Phenotypic Mutation 'candy_corn' (pdf version)
Allelecandy_corn
Mutation Type missense
Chromosome6
Coordinate142,456,333 bp (GRCm38)
Base Change T ⇒ C (forward strand)
Gene Gys2
Gene Name glycogen synthase 2
Synonym(s) glycogen synthase, liver, LGS
Chromosomal Location 142,422,613-142,473,109 bp (-)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene, liver glycogen synthase, catalyzes the rate-limiting step in the synthesis of glycogen - the transfer of a glucose molecule from UDP-glucose to a terminal branch of the glycogen molecule. Mutations in this gene cause glycogen storage disease type 0 (GSD-0) - a rare type of early childhood fasting hypoglycemia with decreased liver glycogen content. [provided by RefSeq, Dec 2009]
PHENOTYPE: Mice homozygous for a conditional allele knocked out in the liver results in abnormal glycogen homeostasis, altered glucose homeostasis, decreased exercise endurance, and a phenotype similar to patients with glycogen storage disease 0. [provided by MGI curators]
Accession Number

NCBI RefSeq: NM_145572; MGI:2385254

Mapped Yes 
Amino Acid Change Glutamic Acid changed to Glycine
Institutional SourceBeutler Lab
Gene Model predicted gene model for protein(s): [ENSMUSP00000032371]
SMART Domains Protein: ENSMUSP00000032371
Gene: ENSMUSG00000030244
AA Change: E260G

DomainStartEndE-ValueType
Pfam:Glycogen_syn 32 667 N/A PFAM
Predicted Effect probably benign

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
(Using ENSMUST00000032371)
Meta Mutation Damage Score 0.1867 question?
Is this an essential gene? Possibly nonessential (E-score: 0.263) question?
Phenotypic Category
Phenotypequestion? Literature verified References
30 min GTT hyperglycemic 23990365
30 min GTT hyperoglycemic (female)
Candidate Explorer Status CE: good candidate; Verification probability: 0.803; ML prob: 0.7456; human score: -1.5
Single pedigree
Linkage Analysis Data
Penetrance  
Alleles Listed at MGI

All Mutations and Alleles(3) Targeted(3)

Lab Alleles
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00466:Gys2 APN 6 142463290 nonsense probably null
IGL02963:Gys2 APN 6 142449428 critical splice donor site probably null
IGL02997:Gys2 APN 6 142449469 missense probably damaging 1.00
embittered UTSW 6 142454484 missense possibly damaging 0.92
hazelnut UTSW 6 142449455 missense possibly damaging 0.67
R0243:Gys2 UTSW 6 142472668 splice site probably benign
R1124:Gys2 UTSW 6 142446013 missense probably damaging 0.97
R1188:Gys2 UTSW 6 142455183 missense probably damaging 1.00
R1208:Gys2 UTSW 6 142450467 critical splice donor site probably null
R1208:Gys2 UTSW 6 142450467 critical splice donor site probably null
R1235:Gys2 UTSW 6 142430293 missense probably damaging 1.00
R1387:Gys2 UTSW 6 142461283 missense probably benign 0.06
R1758:Gys2 UTSW 6 142472706 missense probably damaging 1.00
R1819:Gys2 UTSW 6 142461186 missense probably damaging 1.00
R2221:Gys2 UTSW 6 142456422 missense probably damaging 1.00
R2311:Gys2 UTSW 6 142463244 missense possibly damaging 0.81
R2344:Gys2 UTSW 6 142446022 missense probably damaging 0.99
R3151:Gys2 UTSW 6 142456333 missense probably benign 0.00
R3902:Gys2 UTSW 6 142472800 start codon destroyed probably null 0.98
R4532:Gys2 UTSW 6 142455141 missense probably damaging 0.98
R4577:Gys2 UTSW 6 142454510 missense possibly damaging 0.93
R4588:Gys2 UTSW 6 142449455 missense possibly damaging 0.67
R4606:Gys2 UTSW 6 142454484 missense possibly damaging 0.92
R5338:Gys2 UTSW 6 142454513 missense probably damaging 1.00
R5411:Gys2 UTSW 6 142448421 missense probably damaging 0.99
R6072:Gys2 UTSW 6 142428537 missense probably damaging 0.98
R6261:Gys2 UTSW 6 142459408 missense probably benign
R6366:Gys2 UTSW 6 142463394 missense probably benign 0.02
R6597:Gys2 UTSW 6 142456309 missense probably benign 0.25
R6930:Gys2 UTSW 6 142459380 critical splice donor site probably null
R7033:Gys2 UTSW 6 142472722 missense probably benign 0.08
R7663:Gys2 UTSW 6 142459485 missense probably damaging 1.00
R7757:Gys2 UTSW 6 142454451 missense probably benign 0.10
R7848:Gys2 UTSW 6 142446015 nonsense probably null
R7852:Gys2 UTSW 6 142430333 missense probably damaging 1.00
R8008:Gys2 UTSW 6 142454517 missense probably damaging 1.00
R8037:Gys2 UTSW 6 142448393 missense probably benign 0.44
R8070:Gys2 UTSW 6 142448504 critical splice acceptor site probably null
R8152:Gys2 UTSW 6 142427410 missense probably benign
R8178:Gys2 UTSW 6 142456412 missense probably damaging 1.00
R8439:Gys2 UTSW 6 142461195 missense probably benign 0.09
R8674:Gys2 UTSW 6 142430322 missense probably benign 0.02
Mode of Inheritance Autosomal Recessive
Local Stock
Repository
Last Updated 2021-03-22 4:00 PM by External Program
Record Created 2016-09-28 3:50 PM
Record Posted 2018-08-29
Phenotypic Description

Figure 1. Candy_corn mice exhibited hyperglycemia in response to glucose stimulation. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The candy_corn phenotype was identified among N-ethyl-N-nitrosourea (ENU)-mutagenized G3 mice of the pedigree R3151, some of which showed hyperglycemia 30 minutes after glucose challenge (Figure 1).

Nature of Mutation

Figure 2. Linkage mapping of the hyperglycemia phenotype using a recessive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 65 mutations (X-axis) identified in the G1 male of pedigree R3151.  Normalized phenotype data are shown for single locus linkage analysis without consideration of G2 dam identity.  Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 65 mutations. The hyperglycemia phenotype was linked by continuous variable mapping to a mutation in Gys2: an A to G transition at base pair 142,456,333 (v38) on chromosome 6, or base pair 16,798 in the GenBank genomic region NC_000072 encoding Gys2. Linkage was found with a recessive model of inheritance, wherein 10 variant homozygotes departed phenotypically from nine homozygous reference mice and 27 heterozygous mice with a P value of 1.88 x 10-4 (Figure 2).  

 

The mutation corresponds to residue 1,087 in the mRNA sequence NM_145572 within exon 5 of 17 total exons.

 

1071 TTCACCACAGTGTCAGAAATCACAGCCATCGAG

255  -F--T--T--V--S--E--I--T--A--I--E-

 

The mutated nucleotide is indicated in red.  The mutation results in a glutamic acid (E) to glycine (G) substitution at position 260 (E260G) in the GYS2 protein, and is strongly predicted by PolyPhen-2 to be benign (score = 0.001).

 

**this is a double linkage of Gys2 and Rab33b

Illustration of Mutations in
Gene & Protein
Protein Prediction
Figure 3. Domain organization of GYS2. GYS2 has no known defined domain. Phosphorylation sites are shown as orange ovals. Secondary structures are based on AtGS (see Figure 4). β-strands are noted in blue, and α-helices are shown in pink. The candy_corn mutation results in a glutamic acid to glycine substitution at position 260 in the GYS2 protein. The image is interactive. Click on each mutation to view more information.
Figure 4. Crystal structure of glycogen synthase from Agrobacterium tumefaciens. β-strands are shown in blue, and α-helices are shown in pink. UCSF Chimera model is based on PDB 1RZV. Click on the 3D structure to view it rotate.

Gys2 encodes liver-specific glycogen synthase-2 (GYS2). GYS2 does not have defined domains (Figure 3 & 4). The candy_corn mutation results in a glutamic acid (E) to glycine (G) substitution at position 260 (E260G) in the GYS2 protein.

 

For more information about Gys2, please see the record for hazelnut.

Putative Mechanism

Glycogen is a primary carbohydrate storage form primarily found in liver and skeletal muscle. Glycogen synthase catalyzes the rate-limiting step in glycogen synthesis:  the transfer of a glucose molecule from uridine diphosphoglucose (UDPG) to a terminal branch of the glycogen primer by alpha(1,4) bonds. The branching enzyme amylo-(1,4 to 1,6)-transglycosylase produces the characteristic alpha(1,6) branches of glycogen by breaking alpha(1,4) chains and carrying the broken chain to the carbon #6.

 

Mutations in human GYS2 and/or GYS2 deficiency are associated with liver glycogen storage disease-0 [GSD0A; OMIM: #240600; (1-3)]. Patients with GSD0A exhibit fasting hypoglycemia and hyperketonemia, but hyperglycemia and hyperlactatemia with feeding (2;4). A mutation in GYS2 (c.1802T>G; p. Leu601X) was identified in a patient with ketotic hypoglycemia (5). Patients with ketotic hypoglycemia have fasting hypoglycemia, but normal hormonal and metabolite profiles. GYS2 is a putative predisposing factor of polycystic ovary syndrome in relation to obesity in Korean women (6).

 

Gys2-deficient mice exhibited reduced circulating levels of glucose, glycerol, liver glycogen, calcium, sodium, total protein, and chloride [MGI and (7)]. Homozygous mice expressing a mutant Gys2 (Gys2R582A/R582A) exhibit reduced fasting glucose levels, but normal glucose levels after feeding (7). The Gys2R582A/R582A mice exhibited reduced circulating insulin levels, impaired basal production of glucose, impaired glucose tolerance, reduced glycogen catabolism, absent liver glycogen levels, insulin resistance, and increased liver triglyceride levels (7). Mice with liver-specific knockout of Gys2 exhibited reduction in fed liver glycogen content, reduced circulating glucose levels in fed and fasted states, increased liver triglyceride levels, reduced systemic arterial diastolic blood pressure, and impaired exercise endurance (8). Expression of a constitutively active mutant GYS2 in rats caused lowering of blood glucose in the fed, but not fasted state (9). Also, fasted rats overexpressing GYS2 showed increased clearance of blood glucose after glucose challenge (9).

 

The impaired glucose tolerance phenotype observed in the candy_corn mice indicates loss of GYS2candy_corn function. Some function may be retained as changes in fasting glucose levels were not noted.

Primers PCR Primer
candy_corn_pcr_F: TCTTGAAGACCCCACCTCTAG
candy_corn_pcr_R: CAGACTTGAAGTGAACAGTGCTG

Sequencing Primer
candy_corn_seq_F: TGAAGACCCCACCTCTAGACACC
candy_corn_seq_R: GGGGTCTTTACAACTTCAATCAGC
Genotyping

PCR program

1) 94°C 2:00
2) 94°C 0:30
3) 55°C 0:30
4) 72°C 1:00
5) repeat steps (2-4) 40x
6) 72°C 10:00
7) 4°C hold


The following sequence of 436 nucleotides is amplified (chromosome 6, - strand):


1   cagacttgaa gtgaacagtg ctgttaaaaa taccaatttt atactctagc cagtggctta
61  atatccacta gtcctttaat ggggtcttta caacttcaat cagctctgag gaaaaccttg
121 gcatgtggag ggggtcctgt aaggaacgtg tgtttgtctt caacagttcg acattgacaa
181 agaggccggg gagaggcaga tataccaccg ctactgcatg gagcgggcat ccgtgcactg
241 tgcgcacgtg ttcaccacag tgtcagaaat cacagccatc gaggcagagc acatgctgaa
301 gaggaagcct ggtaatgaca gaggctgggt ttgccaccct aacacatgca gcacccttgc
361 ttaattgctg tgctctcacc tgcggtttcc tagttgtcag agaccacttg ggtgtctaga
421 ggtggggtct tcaaga


Primer binding sites are underlined and the sequencing primers are highlighted; the mutated nucleotide is shown in red.

References
Science Writers Anne Murray
Illustrators Katherine Timer
AuthorsJames Butler, Emre Turer, and Bruce Beutler