Phenotypic Mutation 'posey'

• Allele: posey
• Mutation Type: missense
• Chromosome: 8
• Coordinate: 10,022,955 bp (GRCm39)
• Base Change: T ⇒ C (forward strand)
• Gene: Lig4
• Gene Name: ligase IV, DNA, ATP-dependent
• Synonym(s): DNA ligase IV, tiny, 5830471N16Rik
• Chromosomal Location: 10,020,020-10,027,680 bp (-) (GRCm39)
• MGI Phenotype: FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a DNA ligase that joins single-strand breaks in a double-stranded polydeoxynucleotide in an ATP-dependent reaction. This protein is essential for V(D)J recombination and DNA double-strand break (DSB) repair through nonhomologous end joining (NHEJ). This protein forms a complex with the X-ray repair cross complementing protein 4 (XRCC4), and further interacts with the DNA-dependent protein kinase (DNA-PK). Both XRCC4 and DNA-PK are known to be required for NHEJ. The crystal structure of the complex formed by this protein and XRCC4 has been resolved. Defects in this gene are the cause of LIG4 syndrome. Alternatively spliced transcript variants encoding the same protein have been observed. [provided by RefSeq, Jul 2008] ; PHENOTYPE: Null homozygotes die late in gestation with extensive CNS apoptosis, blocked lymphopoeiesis and failure of V(D)J joining. Carrier fibroblasts show elevated chromosome breaks. ~40% of homozygous hypomorphs survive, with retarded growth, reduced PBL and progressive loss of hematopoietic stem cells. [provided by MGI curators]
• Mapped: Yes
• Limits of the Critical Region: 9970020 - 9970020 bp
• Amino Acid Change: Aspartic acid changed to Glycine
• Institutional Source: Beutler Lab
• Gene Model: predicted gene model for protein(s): [ENSMUSP00000093130] [ENSMUSP00000130807]
• AlphaFold: Q8BTF7
• SMART Domains: Protein: ENSMUSP00000093130; Gene: ENSMUSG00000049717; AA Change: D275G

Domain	Start	End	E-Value	Type
Pfam:DNA_ligase_A_N	14	209	1.3e-43	PFAM
Pfam:DNA_ligase_A_M	248	451	2e-50	PFAM
Pfam:DNA_ligase_A_C	476	588	3.3e-16	PFAM
BRCT	656	733	2.8e-14	SMART
Pfam:DNA_ligase_IV	749	784	7.3e-21	PFAM
BRCT	816	901	1.6e-5	SMART

• Predicted Effect: probably damaging ; PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
  (Using ENSMUST00000095476)
• SMART Domains: Protein: ENSMUSP00000130807; Gene: ENSMUSG00000049717; AA Change: D275G

Domain	Start	End	E-Value	Type
Pfam:DNA_ligase_A_N	15	208	8.8e-39	PFAM
Pfam:DNA_ligase_A_M	248	451	2.3e-52	PFAM
Pfam:DNA_ligase_A_C	476	588	4.8e-18	PFAM
BRCT	656	733	2.9e-14	SMART
Pfam:DNA_ligase_IV	750	783	5.5e-17	PFAM
BRCT	816	901	1.6e-5	SMART

• Predicted Effect: probably damaging ; PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
  (Using ENSMUST00000170033)
• Meta Mutation Damage Score: 0.9620
• Is this an essential gene?: Essential (E-score: 1.000)
• Phenotypic Category: Autosomal Recessive
• Mode of Inheritance: Autosomal Recessive
• Last Updated: 2019-12-05 10:44 AM by External Program
• Record Created: 2016-09-14 11:21 PM by Jin Huk Choi
• Record Posted: 2018-12-18
• Science Writers: Anne Murray
• Illustrators: Diantha La Vine
• Authors: Jin Huk Choi, Xue Zhong, James Butler, Zhao Zhang, Xiaoyu Wang, and Bruce Beutler

Accession Number

NCBI RefSeq: NM_176953; MGI:1335098

Alleles Listed at MGI

All Mutations and Alleles(11) Chemically induced (ENU)(1) Gene trapped(4) Targeted(6)

Phenotypic Description

Figure 1. Posey mice exhibit decreased frequencies of peripheral B cells. Flow cytometric analysis of peripheral blood was utilized to determine B cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 2. Posey mice exhibit decreased frequencies of peripheral IgD+ B cells. Flow cytometric analysis of peripheral blood was utilized to determine B cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 3. Posey mice exhibit decreased frequencies of peripheral IgM+ B cells. Flow cytometric analysis of peripheral blood was utilized to determine B cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 4. Posey mice exhibit reduced expression of IgD on peripheral B cells. Flow cytometric analysis of peripheral blood was utilized to determine IgD MFI. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 5. Posey mice exhibit a reduced CD4 to CD8 T cell ratio. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 6. Posey mice exhibit decreased frequencies of peripheral CD4+ T cells in CD3+ T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 7. Posey mice exhibit decreased frequencies of peripheral naive CD4+ T cells in CD4+ T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 8. Posey mice exhibit decreased frequencies of peripheral naive CD8+ T cells in CD8+ T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 9. Posey mice exhibit increased frequencies of peripheral CD44+ CD8 T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 10. Posey mice exhibit increased frequencies of peripheral CD8+ T cells in CD3+ T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 11. Posey mice exhibit increased frequencies of peripheral central memory CD8+ T cells in CD8+ T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 12. Posey mice exhibit increased frequencies of peripheral effector memory CD4+ T cells in CD4+ T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 13. Posey mice exhibit increased CD44 expression on T cells. Flow cytometric analysis of peripheral blood was utilized to determine CD44 MFI. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 14. Posey mice exhibit increased CD44 expression on CD4+ T cells. Flow cytometric analysis of peripheral blood was utilized to determine CD44 MFI. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 15. Posey mice exhibit increased CD44 expression on CD8+ T cells. Flow cytometric analysis of peripheral blood was utilized to determine CD44 MFI. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 16. Posey mice exhibit increased frequencies of peripheral NK cells. Flow cytometric analysis of peripheral blood was utilized to determine NK cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 17. Homozygous posey mice exhibit diminished T-dependent IgG responses to OVA/alum. IgG levels were determined by ELISA. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The posey phenotype was identified among N-ethyl-N-nitrosourea (ENU)-mutagenized G3 mice of the pedigree R4763, some of which showed a reduced frequency of B cells (Figure 1), IgD+ B cells (Figure 2), and IgM+ B cells (Figure 3) as well as reduced IgD expression on B cells (Figure 4), all in the peripheral blood. Some mice showed a reduced CD4 to CD8 T cell ratio (Figure 5) due to reduced frequencies of CD4+ T cells in CD3+ T cells (Figure 6), naïve CD4+ T cells in CD4+ T cells (Figure 7), and naïve CD8+ T cells in CD8+ T cells (Figure 8) with concomitant increased frequencies of CD44+ CD8 T cells (Figure 9), CD8+ T cells in CD3+ T cells (Figure 10), central memory CD8+ T cells in CD8+ T cells (Figure 11), effector memory CD4+ T cells in CD4+ T cells (Figure 12). Some mice also showed increased CD44 expression on T cells (Figure 13), CD4 T cells (Figure 14), and CD8+ T cells (Figure 15) in the peripheral blood. Some mice showed increased frequencies of natural killer cells in the peripheral blood (Figure 16). The T-dependent antibody response to ovalbumin administered with aluminum hydroxide was also diminished (Figure 17).

Nature of Mutation

Figure 18. Linkage mapping of the effector memory CD4 T cell phenotype using a recessive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 73 mutations (X-axis) identified in the G1 male of pedigree R4763. Normalized phenotype data are shown for single locus linkage analysis without consideration of G2 dam identity. Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 73 mutations. All of the above anomalies were linked by continuous variable mapping to a mutation in Lig4: an A to G transition at base pair 9,972,955 (v38) on chromosome 8, or base pair 4,711 in the GenBank genomic region NC_000074 encoding Lig4. The strongest association was found with a recessive model of inheritance to the frequency of effector memory CD4 T cells in CD4 T cells wherein four variant homozygotes departed phenotypically from 12 homozygous reference mice and 10 heterozygous mice with a P value of 3.164 x 10^-5 (Figure 18).  

The mutation corresponds to residue 1,146 in the mRNA sequence NM_176953 within exon 2 of 2 total exons.

1130 ATCGAAACTAAGCTTGATGGTGAGCGCATGCAG 270  -I--E--T--K--L--D--G--E--R--M--Q-

The mutated nucleotide is indicated in red. The mutation results in an aspartic acid (D) to glycine (G) substitution at amino acid 275 (D275G) in the LIG4 protein, and is strongly predicted by PolyPhen-2 to be damaging (score = 1.000).

Protein Prediction

Figure 19. Domain structure of LIG4. The posey mutation results in an aspartic acid to glycine substitution at amino acid 275. Other mutations found in LIG4 are noted. Click on each mutation for more information.

Figure 20. Structure of human LIG4 (aa 1-609). Domains are colored as in Figure 19. Figure generated by UCSF Chimera and is based on PDB:3W1B.

Lig4 encodes DNA ligase IV, a member of the ATP-dependent DNA ligase family. DNA ligase IV has a DNA-binding domain (DBD), a catalytic domain that includes nucleotidyltransferase (NTase) and oligonucleotide binding-fold (OBD) domains, a nuclear localization sequence (NLS), two BRCT domains (BRCT I and BRCT II), and an XRCC4-interacting region (XIR) (Figure 19) (1;2).

The crystal structure of the human DNA ligase IV DBD has been solved [Figure 20; PDB:4HTP; (3) and PDB:3W1B; (4)]. The DBD has two helical subdomains that are connected by two long loops (designated L1 [amino acids 71 to 86] and L2 [amino acids 191 to 201]). Subdomain one is comprised of helices α1, α2, α3, α10, and α11, while subdomain is comprised of helices α4, α5, α6, α7, α8, and α9. The α2 helix interacts with the C-terminal region of Artemis.

Within the catalytic domain, Asp271, Arg278, Arg293, Lys432, Arg443, and Lys449 are ATP-binding sites. Lys273 is the active site, and Asp331 and Asp427 organize magnesium binding. NTase and OBD domains are found in DNA and RNA ligases as well as RNA-capping enzymes (5). The NTase domain engages the nicked DNA strand, and the OBD inserts into the minor groove of the DNA duplex opposite the nick, securing the DNA within the active site of the NTase domain (6).

The BRCT domains mediate protein-protein interactions. BRCT repeats are composed of four central β-sheets surrounded by three α-helices. The BRCT I α2 helix is required for adenovirus-mediated degradation of DNA ligase IV (7). The C-terminal region encompassing the two BRCT domains and the XIR is required for the regulation of the nuclear localization and stability of the DNA ligase IV co-factor XRCC4 as well as binding of the XRCC4/DNA ligase IV complex to chromatin (8-10). Mutations within the BRCT domains (Trp725Arg and Trp893Arg) allow DNA ligase IV binding, but do not allow for the chromatin binding of XRCC4.

Human DNA ligase IV is phosphorylated at Thr650 and putatively at Ser668 or Ser672 (11). DNA ligase IV phosphorylation contributes to its stability, but not to its DNA end joining activity (11). Phosphorylation of mouse DNA ligase IV has not been documented.

The posey mutation results in an aspartic acid (D) to glycine (G) substitution at amino acid 275 (D275G) in DNA ligase IV; amino acid 275 is within the catalytic domain in proximity to two ATP-binding sites and the active site.

Expression/Localization

LIG4 is ubiquitously expressed (NCBI).

Background

Figure 21. Schematic overview of NHEJ DNA DSB repair. Selected steps in nonhomologous end joining (NEHJ) repair (see the text for details): (1) Ku associates to DSBs to promote NHEJ and (2) the recruitment of DNA-PKcs to (3) form the catalytically active DNA-PK complex that protects the DNA ends needed for ligation. (4) Autophosphorylation of DNA-PKcs allows for ARTEMIS and DNA pol x family members to access the DNA termini. ARTEMIS and DNA-PKcs form a complex that cleaves 5’ and 3’ overhangs during NHEJ. DNA pol x family members fill in the gaps with several nucleotides, if necessary, prior to relegation. Nucleases can remove base nucleotides, if necessary (not shown). (5) XRCC4/LIG4 is recruited to the site and the broken ends are religated with the help of XLF. (6) Repair resolution of the DSB following NHEJ. Abbreviations: HR, homologous recombination; NHEJ, nonhomologous end joining; DSB, double strand break; PARP; poly(ADP)ribose polymerase; MRN, MRE11-RAD50-NBS1; MRE11, meiotic recombination 11, NBS1, Nibrin or Nijmega breakage syndrome protein 1; ssDNA, single-stranded DNA; BRCA1, breast cancer 1, early onset; RPA, replication protein A; XRCC3, X-ray repair complementing defective repair in Chinese hamster cells 3; SDSA, synthesis-dependent strand annealing; XRCC4, X-ray repair cross-complementing 4; LIG4, DNA ligase IV; XLF, XRCC4-like factor. Figure modified from images found in Ciccia and Elledge. Mol Cell . (2010) 40:179-204 , Heyer et al. Annu. Rev. Genet. (2010) 44:113-139 , and Neal and Meek. Mutat. Res. (2011) 711:73-86 .

Figure 22. Schematic overview of V(D)J Recombination. The two DNA coding segments to be joined are shown as blue and red DNA strands. (1) The RAG1/2 complex (see maladaptive and huckle ) binds to a recombination signal sequence (RSS) that flanks each variable (V), diversity (D), and joining (J) encoding gene segment. Binding of RAG1/2 and nicking of a single RSS as well as the formation of a paired complex (not shown). (2) The RAG1/2 introduce DNA DSB within the synaptic complex between the gene segments and the RSSs. (3) Cleavage by the RAG complex results in a hairpin-sealed coding end and a blunt signaling end. (4a) Formation of the signal joint occurs after blunt end ligation of signal ends by the XRCC4-ligase IV (Lig IV) complex. (4b-7b) Formation of the coding joint. (4b) The NEHJ factors arrive at the hairpin and the hairpin structures on the coding ends are nicked by DNA-PKcs and Artemis. (5b) Addition of non-templated nucleotides by terminal deoxynucleotidyl transfers (TdT) occurs during coding end processing. (6b) Joining of the coding end occurs upon ligation by the XRCC4-ligase IV (Lig IV) complex to (7b) form a coding joint. Figure adapted from Schatz and Swanson. Annu. Rev. Genet. 2011. 45:167-202 and Schatz and Ji. Nat. Reviews Immunology. 2011. 11:251-263 .

DNA ligase IV is responsible for the ligation step in nonhomologous DNA end joining (NHEJ) (Figure 21) and in V(D)J recombination (Figure 22) (12). In NHEJ, the DNA break is recognized by the Ku heterodimer composed of Ku70 and Ku80, which encircles the DNA and cups the DNA termini into an accessible binding pocket (13). The Ku dimer can recognize blunt ends, hairpin ends, and 5’ or 3’ overhangs; two in vitro studies using purified oligonucleotides containing hairpin ends found that the Ku heterodimer (and DNA-PK_CS; see the record for clover) can bind hairpin ends but the kinase could not be activated (14;15). The Ku heterodimer recruits and activates DNA-PK_CS, forming the Ku/DNA-PK_CS complex known as DNA-PK. The Ku/DNA-PK_CS interaction not only assists in localizing the complex to the DNA ends, it also protects DNA ends from nuclease digestion prior to re-ligation (16;17). Following recruitment of DNA-PK_CS to the Ku-DNA complex, Ku translocates inward ~10 bp from the DNA ends, allowing DNA-PK_CS to bind to the DNA termini (18). Two adjacent DNA-PK_CS molecules interact across the DSB, holding the DNA ends in close proximity within a synaptic complex. Crystallographic studies have shown that the synaptic complex in NHEJ consists of two DNA ends, two Ku heterodimers, and two DNA-PK_CS proteins (17;19). The formation of a synaptic complex is essential for the activation of DNA-PK_CS (17). Nucleases (e.g. 5’: FEN1, EXO1, and Sep1 (20-22); 3’: MRE11 (23)) and polymerases (e.g. polβ, polε, and polδ) are often required to remove several nucleotides or to fill in gaps of several nucleotides, respectively, to facilitate the proper conformation for ligation (24). The colocalization of DNA polymerase X family members (e.g. terminal deoxynucleotidyl transferase (TdT), pol μ, pol λ, and polβ) with DNA-PK_CS as well as the interactions of DNA pol X with both Ku and the DNA ligase IV-XRCC4 complex suggest that the DNA polymerase X family participates in the filling in of short gaps prior to re-ligation (25;26). To protect the DNA termini of a DSB from degradation or premature and incorrect ligation, DNA-PK_CS is positioned as a “cap” on the DNA ends (27;28). Before re-ligation of the DNA ends and finalization of the DSB repair, the DNA-PK_CS cap must be removed or altered. Autophosphorylation of DNA-PK_CS results in release of the cap and accessibility of the termini to enzymes and ligases needed to complete the repair (e.g. Artemis, DNA polymerase X family members and the DNA ligase IV-XRCC4 dimer)(17;25;29). Artemis and DNA-PK_CS form a complex with endonuclease activity that cleaves 5’ and 3’ overhangs during NHEJ, and opens hairpins generated by the RAG complex during V(D)J recombination [(30); reviewed in (29)]. In order to activate its nuclease activity, Artemis is phosphorylated by DNA-PK_CS (31). The DNA ligase IV-XRCC4 dimer rejoins the DNA ends, with XRCC4 both interacting with and catalytically stimulating DNA ligase IV (29).  XLF functions to stimulate the ability of XRCC4-DNA ligase IV to ligate in the presence of Mg²⁺ (32). 

During lymphoid cell development, the process of V(D)J recombination generates a variable region exon to which is subsequently joined a constant region gene, together encoding either an immunoglobulin or T cell receptor chain. In V(D)J recombination, a trans-esterification reaction mediated by RAG1/RAG2 produces an excised DNA fragment with blunt signal ends and two covalently closed hairpins at each end of the coding regions that must be joined (16;25). Artemis is essential to opening hairpins for V(D)J recombination following phosphorylation by DNA-PK_CS.  To process the DNA ends and ligate coding regions, the cell uses the NHEJ pathway. In cells lacking DNA-PK_CS, V(D)J recombination intermediates cannot be completely processed and ligated, leading to an accumulation of hairpin intermediates (33). This indicates that DNA-PK_CS may be necessary for cleavage of hairpin intermediates as well as for the final end joining step (25).

Mutations in human LIG4 are linked to LIG4 syndrome [alternatively, DNA ligase IV deficiency; OMIM: #606593; (34;35)] and resistance to multiple myeloma [OMIM: #254500; (36)]. Patients with LIG4 syndrome exhibit immunodeficiency as well as delays in development and growth (34). Patients also often display unusual facial features, microcephaly, growth and/or developmental delay, pancytopenia, and various skin abnormalities. 

Lig4-deficient mice are embryonic lethal, and the mice exhibited neuronal apoptosis, arrested lymphogenesis, reduced body size, and various cellular defects (37-41). The embryonic lethality, neuronal apoptosis, and fibroblast proliferation/senescence defects observed in the Lig4-deficient mice could be rescued with p53 deficiency; lymphocyte development defects were not rescued (42). K.M. Frank and colleagues propose that most of the phenotypes observed in the Lig4-deficient mice are due to a p53-dependent response to unrepaired DNA damage. The embryonic lethality in the Lig4-deficient mice could also be rescued by deletion of Ku86 (43). Z.E. Karanjawala and colleagues propose that in the case of Lig4 deficiency alone that the lethality phenotype is due the presence of the Artemis:DNA-PK_CS  nuclease. The loss of Ku86 results in a less severe phenotype, because Ku86 is less efficient than Artemis:DNA-PK_CS.  

The Arg278His mutation in humans is linked to Lig4 syndrome. Homozygous Lig4^R278H/R278H knock-in mice exhibited a reduced life span, reduced body weights compared to wild-type controls, reduced fertility, reduced numbers of B220+ cells in the bone marrow, reduced B220+ IgM+ B cells in the spleen, reduced numbers of CD4-CD8- double negative T cells, CD4+CD8+ double positive T cells, B cells, CD4+ T cells, and CD8+ T cells (44). The Lig4^R278H/R278H mice also had reduced IgA, IgG, and IgM in the serum.

Homozygous Lig4 mutant mice (Tyr288Cys) was viable, but showed high levels of endogenous DSBs, immunodeficiency, growth retardation, and reduced brain sizes compared to wild-type mice as well as increased apoptosis in the forebrain, intermediate zone/cortical plate, and ventricular/subventricular zones (45;46). The mice showed impaired V(D)J recombination, B cell class switch recombination, and peripheral lymphocyte survival and proliferation (46). The Tyr288Cys mutant mice also showed a high incidence of thymic tumors.

Homozygous mice (Lig4^tiny/tiny) with an ENU-induced mutation exhibited prenatal lethality (born at 40% of the expected frequency), reduced body sizes, reduced B cell numbers, and lack of CD8+ T cells (MGI:3714853 and (47)). Mouse embryonic fibroblasts from the Lig4^tiny/tiny mice exhibited reduced ability to repair DNA damage from gamma radiation.

Putative Mechanism

The phenotype of the posey mice indicates loss of LIG4^posey function in NHEJ and/or V(D)J recombination.

Primers

PCR Primer
posey_pcr_F: CCCCTTCTGCATGAAAGTCTG
posey_pcr_R: GTTGCACAACGTCACCACAG

Sequencing Primer
posey_seq_F: GGGTTGTAGGCCATCATCTCAC
posey_seq_R: GTCACCACAGATCTGGAAAAGGTC

Genotyping

PCR program

1) 94°C 2:00
2) 94°C 0:30
3) 55°C 0:30
4) 72°C 1:00
5) repeat steps (2-4) 40x
6) 72°C 10:00
7) 4°C hold

The following sequence of 400 nucleotides is amplified (chromosome 8, - strand):

1   gttgcacaac gtcaccacag atctggaaaa ggtctgcagg cagctgcatg acccctctgt
61  agggcttagt gacatctcta tcactctgtt ttctgccttt aagccaatgc tagctgctgt
121 agcagacgtg gagcgtgtgg agaaggacat gaagcagcag agtttctaca tcgaaactaa
181 gcttgatggt gagcgcatgc agatgcacaa agatggcgcg ctgtaccggt acttctccag
241 aaacggttac aactataccg accagtttgg tgaatctcca caggaaggct ctctcacccc
301 atttattcac aatgcgttcg ggacagatgt gcaagcgtgc atccttgacg gtgagatgat
361 ggcctacaac ccaacaacac agactttcat gcagaagggg 

Primer binding sites are underlined and the sequencing primers are highlighted; the mutated nucleotide is shown in red.

References

  1. Tomkinson, A. E., Vijayakumar, S., Pascal, J. M., and Ellenberger, T. (2006) DNA Ligases: Structure, Reaction Mechanism, and Function. Chem Rev. 106, 687-699.

  2. Grawunder, U., Zimmer, D., and Lieber, M. R. (1998) DNA Ligase IV Binds to XRCC4 Via a Motif Located between rather than within its BRCT Domains. Curr Biol. 8, 873-876.

  3. De Ioannes, P., Malu, S., Cortes, P., and Aggarwal, A. K. (2012) Structural Basis of DNA Ligase IV-Artemis Interaction in Nonhomologous End-Joining. Cell Rep. 2, 1505-1512.

  4. Ochi, T., Gu, X., and Blundell, T. L. (2013) Structure of the Catalytic Region of DNA Ligase IV in Complex with an Artemis Fragment Sheds Light on Double-Strand Break Repair. Structure. 21, 672-679.

  5. Shuman, S., and Schwer, B. (1995) RNA Capping Enzyme and DNA Ligase: A Superfamily of Covalent Nucleotidyl Transferases. Mol Microbiol. 17, 405-410.

  6. Cotner-Gohara, E., Kim, I. K., Hammel, M., Tainer, J. A., Tomkinson, A. E., and Ellenberger, T. (2010) Human DNA Ligase III Recognizes DNA Ends by Dynamic Switching between Two DNA-Bound States. Biochemistry. 49, 6165-6176.

  7. Gilson, T., Greer, A. E., Vindigni, A., Ketner, G., and Hanakahi, L. A. (2012) The alpha2 Helix in the DNA Ligase IV BRCT-1 Domain is Required for Targeted Degradation of Ligase IV during Adenovirus Infection. Virology. 428, 128-135.

  8. Liu, S., Liu, X., Kamdar, R. P., Wanotayan, R., Sharma, M. K., Adachi, N., and Matsumoto, Y. (2013) C-Terminal Region of DNA Ligase IV Drives XRCC4/DNA Ligase IV Complex to Chromatin. Biochem Biophys Res Commun. 439, 173-178.

  9. Francis, D. B., Kozlov, M., Chavez, J., Chu, J., Malu, S., Hanna, M., and Cortes, P. (2014) DNA Ligase IV Regulates XRCC4 Nuclear Localization. DNA Repair (Amst). 21, 36-42.

  10. Wu, P. Y., Frit, P., Meesala, S., Dauvillier, S., Modesti, M., Andres, S. N., Huang, Y., Sekiguchi, J., Calsou, P., Salles, B., and Junop, M. S. (2009) Structural and Functional Interaction between the Human DNA Repair Proteins DNA Ligase IV and XRCC4. Mol Cell Biol. 29, 3163-3172.

  11. Wang, Y. G., Nnakwe, C., Lane, W. S., Modesti, M., and Frank, K. M. (2004) Phosphorylation and Regulation of DNA Ligase IV Stability by DNA-Dependent Protein Kinase. J Biol Chem. 279, 37282-37290.

  12. Grawunder, U., Zimmer, D., Fugmann, S., Schwarz, K., and Lieber, M. R. (1998) DNA Ligase IV is Essential for V(D)J Recombination and DNA Double-Strand Break Repair in Human Precursor Lymphocytes. Mol Cell. 2, 477-484.

  13. Walker, J. R., Corpina, R. A., and Goldberg, J. (2001) Structure of the Ku Heterodimer Bound to DNA and its Implications for Double-Strand Break Repair. Nature. 412, 607-614.

  14. Hammarsten, O., DeFazio, L. G., and Chu, G. (2000) Activation of DNA-Dependent Protein Kinase by Single-Stranded DNA Ends. J Biol Chem. 275, 1541-1550.

  15. Smider, V., Rathmell, W. K., Brown, G., Lewis, S., and Chu, G. (1998) Failure of Hairpin-Ended and Nicked DNA to Activate DNA-Dependent Protein Kinase: Implications for V(D)J Recombination. Mol Cell Biol. 18, 6853-6858.

  16. Collis, S. J., DeWeese, T. L., Jeggo, P. A., and Parker, A. R. (2005) The Life and Death of DNA-PK. Oncogene. 24, 949-961.

  17. Weterings, E., and Chen, D. J. (2007) DNA-Dependent Protein Kinase in Nonhomologous End Joining: A Lock with Multiple Keys? J Cell Biol. 179, 183-186.

  18. Cahill, D., Connor, B., and Carney, J. P. (2006) Mechanisms of Eukaryotic DNA Double Strand Break Repair. Front Biosci. 11, 1958-1976.

  19. Spagnolo, L., Rivera-Calzada, A., Pearl, L. H., and Llorca, O. (2006) Three-Dimensional Structure of the Human DNA-PKcs/Ku70/Ku80 Complex Assembled on DNA and its Implications for DNA DSB Repair. Mol Cell. 22, 511-519.

  20. Fiorentini, P., Huang, K. N., Tishkoff, D. X., Kolodner, R. D., and Symington, L. S. (1997) Exonuclease I of Saccharomyces Cerevisiae Functions in Mitotic Recombination in Vivo and in Vitro. Mol Cell Biol. 17, 2764-2773.

  21. Lieber, M. R. (1997) The FEN-1 Family of Structure-Specific Nucleases in Eukaryotic DNA Replication, Recombination and Repair. Bioessays. 19, 233-240.

  22. Johnson, A. W., and Kolodner, R. D. (1991) Strand Exchange Protein 1 from Saccharomyces Cerevisiae. A Novel Multifunctional Protein that Contains DNA Strand Exchange and Exonuclease Activities. J Biol Chem. 266, 14046-14054.

  23. Paull, T. T., and Gellert, M. (1998) The 3' to 5' Exonuclease Activity of Mre 11 Facilitates Repair of DNA Double-Strand Breaks. Mol Cell. 1, 969-979.

  24. Lieber, M. R. (1999) The Biochemistry and Biological Significance of Nonhomologous DNA End Joining: An Essential Repair Process in Multicellular Eukaryotes. Genes Cells. 4, 77-85.

  25. Dip, R., and Naegeli, H. (2005) More than just Strand Breaks: The Recognition of Structural DNA Discontinuities by DNA-Dependent Protein Kinase Catalytic Subunit. FASEB J. 19, 704-715.

  26. Meek, K., Dang, V., and Lees-Miller, S. P. (2008) DNA-PK: The Means to Justify the Ends? Adv Immunol. 99, 33-58.

  27. Block, W. D., Yu, Y., Merkle, D., Gifford, J. L., Ding, Q., Meek, K., and Lees-Miller, S. P. (2004) Autophosphorylation-Dependent Remodeling of the DNA-Dependent Protein Kinase Catalytic Subunit Regulates Ligation of DNA Ends. Nucleic Acids Res. 32, 4351-4357.

  28. Weterings, E., Verkaik, N. S., Bruggenwirth, H. T., Hoeijmakers, J. H., and van Gent, D. C. (2003) The Role of DNA Dependent Protein Kinase in Synapsis of DNA Ends. Nucleic Acids Res. 31, 7238-7246.

  29. Meek, K., Gupta, S., Ramsden, D. A., and Lees-Miller, S. P. (2004) The DNA-Dependent Protein Kinase: The Director at the End. Immunol Rev. 200, 132-141.

  30. Ma, Y., Pannicke, U., Schwarz, K., and Lieber, M. R. (2002) Hairpin Opening and Overhang Processing by an Artemis/DNA-Dependent Protein Kinase Complex in Nonhomologous End Joining and V(D)J Recombination. Cell. 108, 781-794.

  31. Jolly, C. J., Cook, A. J., and Manis, J. P. (2008) Fixing DNA Breaks during Class Switch Recombination. J Exp Med. 205, 509-513.

  32. Gu, J., Lu, H., Tsai, A. G., Schwarz, K., and Lieber, M. R. (2007) Single-Stranded DNA Ligation and XLF-Stimulated Incompatible DNA End Ligation by the XRCC4-DNA Ligase IV Complex: Influence of Terminal DNA Sequence. Nucleic Acids Res. 35, 5755-5762.

  33. Taccioli, G. E., Rathbun, G., Oltz, E., Stamato, T., Jeggo, P. A., and Alt, F. W. (1993) Impairment of V(D)J Recombination in Double-Strand Break Repair Mutants. Science. 260, 207-210.

  34. O'Driscoll, M., Cerosaletti, K. M., Girard, P. M., Dai, Y., Stumm, M., Kysela, B., Hirsch, B., Gennery, A., Palmer, S. E., Seidel, J., Gatti, R. A., Varon, R., Oettinger, M. A., Neitzel, H., Jeggo, P. A., and Concannon, P. (2001) DNA Ligase IV Mutations Identified in Patients Exhibiting Developmental Delay and Immunodeficiency. Mol Cell. 8, 1175-1185.

  35. van der Burg, M., van Veelen, L. R., Verkaik, N. S., Wiegant, W. W., Hartwig, N. G., Barendregt, B. H., Brugmans, L., Raams, A., Jaspers, N. G., Zdzienicka, M. Z., van Dongen, J. J., and van Gent, D. C. (2006) A New Type of Radiosensitive T-B-NK+ Severe Combined Immunodeficiency Caused by a LIG4 Mutation. J Clin Invest. 116, 137-145.

  36. Roddam, P. L., Rollinson, S., O'Driscoll, M., Jeggo, P. A., Jack, A., and Morgan, G. J. (2002) Genetic Variants of NHEJ DNA Ligase IV can Affect the Risk of Developing Multiple Myeloma, a Tumour Characterised by Aberrant Class Switch Recombination. J Med Genet. 39, 900-905.

  37. Frank, K. M., Sekiguchi, J. M., Seidl, K. J., Swat, W., Rathbun, G. A., Cheng, H. L., Davidson, L., Kangaloo, L., and Alt, F. W. (1998) Late Embryonic Lethality and Impaired V(D)J Recombination in Mice Lacking DNA Ligase IV. Nature. 396, 173-177.

  38. Gu, Y., Sekiguchi, J., Gao, Y., Dikkes, P., Frank, K., Ferguson, D., Hasty, P., Chun, J., and Alt, F. W. (2000) Defective Embryonic Neurogenesis in Ku-Deficient but Not DNA-Dependent Protein Kinase Catalytic Subunit-Deficient Mice. Proc Natl Acad Sci U S A. 97, 2668-2673.

  39. Barnes, D. E., Stamp, G., Rosewell, I., Denzel, A., and Lindahl, T. (1998) Targeted Disruption of the Gene Encoding DNA Ligase IV Leads to Lethality in Embryonic Mice. Curr Biol. 8, 1395-1398.

  40. Lee, Y., Barnes, D. E., Lindahl, T., and McKinnon, P. J. (2000) Defective Neurogenesis Resulting from DNA Ligase IV Deficiency Requires Atm. Genes Dev. 14, 2576-2580.

  41. Orii, K. E., Lee, Y., Kondo, N., and McKinnon, P. J. (2006) Selective Utilization of Nonhomologous End-Joining and Homologous Recombination DNA Repair Pathways during Nervous System Development. Proc Natl Acad Sci U S A. 103, 10017-10022.

  42. Frank, K. M., Sharpless, N. E., Gao, Y., Sekiguchi, J. M., Ferguson, D. O., Zhu, C., Manis, J. P., Horner, J., DePinho, R. A., and Alt, F. W. (2000) DNA Ligase IV Deficiency in Mice Leads to Defective Neurogenesis and Embryonic Lethality Via the p53 Pathway. Mol Cell. 5, 993-1002.

  43. Karanjawala, Z. E., Adachi, N., Irvine, R. A., Oh, E. K., Shibata, D., Schwarz, K., Hsieh, C. L., and Lieber, M. R. (2002) The Embryonic Lethality in DNA Ligase IV-Deficient Mice is Rescued by Deletion of Ku: Implications for Unifying the Heterogeneous Phenotypes of NHEJ Mutants. DNA Repair (Amst). 1, 1017-1026.

  44. Rucci, F., Notarangelo, L. D., Fazeli, A., Patrizi, L., Hickernell, T., Paganini, T., Coakley, K. M., Detre, C., Keszei, M., Walter, J. E., Feldman, L., Cheng, H. L., Poliani, P. L., Wang, J. H., Balter, B. B., Recher, M., Andersson, E. M., Zha, S., Giliani, S., Terhorst, C., Alt, F. W., and Yan, C. T. (2010) Homozygous DNA Ligase IV R278H Mutation in Mice Leads to Leaky SCID and Represents a Model for Human LIG4 Syndrome. Proc Natl Acad Sci U S A. 107, 3024-3029.

  45. Gatz, S. A., Ju, L., Gruber, R., Hoffmann, E., Carr, A. M., Wang, Z. Q., Liu, C., and Jeggo, P. A. (2011) Requirement for DNA Ligase IV during Embryonic Neuronal Development. J Neurosci. 31, 10088-10100.

  46. Nijnik, A., Dawson, S., Crockford, T. L., Woodbine, L., Visetnoi, S., Bennett, S., Jones, M., Turner, G. D., Jeggo, P. A., Goodnow, C. C., and Cornall, R. J. (2009) Impaired Lymphocyte Development and Antibody Class Switching and Increased Malignancy in a Murine Model of DNA Ligase IV Syndrome. J Clin Invest. 119, 1696-1705.

  47. Nijnik, A., Woodbine, L., Marchetti, C., Dawson, S., Lambe, T., Liu, C., Rodrigues, N. P., Crockford, T. L., Cabuy, E., Vindigni, A., Enver, T., Bell, J. I., Slijepcevic, P., Goodnow, C. C., Jeggo, P. A., and Cornall, R. J. (2007) DNA Repair is Limiting for Haematopoietic Stem Cells during Ageing. Nature. 447, 686-690.