Phenotypic Mutation 'mooyah' (pdf version)
List |< first << previous [record 16 of 74] next >> last >|
Allelemooyah
Mutation Type critical splice donor site
Chromosome10
Coordinate100,088,222 bp (GRCm38)
Base Change T ⇒ C (forward strand)
Gene Kitl
Gene Name kit ligand
Synonym(s) Gb, grizzle-belly, Mgf, SCF, SF, Sl, SLF, Steel, Steel factor, stem cell factor
Chromosomal Location 100,015,630-100,100,416 bp (+)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the ligand of the tyrosine-kinase receptor encoded by the KIT locus. This ligand is a pleiotropic factor that acts in utero in germ cell and neural cell development, and hematopoiesis, all believed to reflect a role in cell migration. In adults, it functions pleiotropically, while mostly noted for its continued requirement in hematopoiesis. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mutations in this gene affect migration of embryonic stem cells and cause similar phenotypes to mutations in its receptor gene (Kit). Mutants show mild to severe defects in pigmentation, hemopoiesis and reproduction. [provided by MGI curators]
Accession Number

NCBI RefSeq: NM_013598, NM_001347156; MGI:96974

Mapped Yes 
Amino Acid Change
Institutional SourceBeutler Lab
Gene Model predicted gene model for protein(s): [ENSMUSP00000020129] [ENSMUSP00000100920] [ENSMUSP00000151554]
PDB Structure
Structure of a class III RTK signaling assembly [X-RAY DIFFRACTION]
Structure of a class III RTK signaling assembly [X-RAY DIFFRACTION]
SMART Domains Protein: ENSMUSP00000020129
Gene: ENSMUSG00000019966

DomainStartEndE-ValueType
Pfam:SCF 1 176 5.7e-102 PFAM
Pfam:SCF 173 245 1.7e-36 PFAM
Predicted Effect probably null
SMART Domains Protein: ENSMUSP00000100920
Gene: ENSMUSG00000019966

DomainStartEndE-ValueType
Pfam:SCF 1 273 2.3e-157 PFAM
Predicted Effect probably null
Predicted Effect probably null
Phenotypic Category
Phenotypequestion? Literature verified References
pigmentation
skin/coat/nails
Penetrance  
Alleles Listed at MGI

All Mutations and Alleles(79) : Chemically and radiation induced(8) Chemically induced (ENU)(15) Chemically induced (other)(1) Gene trapped(4) Radiation induced(15) Spontaneous(21) Targeted(10) Transgenic(5)

Lab Alleles
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00823:Kitl APN 10 100087344 splice site probably benign
IGL02066:Kitl APN 10 100076882 missense probably damaging 1.00
IGL03211:Kitl APN 10 100080859 missense probably benign 0.19
gregory UTSW 10 100076906 critical splice donor site probably null
sandycheeks UTSW 10 100076906 critical splice donor site
R0131:Kitl UTSW 10 100087364 missense probably benign 0.11
R0131:Kitl UTSW 10 100087364 missense probably benign 0.11
R0132:Kitl UTSW 10 100087364 missense probably benign 0.11
R1554:Kitl UTSW 10 100087438 missense probably benign 0.38
R1649:Kitl UTSW 10 100064114 missense probably benign 0.03
R2194:Kitl UTSW 10 100016037 critical splice donor site probably null
R2254:Kitl UTSW 10 100080131 critical splice donor site probably null
R4877:Kitl UTSW 10 100080866 missense probably damaging 1.00
R5135:Kitl UTSW 10 100088222 critical splice donor site probably null
R5453:Kitl UTSW 10 100087385 missense probably damaging 1.00
R5564:Kitl UTSW 10 100080024 missense possibly damaging 0.89
R5832:Kitl UTSW 10 100080020 missense probably damaging 1.00
R5971:Kitl UTSW 10 100076906 critical splice donor site probably null
R6043:Kitl UTSW 10 100064085 missense probably damaging 1.00
R6067:Kitl UTSW 10 100076906 critical splice donor site probably null
R6138:Kitl UTSW 10 100076906 critical splice donor site probably null
R6255:Kitl UTSW 10 100089233 makesense probably null
R6450:Kitl UTSW 10 100087394 start codon destroyed probably null 0.00
R6588:Kitl UTSW 10 100064092 missense probably damaging 1.00
R6951:Kitl UTSW 10 100051852 missense probably damaging 1.00
U15987:Kitl UTSW 10 100076906 critical splice donor site probably null
Mode of Inheritance Autosomal Recessive
Local Stock
Repository
Last Updated 2018-08-06 2:00 PM by Anne Murray
Record Created 2016-10-05 2:05 PM by Carlos Reyna
Record Posted 2018-04-24
Phenotypic Description
Figure 1. The mooyah mice exhibit predominantly white fur with black spots.

The mooyah phenotype was identified among N-ethyl-N-nitrosourea (ENU)-mutagenized G3 mice of the pedigree R5135, some of which had predominantly white fur with black spots (Figure 1).

Nature of Mutation
Figure 2. Linkage mapping of the pigmentation phenotype using a recessive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 85 mutations (X-axis) identified in the G1 male of pedigree R5135. Binary phenotype data are shown for single locus linkage analysis without consideration of G2 dam identity. Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 85 mutations. The pigmentation phenotype was linked to a mutation in Kitl: a T to C transition at base pair 100,088,222 (v38) on chromosome 10, or base pair 72,588 in the GenBank genomic region NC_000076 in the splice donor site of intron 8. Linkage was found with a recessive model of inheritance (P = 0.000105), wherein three affected mice were homozygous for the variant allele, and 28 unaffected mice were either heterozygous (N = 17) or homozygous for the reference allele (N = 11) (Figure 2).

 

The effect of the mutation at the cDNA and protein levels have not examined, but the mutation is predicted to result in skipping of the 68-nucleotide exon 8 (out of 10 total exons), resulting in a frame-shifted protein product beginning after amino acid 238 of the protein, and terminating after the inclusion of 27 aberrant amino acids.

 

           <--exon 7     <--exon 8 intron 8-->         exon 9-->

71811 ……TTATACTGGAAG ……AATGAGATAAG gtattttgttctcctaa…… TATGTTGCAACA……AGTGGCTGGTAA…… 
235   ……-L--Y--W--K- ……-N--E--I--S                     -Y--V--A--T-……-S--G--W--*-

          correct        deleted                                 aberrant

 

Genomic numbering corresponds to NC_000076. The donor splice site of intron 8, which is destroyed by the Mooyah mutation, is indicated in blue lettering and the mutated nucleotide is indicated in red. 

Protein Prediction

Figure 3. Domain structure of SCF. The moooyah mutation results in a T to C transition in the splice donor site of intron 8. The location of other Kitl mutations is indicated; click to view more information about these mutations. Abbreviations: SP, signal peptide; TM, transmembrane domain.

Figure 2. Crystal structure of the KIT/SCF complex. The KIT extracellular domains are shown in blue, while the two SCF molecules are shown in green. β-strands are represented by arrows and α-helices by coils. UCSF Chimera model is based on PDB 2E9W, Yuzawa et al., Cell. 130, 232-334 (2007). Click on the 3D structure to view it rotate.

Kitl encodes stem cell factor (SCF; alternatively, Kit ligand [KL], Steel, Steel factor, or mast cell growth factor [MGF]). SCF has an N-terminal signal sequence and a putative transmembrane domain near the C-terminus [Figure 3; (1)].

 

Kitl undergoes alternatively splicing to form two protein products: SCF-M1 and SCF-M2 (2;3). SCF-M1 has the major proteolytic cleavage site that generates soluble SCF, while SCF-M2 does not have the major proteolytic site (3). SCF-M2 can be processed at other proteolytic sites with less efficiency (2). Soluble SCF consists of a region of the protein between the signal sequence and the transmembrane domain. Soluble SCF mediates cell migration, while the membrane-bound SCF mediates cell survival (4;5).

 

SCF functions as a noncovalent homodimer to activate KIT [see the record for Pretty2; (6-9)]. The crystal structure of the ectodomain of KIT, with and without bound SCF, reveals that SCF interacts with the first, second and third Ig domains of KIT [Figure 4; PDB ID: 2E9W; [(10)], in agreement with earlier data based on the structure of SCF alone (11). The main region for SCF binding resides in the second KIT Ig domain, and binding is mediated by complementary electrostatic interactions between SCF and KIT (10). Upon ligand binding, the fourth and fifth Ig domains of two neighboring KIT ectodomains are brought closer together, stabilizing the interaction between two receptor molecules (10). Based on these data, it was proposed that KIT receptor dimerization is driven by binding of the SCF homodimer, whose exclusive function is to bring two KIT molecules together (10). Dimerization induces reorientation of the fourth and fifth Ig domains, enabling their lateral interaction and stabilization of the dimer.

 

The mooyah mutation is predicted to result in a frame-shifted protein product beginning after amino acid 238 of the protein, and terminating after the inclusion of 27 aberrant amino acids. The region affected by the mutation is within the cytoplasmic domain of membrane-associated SCF.

Expression/Localization

SCF is widely expressed during embryogenesis; it is detected in brain, endothelium, gametes, heart, kidney, lung, melanocytes, skin, and the stromal cells of the bone marrow, liver, and thymus (12).

 

During inflammation, fibroblasts, mature mast cells, endothelial cells, and eosinophil granulocytes can produce SCF (13).

Background
Figure 3. Binding partners use SH2 or other phosphotyrosine binding domains to interact with specific phosphotyrosine residues on activated KIT.  Schematic of several KIT interactors and the phosphorylated tyrosine residues to which they bind (numbering corresponds to human KIT).  

SCF/KIT-associated signaling mediates hematopoiesis, melanogenesis, and gametogenesis (1;14). Signal transduction from KIT begins with the binding of an SCF homodimer, which leads to receptor dimerization and activation of receptor tyrosine kinase activity. Receptor autophosphorylation creates binding sites for SH2-containing and phosphotyrosine-binding proteins. KIT also phosphorylates substrate proteins that are recruited to the signaling complex. Many signaling molecules have been identified as binding partners for specific phosphotyrosine residues on activated KIT (Figure 5). These include the p85 subunit of phosphatidylinositol 3’ kinase (PI3K), phospholipase Cγ, and the Grb2 and Grb7 adaptors [reviewed in (12)]. Src family kinases and the protein tyrosine phosphatases SHP-1 and SHP-2 are also reported to associate with KIT (12).

 

Mutations in KITL (alternatively, KITLG) in humans are associated with unilateral or asymmetric autosomal dominant deafness-69 [OMIM: #616697; (15)], familial progressive hyperpigmentation with or without hypopigmentation [FPHH; OMIM: #145250; (16;17)], and skin/hair/eye pigmentation-7, blond/brown hair [OMIM: #611664; (18;19)]. Patients with FPHH exhibit diffuse hyperpigmentation of variable intensity sometimes associated with cafe-au-lait macules and larger hypopigmented ash-leaf macules. Loss-of-function mutations in KIT result in piebaldism (20) (OMIM #172800), an autosomal dominant disease characterized by a white forelock and large, non-pigmented patches on the forehead, eyebrows, chin, chest, abdomen and extremities. Mutations in Kitl and Kit increase the number and migration of primordial germ cells causing impaired fertility.

 

Kitl knockout and mutant mouse models (MGI) exhibit variable hypopigmentation and/or white spotting of the fur, abnormal foot and ear pigmentation, and normal eye pigmentation (6;21-30). Some models also exhibited reduced body weights, reduced male and female fertility, reduced numbers of primordial germ cells, macrocytic anemia, decreased hematocrit, reduced numbers of erythrocytes and mast cells, reduced hemoglobin content, increased mean corpuscular hemoglobin, increased mean corpuscular volume, reduced bone mineral content and density, thymus atrophy, progressive ulcerative dermatitis, and increased incidence of testicular teratomas (6;21;22;24;25;27;28;30-41). Some mutations also resulted in pre-, peri- or postnatal lethality [MGI; (24;25;31;33;34;40;42)].

Putative Mechanism

The mooyah mutation is not predicted to affect the cleavage of SCF, but may reduce the amount of SCF on the cell surface (43-46). Reduced cell surface expression of SCF results in reduced numbers of SCF-dependent mastocytes, germ cells, and melanocytes.

Primers PCR Primer
mooyah(F):5'- TGCTAAAAGACAAGCACCGG -3'
mooyah(R):5'- AATGTGCCTTCCCAGACACTATTC -3'

Sequencing Primer
mooyah_seq(F):5'- GTGACGGTGGCTCAGTTGC -3'
mooyah_seq(R):5'- GCCTTCCCAGACACTATTCATAGG -3'
Genotyping

Genotyping is performed by amplifying the region containing the mutation using PCR, followed by sequencing of the amplified region to detect the mutation.
 

PCR Primers

R51350056_PCR_F: 5’- TGCTAAAAGACAAGCACCGG-3’

R51350056_PCR_R: 5’- AATGTGCCTTCCCAGACACTATTC-3’

 

Sequencing Primers

R51350056_SEQ_F: 5’- GTGACGGTGGCTCAGTTGC-3’
 

R51350056_SEQ_R: 5’- GCCTTCCCAGACACTATTCATAGG-3’
 

 

PCR program

1) 94°C             2:00

2) 94°C             0:30

3) 55°C             0:30

4) 72°C             1:00

5) repeat steps (2-4) 40X

6) 72°C             10:00

7) 4°C               hold

 

The following sequence of 424 nucleotides is amplified (NCBI RefSeq: NC_000076, chromosome 10:100088024-100088447):

 

tgctaaaaga caagcaccgg tgacggtggc tcagttgcct ttaatagtaa cagtgtagag       

tgctgacctc aagaattgca gccgtcactg gggtttctac aataggtgtc actctttttg      

tttttccaga agaaacagtc aagtcttaca agggcagttg aaaatataca gattaatgaa      

gaggataatg agataaggta ttttgttctc ctaactgtgt gctccaacaa gcttggtgtc      

gtcctttctc atgctgtgcc tatgcaggac tctaacatct gtagggaggt gttctttaag      

gagatgttcc gagatgggct gcacctccca ttcagtgtgt tccagatgtg tcgtaatttc      

tggccttcca ctgtgtcttc actcttacgt ctttacctat gaatagtgtc tgggaaggca      

catt

  

Primer binding sites are underlined and the sequencing primer is highlighted; the mutated nucleotide is shown in red text (Chr. (+) = T>C).

References
  40. Sarvella, P. A., and Russell, L. B. (1956) Steel, a New Dominant Gene in the House Mouse. J Hered. 47, 123-128.
  41. Stevens, L. C., and Mackensen, J. A. (1961) Genetic and Environmental Influences on Teratocarcinogenesis in Mice. J Natl Cancer Inst. 27, 443-453.
Science Writers Anne Murray
Illustrators Diantha La Vine
AuthorsCarlos Reyna, Jamie Russell, and Bruce Beutler
List |< first << previous [record 16 of 74] next >> last >|