stock
Repository
Last Updated 2018-09-18 3:36 PM by Anne Murray
Record Created 2016-09-02 3:07 PM by Evan Nair-Gill
Record Posted 2018-06-13
Phenotypic Description
Figure 1. Nibbler mice exhibited reduced CTL cytotoxicity. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 2. Nibbler mice exhibited reduced NK cytotoxicity. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 3. Homozygous nibbler mice exhibit diminished T-dependent IgG responses to recombinant Semliki Forest virus (rSFV)-encoded β-galactosidase (rSFV-β-gal). IgG levels were determined by ELISA. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 4. Nibbler mice exhibit reduced B to T cell ratios. Flow cytometric analysis of peripheral blood was utilized to determine B and T cell frequencies. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 5. Nibbler mice exhibit increased CD4 to CD8 T cell ratios. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequencies. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 6. Nibbler mice exhibit decreased frequencies of peripheral B cells. Flow cytometric analysis of peripheral blood was utilized to determine B cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 7. Nibbler mice exhibit decreased frequencies of peripheral IgD+ B cells. Flow cytometric analysis of peripheral blood was utilized to determine B cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 8. Nibbler mice exhibit decreased frequencies of peripheral IgM+ B cells. Flow cytometric analysis of peripheral blood was utilized to determine B cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 9. Nibbler mice exhibit decreased frequencies of peripheral CD4+ T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 10. Nibbler mice exhibit decreased frequencies of peripheral CD4+ T cells in CD3+ T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 11. Nibbler mice exhibit decreased frequencies of peripheral CD8+ T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 12. Nibbler mice exhibit decreased frequencies of peripheral CD8+ T cells in CD3+ T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 13. Nibbler mice exhibit decreased frequencies of peripheral naive CD4 T cells in CD4 T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 14. Nibbler mice exhibit decreased frequencies of peripheral naive CD8 T cells in CD8 T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 15. Nibbler mice exhibit decreased frequencies of peripheral macrophages. Flow cytometric analysis of peripheral blood was utilized to determine macrophage frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 16. Nibbler mice exhibit decreased frequencies of peripheral neutrophils. Flow cytometric analysis of peripheral blood was utilized to determine neutrophil frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 17. Nibbler mice exhibit decreased frequencies of peripheral CD11b+ DCs. Flow cytometric analysis of peripheral blood was utilized to determine DC frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 18. Nibbler mice exhibit increased frequencies of peripheral CD8a+ DCs. Flow cytometric analysis of peripheral blood was utilized to determine DC frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 19. Nibbler mice exhibit increased frequencies of peripheral NK T cells. Flow cytometric analysis of peripheral blood was utilized to determine NK T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 20. Nibbler mice exhibit increased frequencies of peripheral effector memory CD4 T cells in CD4 T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 21. Nibbler mice exhibit increased frequencies of peripheral effector memory CD8 T cells in CD8 T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 22. Nibbler mice exhibit increased expression of CD44 on peripheral blood T cells. Flow cytometric analysis of peripheral blood was utilized to determine CD44 MFI. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 23. Nibbler mice exhibit increased expression of CD44 on peripheral blood CD4+ T cells. Flow cytometric analysis of peripheral blood was utilized to determine CD44 MFI. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 24. Nibbler mice exhibit increased levels of total IgE in the serum. IgE levels were determined by ELISA. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The nibbler phenotype was identified among G3 mice of the pedigree R4537, some of which showed reduced cytotoxic T lymphocyte killing (Figure 1), and reduced natural killer cell killing (Figure 2). The T-dependent antibody response to recombinant Semliki Forest virus (rSFV)-encoded β-galactosidase (rSFV-β-gal) was diminished (Figure 3). Some mice showed reduced B to T cell ratios (Figure 4) and increased CD4 to CD8 T cell ratios (Figure 5). The mice showed reduced frequencies of B cells (Figure 6), IgD+ B cells (Figure 7), IgM+ B cells (Figure 8), CD4+ T cells (Figure 9), CD4+ T cells in CD3+ T cells (Figure 10), CD8+ T cells (Figure 11), CD8+ T cells in CD3+ T cells (Figure 12), naïve CD4 T cells in CD4+ T cells (Figure 13), naïve CD8 T cells in CD8+ T cells (Figure 14), macrophages (Figure 15), neutrophils (Figure 16), and CD11b+ dendritic cells (gated in CD11c+ cells) (Figure 17) with concomitant increased frequencies of CD8a+ dendritic cells (gated in CD11c+ cells) (Figure 18), NK T cells (Figure 19), effector memory CD4 T cells in CD4+ T cells (Figure 20), and effector memory CD8 T cells in CD8+ T cells (Figure 21), all in the peripheral blood. Some mice showed increased expression of CD44 on peripheral blood T cells (Figure 22) and CD4+ T cells (Figure 23). Some mice also showed increased levels of total IgE in the serum (Figure 24).

Nature of Mutation
Figure 4. Linkage mapping of the reduced CD8+ T cells in CD3+ T cell frequency using a recessive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 43 mutations (X-axis) identified in the G1 male of pedigree R4537. Normalized phenotype data are shown for single locus linkage analysis without consideration of G2 dam identity. Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 43 mutations. All of the above anomalies were linked by continuous variable mapping to a mutation in Itgb2:  a G to A transition at base pair 77,561,216 (v38) on chromosome 10, or base pair 30,888 in the GenBank genomic region NC_000076 within the donor splice site of intron 14. The strongest association was found with a recessive model of inheritance to the reduced frequency of CD8+ T cells in CD3+ T cells, wherein two variant homozygotes departed phenotypically from 11 homozygous reference mice and 14 heterozygous mice with a P value of 5.67 x 10-17 (Figure 25).  

 

The effect of the mutation at the cDNA and protein level have not examined, but the mutation is predicted to result in the use of a cryptic site in intron 14, resulting in an 80-base pair insertion of intron 14. This predicts a frame shifted protein product beginning after amino acid 694 of the protein, which is normally 770 amino acids in length, and terminating after the inclusion of 9 aberrant amino acids.

 

C57BL/6J:

         <--exon 13      <--exon 14 intron 14-->            <--exon 15-->

30034 ……GACAACCACAC ……GAGGACAGTCTAG gtgaggctgggtggt…… AGTGTGTGAAG……GCTGAAAGCTAG 34912
624   ……-D--N--H--T ……-E--D--S--L--                   E--C--V--K-……-A--E--S--*- 770

 

Genomic numbering corresponds to NC_000076. The donor splice site of intron 14, which is destroyed by the nibbler mutation, is indicated in blue lettering and the mutated nucleotide is indicated in red. 

Protein Prediction

Figure 26. Domain structure of α and β integrins. Some α subunits do not contain an I domain. The β-propeller and I-like domains make numerous contacts in the native integrin dimer. The location of the nibbler mutation is indicated. Abbreviations: HD, hybrid domain; TM, transmembrane domain. This image is interactive. Click on the image to view other mutations found in CD18. Click on the mutations for more specific information.

The Itgb2 gene encodes the integrin β2 protein (also called CD18), which forms noncovalently linked dimers with integrin α subunits to form functional integrin receptors. The extracellular domains of integrin α and β subunits are >940 and >640 residues, respectively, but the intracellular domains are much shorter, about 50 residues. The shape of the integrin receptor extracellular domain, as determined by electron microscopy, is a globular ligand-binding headpiece connected to two long stalk regions, connected to the transmembrane and C-terminal cytoplasmic domains. Integrin β2 is a cysteine-rich single pass transmembrane protein with six N-linked extracellular glycosylation sites (Figure 26) [reviewed in (1)]. The N-terminal cysteine-rich region (residues ~1-50) of the integrin β2 extracellular domain is called a PSI (plexins, semaphorins, integrins) domain, and shares homology with the membrane proteins plexins, semaphorins and the c-met receptor. Residues ~100-340 contain a von Willebrand factor-type A domain of 241 amino acids, which is referred to as the inserted (I) domain in α subunits and I-like domain in β subunits. The C-terminal portion of the extracellular domain is the “stalk” region, which contains four EGF-like domains (integrin-EGF, I-EGF) and a tail domain connecting it to the membrane.

 

The nibbler mutation is predicted to result in the use of a cryptic site in intron 14, resulting in an 80-base pair insertion of intron 14.

 

For more information about Itgb2, please see the record for Joker.

Putative Mechanism

Integrins are adhesion molecules that mediate cell-cell, cell-extracellular matrix, and cell-pathogen interactions. They regulate cell migration and morphogenesis by coordinating regulatory signals from inside and outside the cell, with the physical machinery for cell movement. Most integrins, including β2-integrins, link to and regulate the actin cytoskeleton. The β2-containing integrins are αLβ2 (CD11aCD18; also called leukocyte function-associated antigen 1, LFA-1), αMβ2 (CD11bCD18; also called MAC-1), αXβ2 (CD11cCD18; also called p150,95) and αDβ2 (CD11dCD18). The CD11/CD18 integrins are referenced collectively as the “leukocyte” integrins, and mediate leukocyte adhesion during inflammatory responses to infections and also during wound repair.

 

Two integrin β2 mutant mice have been developed. One strain contains a hypomorphic allele (Itgb2tm1Bay) of integrin β2 (2). These animals exhibit elevated total numbers of leukocytes, including granulocytes and lymphocytes, as well as an impaired inflammatory response to intraperitoneal injection of thioglycolate medium (slightly fewer numbers of neutrophils migrate into the peritoneal cavity). The second integrin β2 mutant strain contains a null allele (Itgb2tm2Bay(3), and exhibits a phenotype very similar to that of human patients with leukocyte adhesion deficiency (LAD, OMIM #116920), an autosomal recessive disorder characterized by leukocytosis (especially neutrophilia), failure to recruit leukocytes to sites of infection, recurring bacterial and fungal infections involving the skin and mucosa, impaired wound healing, and lack of pus formation.

 

Nibbler mice display a phenotype distinct from that of the CD18 null or hypomorphic mutant, and from humans with LAD. In particular, nibbler mice do not develop the dermatitis or facial/submandibular inflammation observed in CD18-/- mice. Spontaneous infections have not been observed in nibbler mice, as they are in the CD18 null mutant and in LAD patients.

Primers PCR Primer
nibbler(F):5'- AGGGCCCTTTTGAGAAGAAC -3'
nibbler(R):5'- TTCATCTCCTCATACAGGGCCG -3'

Sequencing Primer
nibbler_seq(F):5'- GGCCCTTTTGAGAAGAACTGTAG -3'
nibbler_seq(R):5'- CTCATACAGGGCCGGGTAAG -3'
References
Science Writers Anne Murray
Illustrators Diantha La Vine
AuthorsEvan Nair-Gill, Jin Huk Choi, James Butler, and Bruce Beutler
List |< first << previous [record 12 of 74] next >> last >|