Phenotypic Mutation 'mooyah'

• Allele: mooyah
• Mutation Type: critical splice donor site
• Chromosome: 10
• Coordinate: 100,088,222 bp (GRCm38)
• Base Change: T ⇒ C (forward strand)
• Gene: Kitl
• Gene Name: kit ligand
• Synonym(s): Gb, grizzle-belly, Mgf, SCF, SF, Sl, SLF, Steel, Steel factor, stem cell factor
• Chromosomal Location: 100,015,630-100,100,416 bp (+)
• MGI Phenotype: FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the ligand of the tyrosine-kinase receptor encoded by the KIT locus. This ligand is a pleiotropic factor that acts in utero in germ cell and neural cell development, and hematopoiesis, all believed to reflect a role in cell migration. In adults, it functions pleiotropically, while mostly noted for its continued requirement in hematopoiesis. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008] ; PHENOTYPE: Mutations in this gene affect migration of embryonic stem cells and cause similar phenotypes to mutations in its receptor gene (Kit). Mutants show mild to severe defects in pigmentation, hemopoiesis and reproduction. [provided by MGI curators]
• Mapped: Yes
• Institutional Source: Beutler Lab
• Gene Model: predicted gene model for protein(s): [ENSMUSP00000020129 ^†] [ENSMUSP00000100920 ^†] [ENSMUSP00000151554 ^†] † probably from a misspliced transcript
• AlphaFold: P20826
• PDB Structure: Structure of a class III RTK signaling assembly [X-RAY DIFFRACTION] ; Structure of a class III RTK signaling assembly [X-RAY DIFFRACTION]
• SMART Domains: Protein: ENSMUSP00000020129; Gene: ENSMUSG00000019966

Domain	Start	End	E-Value	Type
Pfam:SCF	1	176	5.7e-102	PFAM
Pfam:SCF	173	245	1.7e-36	PFAM

• Predicted Effect: probably null
• SMART Domains: Protein: ENSMUSP00000100920; Gene: ENSMUSG00000019966

Domain	Start	End	E-Value	Type
Pfam:SCF	1	273	2.3e-157	PFAM

• Predicted Effect: probably null
• Predicted Effect: probably null
• Meta Mutation Damage Score: 0.9483
• Is this an essential gene?: Possibly nonessential (E-score: 0.280)
• Phenotypic Category: Autosomal Recessive
• Mode of Inheritance: Autosomal Recessive
• Last Updated: 2018-08-06 2:00 PM by Anne Murray
• Record Created: 2016-10-05 2:05 PM by Carlos Reyna
• Record Posted: 2018-04-24
• Science Writers: Anne Murray
• Illustrators: Diantha La Vine
• Authors: Carlos Reyna, Jamie Russell, and Bruce Beutler

Accession Number

NCBI RefSeq: NM_013598, NM_001347156; MGI:96974

Alleles Listed at MGI

All Mutations and Alleles(79) : Chemically and radiation induced(8) Chemically induced (ENU)(15) Chemically induced (other)(1) Gene trapped(4) Radiation induced(15) Spontaneous(21) Targeted(10) Transgenic(5)

Phenotypic Description

Figure 1. The mooyah mice exhibit predominantly white fur with black spots.

The mooyah phenotype was identified among N-ethyl-N-nitrosourea (ENU)-mutagenized G3 mice of the pedigree R5135, some of which had predominantly white fur with black spots (Figure 1).

Nature of Mutation

Figure 2. Linkage mapping of the pigmentation phenotype using a recessive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 85 mutations (X-axis) identified in the G1 male of pedigree R5135. Binary phenotype data are shown for single locus linkage analysis without consideration of G2 dam identity. Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 85 mutations. The pigmentation phenotype was linked to a mutation in Kitl: a T to C transition at base pair 100,088,222 (v38) on chromosome 10, or base pair 72,588 in the GenBank genomic region NC_000076 in the splice donor site of intron 8. Linkage was found with a recessive model of inheritance (P = 0.000105), wherein three affected mice were homozygous for the variant allele, and 28 unaffected mice were either heterozygous (N = 17) or homozygous for the reference allele (N = 11) (Figure 2).

 

The effect of the mutation at the cDNA and protein levels have not examined, but the mutation is predicted to result in skipping of the 68-nucleotide exon 8 (out of 10 total exons), resulting in a frame-shifted protein product beginning after amino acid 238 of the protein, and terminating after the inclusion of 27 aberrant amino acids.

 

<--exon 7     <--exon 8 intron 8-->         exon 9--> 71811 ……TTATACTGGAAG ……AATGAGATAAG gtattttgttctcctaa…… TATGTTGCAACA……AGTGGCTGGTAA…… 235   ……-L--Y--W--K- ……-N--E--I--S                  -Y--V--A--T-……-S--G--W--*-           correct        deleted                                 aberrant

 

Genomic numbering corresponds to NC_000076. The donor splice site of intron 8, which is destroyed by the Mooyah mutation, is indicated in blue lettering and the mutated nucleotide is indicated in red. 

Protein Prediction

Figure 3. Domain structure of SCF. The moooyah mutation results in a T to C transition in the splice donor site of intron 8. The location of other Kitl mutations is indicated; click to view more information about these mutations. Abbreviations: SP, signal peptide; TM, transmembrane domain.

Figure 2. Crystal structure of the KIT/SCF complex. The KIT extracellular domains are shown in blue, while the two SCF molecules are shown in green. β-strands are represented by arrows and α-helices by coils. UCSF Chimera model is based on PDB 2E9W, Yuzawa et al., Cell. 130, 232-334 (2007). Click on the 3D structure to view it rotate.

Kitl encodes stem cell factor (SCF; alternatively, Kit ligand [KL], Steel, Steel factor, or mast cell growth factor [MGF]). SCF has an N-terminal signal sequence and a putative transmembrane domain near the C-terminus [Figure 3; (1)].

 

Kitl undergoes alternatively splicing to form two protein products: SCF-M1 and SCF-M2 (2;3). SCF-M1 has the major proteolytic cleavage site that generates soluble SCF, while SCF-M2 does not have the major proteolytic site (3). SCF-M2 can be processed at other proteolytic sites with less efficiency (2). Soluble SCF consists of a region of the protein between the signal sequence and the transmembrane domain. Soluble SCF mediates cell migration, while the membrane-bound SCF mediates cell survival (4;5).

 

SCF functions as a noncovalent homodimer to activate KIT [see the record for Pretty2; (6-9)]. The crystal structure of the ectodomain of KIT, with and without bound SCF, reveals that SCF interacts with the first, second and third Ig domains of KIT [Figure 4; PDB ID: 2E9W; [(10)], in agreement with earlier data based on the structure of SCF alone (11). The main region for SCF binding resides in the second KIT Ig domain, and binding is mediated by complementary electrostatic interactions between SCF and KIT (10). Upon ligand binding, the fourth and fifth Ig domains of two neighboring KIT ectodomains are brought closer together, stabilizing the interaction between two receptor molecules (10). Based on these data, it was proposed that KIT receptor dimerization is driven by binding of the SCF homodimer, whose exclusive function is to bring two KIT molecules together (10). Dimerization induces reorientation of the fourth and fifth Ig domains, enabling their lateral interaction and stabilization of the dimer.

 

The mooyah mutation is predicted to result in a frame-shifted protein product beginning after amino acid 238 of the protein, and terminating after the inclusion of 27 aberrant amino acids. The region affected by the mutation is within the cytoplasmic domain of membrane-associated SCF.

Expression/Localization

SCF is widely expressed during embryogenesis; it is detected in brain, endothelium, gametes, heart, kidney, lung, melanocytes, skin, and the stromal cells of the bone marrow, liver, and thymus (12).

 

During inflammation, fibroblasts, mature mast cells, endothelial cells, and eosinophil granulocytes can produce SCF (13).

Background

Figure 3. Binding partners use SH2 or other phosphotyrosine binding domains to interact with specific phosphotyrosine residues on activated KIT.  Schematic of several KIT interactors and the phosphorylated tyrosine residues to which they bind (numbering corresponds to human KIT).  

SCF/KIT-associated signaling mediates hematopoiesis, melanogenesis, and gametogenesis (1;14). Signal transduction from KIT begins with the binding of an SCF homodimer, which leads to receptor dimerization and activation of receptor tyrosine kinase activity. Receptor autophosphorylation creates binding sites for SH2-containing and phosphotyrosine-binding proteins. KIT also phosphorylates substrate proteins that are recruited to the signaling complex. Many signaling molecules have been identified as binding partners for specific phosphotyrosine residues on activated KIT (Figure 5). These include the p85 subunit of phosphatidylinositol 3’ kinase (PI3K), phospholipase Cγ, and the Grb2 and Grb7 adaptors [reviewed in (12)]. Src family kinases and the protein tyrosine phosphatases SHP-1 and SHP-2 are also reported to associate with KIT (12).

 

Mutations in KITL (alternatively, KITLG) in humans are associated with unilateral or asymmetric autosomal dominant deafness-69 [OMIM: #616697; (15)], familial progressive hyperpigmentation with or without hypopigmentation [FPHH; OMIM: #145250; (16;17)], and skin/hair/eye pigmentation-7, blond/brown hair [OMIM: #611664; (18;19)]. Patients with FPHH exhibit diffuse hyperpigmentation of variable intensity sometimes associated with cafe-au-lait macules and larger hypopigmented ash-leaf macules. Loss-of-function mutations in KIT result in piebaldism (20) (OMIM #172800), an autosomal dominant disease characterized by a white forelock and large, non-pigmented patches on the forehead, eyebrows, chin, chest, abdomen and extremities. Mutations in Kitl and Kit increase the number and migration of primordial germ cells causing impaired fertility.

 

Kitl knockout and mutant mouse models (MGI) exhibit variable hypopigmentation and/or white spotting of the fur, abnormal foot and ear pigmentation, and normal eye pigmentation (6;21-30). Some models also exhibited reduced body weights, reduced male and female fertility, reduced numbers of primordial germ cells, macrocytic anemia, decreased hematocrit, reduced numbers of erythrocytes and mast cells, reduced hemoglobin content, increased mean corpuscular hemoglobin, increased mean corpuscular volume, reduced bone mineral content and density, thymus atrophy, progressive ulcerative dermatitis, and increased incidence of testicular teratomas (6;21;22;24;25;27;28;30-41). Some mutations also resulted in pre-, peri- or postnatal lethality [MGI; (24;25;31;33;34;40;42)].

Putative Mechanism

The mooyah mutation is not predicted to affect the cleavage of SCF, but may reduce the amount of SCF on the cell surface (43-46). Reduced cell surface expression of SCF results in reduced numbers of SCF-dependent mastocytes, germ cells, and melanocytes.

Primers

PCR Primer
mooyah_pcr_F: TGCTAAAAGACAAGCACCGG
mooyah_pcr_R: AATGTGCCTTCCCAGACACTATTC

Sequencing Primer
mooyah_seq_F: GTGACGGTGGCTCAGTTGC
mooyah_seq_R: GCCTTCCCAGACACTATTCATAGG

Genotyping

Genotyping is performed by amplifying the region containing the mutation using PCR, followed by sequencing of the amplified region to detect the mutation.
 

PCR Primers

R51350056_PCR_F: 5’- TGCTAAAAGACAAGCACCGG-3’

R51350056_PCR_R: 5’- AATGTGCCTTCCCAGACACTATTC-3’

 

Sequencing Primers

R51350056_SEQ_F: 5’- GTGACGGTGGCTCAGTTGC-3’
 

R51350056_SEQ_R: 5’- GCCTTCCCAGACACTATTCATAGG-3’
 

 

PCR program

1) 94°C             2:00

2) 94°C             0:30

3) 55°C             0:30

4) 72°C             1:00

5) repeat steps (2-4) 40X

6) 72°C             10:00

7) 4°C               hold

 

The following sequence of 424 nucleotides is amplified (NCBI RefSeq: NC_000076, chromosome 10:100088024-100088447):

 

tgctaaaaga caagcaccgg tgacggtggc tcagttgcct ttaatagtaa cagtgtagag       

tgctgacctc aagaattgca gccgtcactg gggtttctac aataggtgtc actctttttg      

tttttccaga agaaacagtc aagtcttaca agggcagttg aaaatataca gattaatgaa      

gaggataatg agataaggta ttttgttctc ctaactgtgt gctccaacaa gcttggtgtc      

gtcctttctc atgctgtgcc tatgcaggac tctaacatct gtagggaggt gttctttaag      

gagatgttcc gagatgggct gcacctccca ttcagtgtgt tccagatgtg tcgtaatttc      

tggccttcca ctgtgtcttc actcttacgt ctttacctat gaatagtgtc tgggaaggca      

catt

  

Primer binding sites are underlined and the sequencing primer is highlighted; the mutated nucleotide is shown in red text (Chr. (+) = T>C).

References

  1. Martin, F. H., Suggs, S. V., Langley, K. E., Lu, H. S., Ting, J., Okino, K. H., Morris, C. F., McNiece, I. K., Jacobsen, F. W., and Mendiaz, E. A. (1990) Primary Structure and Functional Expression of Rat and Human Stem Cell Factor DNAs. Cell. 63, 203-211.

  2. Huang, E. J., Nocka, K. H., Buck, J., and Besmer, P. (1992) Differential Expression and Processing of Two Cell Associated Forms of the Kit-Ligand: KL-1 and KL-2. Mol Biol Cell. 3, 349-362.

  3. Flanagan, J. G., Chan, D. C., and Leder, P. (1991) Transmembrane Form of the Kit Ligand Growth Factor is Determined by Alternative Splicing and is Missing in the Sld Mutant. Cell. 64, 1025-1035.

  4. Tajima, Y., Moore, M. A., Soares, V., Ono, M., Kissel, H., and Besmer, P. (1998) Consequences of Exclusive Expression in Vivo of Kit-Ligand Lacking the Major Proteolytic Cleavage Site. Proc Natl Acad Sci U S A. 95, 11903-11908.

  5. Wehrle-Haller, B., and Weston, J. A. (1995) Soluble and Cell-Bound Forms of Steel Factor Activity Play Distinct Roles in Melanocyte Precursor Dispersal and Survival on the Lateral Neural Crest Migration Pathway. Development. 121, 731-742.

  6. Huang, E. J., Nocka, K. H., Buck, J., and Besmer, P. (1992) Differential Expression and Processing of Two Cell Associated Forms of the Kit-Ligand: KL-1 and KL-2. Mol Biol Cell. 3, 349-362.

  7. Huang, E., Nocka, K., Beier, D. R., Chu, T. Y., Buck, J., Lahm, H. W., Wellner, D., Leder, P., and Besmer, P. (1990) The Hematopoietic Growth Factor KL is Encoded by the Sl Locus and is the Ligand of the c-Kit Receptor, the Gene Product of the W Locus. Cell. 63, 225-233.

  8. Martin, F. H., Suggs, S. V., Langley, K. E., Lu, H. S., Ting, J., Okino, K. H., Morris, C. F., McNiece, I. K., Jacobsen, F. W., Mendiaz, E. A., et al. (1990) Primary Structure and Functional Expression of Rat and Human Stem Cell Factor DNAs. Cell. 63, 203-211.

  9. Williams, D. E., Eisenman, J., Baird, A., Rauch, C., Van, N. K., March, C. J., Park, L. S., Martin, U., Mochizuki, D. Y., Boswell, H. S., et al. (1990) Identification of a Ligand for the c-Kit Proto-Oncogene. Cell. 63, 167-174.

  10. Yuzawa, S., Opatowsky, Y., Zhang, Z., Mandiyan, V., Lax, I., and Schlessinger, J. (2007) Structural Basis for Activation of the Receptor Tyrosine Kinase KIT by Stem Cell Factor. Cell. 130, 323-334.

  11. Zhang, Z., Zhang, R., Joachimiak, A., Schlessinger, J., and Kong, X. P. (2000) Crystal Structure of Human Stem Cell Factor: Implication for Stem Cell Factor Receptor Dimerization and Activation. Proc Natl Acad Sci U S A. 97, 7732-7737.

  12. Roskoski, R.,Jr. (2005) Signaling by Kit Protein-Tyrosine Kinase--the Stem Cell Factor Receptor. Biochem Biophys Res Commun. 337, 1-13.

  13. Shen, S. Q., Wang, R., and Huang, S. G. (2017) Expression of the Stem Cell Factor in Fibroblasts, Endothelial Cells, and Macrophages in Periapical Tissues in Human Chronic Periapical Diseases. Genet Mol Res. 16, 10.4238/gmr16019394.

  14. Besmer, P., Manova, K., Duttlinger, R., Huang, E. J., Packer, A., Gyssler, C., and Bachvarova, R. F. (1993) The Kit-Ligand (Steel Factor) and its Receptor c-kit/W: Pleiotropic Roles in Gametogenesis and Melanogenesis. Dev Suppl. , 125-137.

  15. Zazo Seco, C., Serrao de Castro, L., van Nierop, J. W., Morin, M., Jhangiani, S., Verver, E. J., Schraders, M., Maiwald, N., Wesdorp, M., Venselaar, H., Spruijt, L., Oostrik, J., Schoots, J., Baylor-Hopkins Center for Mendelian Genomics, van Reeuwijk, J., Lelieveld, S. H., Huygen, P. L., Insenser, M., Admiraal, R. J., Pennings, R. J., Hoefsloot, L. H., Arias-Vasquez, A., de Ligt, J., Yntema, H. G., Jansen, J. H., Muzny, D. M., Huls, G., van Rossum, M. M., Lupski, J. R., Moreno-Pelayo, M. A., Kunst, H. P., and Kremer, H. (2015) Allelic Mutations of KITLG, Encoding KIT Ligand, Cause Asymmetric and Unilateral Hearing Loss and Waardenburg Syndrome Type 2. Am J Hum Genet. 97, 647-660.

  16. Wang, Z. Q., Si, L., Tang, Q., Lin, D., Fu, Z., Zhang, J., Cui, B., Zhu, Y., Kong, X., Deng, M., Xia, Y., Xu, H., Le, W., Hu, L., and Kong, X. (2009) Gain-of-Function Mutation of KIT Ligand on Melanin Synthesis Causes Familial Progressive Hyperpigmentation. Am J Hum Genet. 84, 672-677.

  17. Amyere, M., Vogt, T., Hoo, J., Brandrup, F., Bygum, A., Boon, L., and Vikkula, M. (2011) KITLG Mutations Cause Familial Progressive Hyper- and Hypopigmentation. J Invest Dermatol. 131, 1234-1239.

  18. Sulem, P., Gudbjartsson, D. F., Stacey, S. N., Helgason, A., Rafnar, T., Magnusson, K. P., Manolescu, A., Karason, A., Palsson, A., Thorleifsson, G., Jakobsdottir, M., Steinberg, S., Palsson, S., Jonasson, F., Sigurgeirsson, B., Thorisdottir, K., Ragnarsson, R., Benediktsdottir, K. R., Aben, K. K., Kiemeney, L. A., Olafsson, J. H., Gulcher, J., Kong, A., Thorsteinsdottir, U., and Stefansson, K. (2007) Genetic Determinants of Hair, Eye and Skin Pigmentation in Europeans. Nat Genet. 39, 1443-1452.

  19. Miller, C. T., Beleza, S., Pollen, A. A., Schluter, D., Kittles, R. A., Shriver, M. D., and Kingsley, D. M. (2007) Cis-Regulatory Changes in Kit Ligand Expression and Parallel Evolution of Pigmentation in Sticklebacks and Humans. Cell. 131, 1179-1189.

  20. Giebel, L. B., and Spritz, R. A. (1991) Mutation of the KIT (mast/stem Cell Growth Factor Receptor) Protooncogene in Human Piebaldism. Proc Natl Acad Sci U S A. 88, 8696-8699.

  21. Graw, J., Loster, J., Neuhauser-Klaus, A., Pretsch, W., and Schmitt-John, T. (1996) Molecular Analysis of Two New Steel Mutations in Mice shows a Transversion Or an Insertion. Mamm Genome. 7, 843-846.

  22. Graw, J., Neuhauser-Klaus, A., and Pretsch, W. (1997) Detection of a Point Mutation (A to G) in Exon 5 of the Murine Mgf Gene Defines a Novel Allele at the Steel Locus with a Weak Phenotype. Mutat Res. 382, 75-78.

  23. Kuroda, H., Terada, N., Nakayama, H., Matsumoto, K., and Kitamura, Y. (1988) Infertility due to Growth Arrest of Ovarian Follicles in Sl/Slt Mice. Dev Biol. 126, 71-79.

  24. Chandra, S., Kapur, R., Chuzhanova, N., Summey, V., Prentice, D., Barker, J., Cooper, D. N., and Williams, D. A. (2003) A Rare Complex DNA Rearrangement in the Murine Steel Gene Results in Exon Duplication and a Lethal Phenotype. Blood. 102, 3548-3555.

  25. Rajaraman, S., Davis, W. S., Mahakali-Zama, A., Evans, H. K., Russell, L. B., and Bedell, M. A. (2002) An Allelic Series of Mutations in the Kit Ligand Gene of Mice. II. Effects of Ethylnitrosourea-Induced Kitl Point Mutations on Survival and Peripheral Blood Cells of Kitl(Steel) Mice. Genetics. 162, 341-353.

  26. Nolan, P. M., Peters, J., Strivens, M., Rogers, D., Hagan, J., Spurr, N., Gray, I. C., Vizor, L., Brooker, D., Whitehill, E., Washbourne, R., Hough, T., Greenaway, S., Hewitt, M., Liu, X., McCormack, S., Pickford, K., Selley, R., Wells, C., Tymowska-Lalanne, Z., Roby, P., Glenister, P., Thornton, C., Thaung, C., Stevenson, J. A., Arkell, R., Mburu, P., Hardisty, R., Kiernan, A., Erven, A., Steel, K. P., Voegeling, S., Guenet, J. L., Nickols, C., Sadri, R., Nasse, M., Isaacs, A., Davies, K., Browne, M., Fisher, E. M., Martin, J., Rastan, S., Brown, S. D., and Hunter, J. (2000) A Systematic, Genome-Wide, Phenotype-Driven Mutagenesis Programme for Gene Function Studies in the Mouse. Nat Genet. 25, 440-443.

  27. Bedell, M. A., Brannan, C. I., Evans, E. P., Copeland, N. G., Jenkins, N. A., and Donovan, P. J. (1995) DNA Rearrangements Located Over 100 Kb 5' of the Steel (Sl)-Coding Region in Steel-Panda and Steel-Contrasted Mice Deregulate Sl Expression and Cause Female Sterility by Disrupting Ovarian Follicle Development. Genes Dev. 9, 455-470.

  28. Brannan, C. I., Lyman, S. D., Williams, D. E., Eisenman, J., Anderson, D. M., Cosman, D., Bedell, M. A., Jenkins, N. A., and Copeland, N. G. (1991) Steel-Dickie Mutation Encodes a c-Kit Ligand Lacking Transmembrane and Cytoplasmic Domains. Proc Natl Acad Sci U S A. 88, 4671-4674.

  29. Kohrogi, T., Yokoyama, M., Taguchi, T., Kitamura, Y., and Tutikawa, K. (1983) Effect of the Slt Mutant Allele on the Production of Tissue Mast Cells in Mice. J Hered. 74, 375-377.

  30. Deshpande, S., Agosti, V., Manova, K., Moore, M. A., Hardy, M. P., and Besmer, P. (2010) Kit Ligand Cytoplasmic Domain is Essential for Basolateral Sorting in Vivo and has Roles in Spermatogenesis and Hematopoiesis. Dev Biol. 337, 199-210.

  31. Kales, A. N., Fried, W., and Gurney, C. W. (1966) Mechanism of the Hereditary Anemia of Slm Mutant Mice. Blood. 28, 387-397.

  32. Mahakali Zama, A., Hudson, F. P.,3rd, and Bedell, M. A. (2005) Analysis of Hypomorphic KitlSl Mutants Suggests Different Requirements for KITL in Proliferation and Migration of Mouse Primordial Germ Cells. Biol Reprod. 73, 639-647.

  33. Rajaraman, S., Wood, L. K., Willhite, D. K., Russell, L. B., and Bedell, M. A. (2003) Effects of Spontaneous KitlSteel Mutations on Survival and Red Blood Cells of Mice. Mamm Genome. 14, 168-174.

  34. Bedell, M. A., Cleveland, L. S., O'Sullivan, T. N., Copeland, N. G., and Jenkins, N. A. (1996) Deletion and Interallelic Complementation Analysis of Steel Mutant Mice. Genetics. 142, 935-944.

  35. Brannan, C. I., Bedell, M. A., Resnick, J. L., Eppig, J. J., Handel, M. A., Williams, D. E., Lyman, S. D., Donovan, P. J., Jenkins, N. A., and Copeland, N. G. (1992) Developmental Abnormalities in Steel17H Mice Result from a Splicing Defect in the Steel Factor Cytoplasmic Tail. Genes Dev. 6, 1832-1842.

  36. Kitamura, Y., and Go, S. (1979) Decreased Production of Mast Cells in S1/S1d Anemic Mice. Blood. 53, 492-497.

  37. Lotinun, S., Evans, G. L., Turner, R. T., and Oursler, M. J. (2005) Deletion of Membrane-Bound Steel Factor Results in Osteopenia in Mice. J Bone Miner Res. 20, 644-652.

  38. Sundberg, J. P., Kenty, G. A., Beamer, W. G., and Adkison, D. L. (1992) Forestomach Papillomas in Flaky Skin and Steel-Dickie Mutant Mice. J Vet Diagn Invest. 4, 312-317.

  39. McCoshen, J. A., and McCallion, D. J. (1975) A Study of the Primordial Germ Cells during their Migratory Phase in Steel Mutant Mice. Experientia. 31, 589-590.

  40. Sarvella, P. A., and Russell, L. B. (1956) Steel, a New Dominant Gene in the House Mouse. J Hered. 47, 123-128.

  41. Stevens, L. C., and Mackensen, J. A. (1961) Genetic and Environmental Influences on Teratocarcinogenesis in Mice. J Natl Cancer Inst. 27, 443-453.

  42. Murphy, E. D. (1977) Effects of Mutant Steel Alleles on Leukemogenesis and Life-Span in the Mouse. J Natl Cancer Inst. 58, 107-110.

  43. Cheng, H. J., and Flanagan, J. G. (1994) Transmembrane Kit Ligand Cleavage does Not Require a Signal in the Cytoplasmic Domain and Occurs at a Site Dependent on Spacing from the Membrane. Mol Biol Cell. 5, 943-953.

  44. Tajima, Y., Huang, E. J., Vosseller, K., Ono, M., Moore, M. A., and Besmer, P. (1998) Role of Dimerization of the Membrane-Associated Growth Factor Kit Ligand in Juxtacrine Signaling: The Sl17H Mutation Affects Dimerization and Stability-Phenotypes in Hematopoiesis. J Exp Med. 187, 1451-1461.

  45. Wehrle-Haller, B., and Weston, J. A. (1999) Altered Cell-Surface Targeting of Stem Cell Factor Causes Loss of Melanocyte Precursors in Steel17H Mutant Mice. Dev Biol. 210, 71-86.

  46. Paulhe, F., Imhof, B. A., and Wehrle-Haller, B. (2004) A Specific Endoplasmic Reticulum Export Signal Drives Transport of Stem Cell Factor (Kitl) to the Cell Surface. J Biol Chem. 279, 55545-55555.