Phenotypic Mutation 'clip' (pdf version)
List |< first << previous [record 20 of 132] next >> last >|
Alleleclip
Mutation Type nonsense
Chromosome3
Coordinate95,545,384 bp (GRCm38)
Base Change C ⇒ T (forward strand)
Gene Ctss
Gene Name cathepsin S
Synonym(s) Cat S
Chromosomal Location 95,526,786-95,556,403 bp (+)
MGI Phenotype FUNCTION: This gene encodes a member of the peptidase C1 (papain) family of cysteine proteases. Alternative splicing results in multiple transcript variants, which encode preproproteins that are proteolytically processed to generate mature protein products. This enzyme is secreted by antigen-presenting cells during inflammation and may induce pain and itch via activation of G-protein coupled receptors. Homozygous knockout mice for this gene exhibit impaired wound healing, reduced tumorigenesis in a pancreatic cancer model, and reduced pathogenesis in a myasthenia gravis model. [provided by RefSeq, Aug 2015]
PHENOTYPE: Homozygous null mice are resistant to the development of experimental autoimmune myasthenia gravis and showed reduced T and B cell responses to acetylcholine receptor. [provided by MGI curators]
Accession Number

NCBI RefSeq: NM_001267695 (variant 1), NM_021281 (variant 2); MGI:107341

Mapped Yes 
Limits of the Critical Region 95526786 - 95556400 bp
Amino Acid Change
Institutional SourceBeutler Lab
Gene Model predicted gene model for protein(s): [ENSMUSP00000015667] [ENSMUSP00000112006]
SMART Domains Protein: ENSMUSP00000015667
Gene: ENSMUSG00000038642
AA Change: Q160*

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Inhibitor_I29 39 99 2.3e-27 SMART
Pept_C1 126 342 2.3e-122 SMART
Predicted Effect probably null
SMART Domains Protein: ENSMUSP00000112006
Gene: ENSMUSG00000038642
AA Change: Q159*

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Inhibitor_I29 36 96 3.01e-23 SMART
Pept_C1 123 339 6.79e-120 SMART
Predicted Effect probably null
Phenotypic Category
Phenotypequestion? Literature verified References
T-dependent humoral response defect- decreased antibody response to OVA+ alum immunization
TLR signaling defect: hypersensitivity to PAM3CSK4
TLR signaling defect: TNF production by macrophages
Penetrance  
Alleles Listed at MGI

All Mutations and Alleles(15) : Chemically induced (other)(1) Gene trapped(7) Radiation induced(1) Targeted(5) Transgenic(1)

Lab Alleles
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01140:Ctss APN 3 95538725 missense probably damaging 1.00
IGL02162:Ctss APN 3 95546821 missense probably benign 0.26
IGL03026:Ctss APN 3 95538830 missense probably benign 0.01
IGL03219:Ctss APN 3 95543100 missense possibly damaging 0.88
R0025:Ctss UTSW 3 95550137 missense probably damaging 1.00
R0025:Ctss UTSW 3 95550137 missense probably damaging 1.00
R0033:Ctss UTSW 3 95545577 splice site probably benign
R0033:Ctss UTSW 3 95545577 splice site probably benign
R1844:Ctss UTSW 3 95546794 critical splice acceptor site probably null
R2866:Ctss UTSW 3 95545406 missense probably benign 0.04
R4061:Ctss UTSW 3 95543034 missense probably benign 0.34
R4846:Ctss UTSW 3 95545384 nonsense probably null
R5917:Ctss UTSW 3 95543113 missense probably benign 0.00
R6443:Ctss UTSW 3 95546803 missense probably benign 0.00
R6555:Ctss UTSW 3 95543029 nonsense probably null
Mode of Inheritance Autosomal Recessive
Local Stock
Repository
Last Updated 2018-10-16 10:18 AM by Anne Murray
Record Created 2016-10-19 7:58 PM by Jin Huk Choi
Record Posted 2018-10-16
Phenotypic Description

Figure 1. Homozygous clip mice exhibit diminished T-dependent IgG responses to OVA/alum. IgG levels were determined by ELISA. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The clip phenotype was identified among N-ethyl-N-nitrosourea (ENU)-mutagenized G3 mice of the pedigree R4846, some of which showed a diminished T-dependent antibody response to ovalbumin administered with aluminum hydroxide (Figure 1). 

Nature of Mutation

Figure 2. Linkage mapping of the reduced T-dependent antibody response after OVA/alum stimulation using a recessive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 56 mutations (X-axis) identified in the G1 male of pedigree R4846. Normalized phenotype data are shown for single locus linkage analysis without consideration of G2 dam identity. Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

 

Whole exome HiSeq sequencing of the G1 grandsire identified 56 mutations. The diminished T-dependent antibody response to OVA/alum phenotype was linked by continuous variable mapping to a mutation in Ctss: a C to T transition at base pair 95,545,384 (v38) on chromosome 3, or base pair 18,599 in the GenBank genomic region NC_000069 encoding Ctss. Linkage was found with a recessive model of inheritance, wherein seven variant homozygotes departed phenotypically from 12 homozygous reference mice and 13 heterozygous mice with a P value of 9.431 x 10-7 (Figure 2).  

 

The mutation corresponds to residue 592 in the mRNA sequence NM_001267695 within exon 5 of 8 total exons and to residue 589 in the mRNA sequence NM_021281 within exon 5 of 8 total exons.

 

18584 GGGGCCCTTGAAGGGCAGCTGAAGCTGAAAACG

155   -G--A--L--E--G--Q--L--K--L--K--T- NP_001254624

154   -G--A--L--E--G--Q--L--K--L--K--T- NP_067256

 

Genomic numbering corresponds to NC_000069. The mutated nucleotide is indicated in red.  The mutation results in substitution of glutamine 160 to a premature stop codon (Q160*) in variant 1 and Q159* in variant 2 of the CTSS protein.

Protein Prediction
Figure 3. Domain organization of CTSS. The location of the clip mutation is indicated. Domain information is from SMART and UniProt.
Figure 4. Crystal structure of human Cathepsin S. Domains are colored as in Figure 3. The location of the clip mutation is noted in red. UCSF Chimera model is based on PDB:2C0Yl, Kaulman, et al. Protein Sci. 15, 2619 (2006). Click on the 3D structure to view it rotate.

Ctss encodes cathepsin S, one of 11 cysteine protease cathepsins (i.e., cathepsins B, C, F, H, K, L, O, S, V, W, and X). The cysteine cathepsins are members of the papain family. Cathepsin S contains a signal domain, a pro-peptide domain, and a mature domain (Figure 3). Cathepsin S is synthesized as an inactive zymogen in the endoplasmic reticulum. Cathepsin S requires proteolytic cleavage of the N-terminal propeptide for its activity.

 

Mature cathepsin S has a similar structure to other cathepsins (e.g., cathepsins K, L, H, and papain) (1). It is a monomer with two globular domains, and a third smaller “P” domain formed by the N-terminal part of the pro-peptide [Figure 4; PDB:2C0Yl; (2) and PDB:1GLO; (1)]. The P domain is anchored to the prosegment binding loop. The “left” globular domain is comprised of three α-helices and a hydrophobic core, while the “right” globular domain is an antiparallel β-sheet barrel enclosing a hydrophobic core with two α-helices flanking either side of the barrel (2). The interface between the globular domains provides the structure for the active-site cleft; catalytic His164-stabilizing Asn184-catalytic Cys25 comprise the catalytic triad (1).

 

The clip mutation results in substitution of glutamine 160 to a premature stop codon (Q160*) in cathepsin S; Gln160 is within the mature cathepsin S protein.

Expression/Localization

CTSS is highly expressed in the spleen, heart, and lung (3). Cathepsin S is predominantly expressed in antigen presenting cells (APCs) namely B cells, macrophages, and dendritic cells. Cathepsin S is also expressed in microglia and ‘non-professional’ APCs such as epithelial cells (4-6).

 

Cathepsin S is localized in the endosome of hematopoietic cells.

 

Cathepsin S expression is upregulated in an antigen-induced arthritis mouse model (7) as well as in obesity (8).

Background
Figure 5. Antigen presentation by MHC II. MHC II αβ heterodimers are synthesized in the endoplasmic reticulum in a complex with the invariant chain (Ii). Ii chaperones the complex to endosomes containing antigen. In the endosome, the antigen is degraded by lysosomal enzymes. Cathepsin S cleaves Ii, leaving the fragment CLIP (class II associated invariant chain peptide). The MHC-like molecule H–2M (in mice) mediates the removal of CLIP and loading of antigen peptide. The MHC II/antigen complex is trafficked to the plasma membrane to bind with T cell receptors (TCR) on T cells. 

Formation of major histocompatibility complex (MHC) class II peptide complexes begins with the synthesis of class II αβ heterodimers in the endoplasmic reticulum (Figure 5). The dimers are assembled with the assistance of the invariant chain (Ii or CD74) chaperone, subsequently forming the αβ-Ii complex. The αβ-Ii complex is delivered to endosomes, where Ii is degraded by cathepsins, permitting accessibility of the MHC II antigen-binding site. Cathepsin S is the major endoprotease that cleaves Ii from the MHC class II-Ii complex before antigen presentation in macrophages and dendritic cells; cathepsin L and cathepsin F can partially compensate for loss of cathepsin S deficiency in macrophages (9;10). Cathepsin S-mediated cleavage of Ii causes formation of 24-amino acid CLIP (class II associated invariant chain peptide) fragments. HLA-DM in humans and H-2M in mice catalyze the replacement of the MHC II-bound CLIP peptide with an extracellularly derived antigenic peptide. Inability to degrade CD74 causes accumulation of a class II-associated, 10-kD Ii fragment within endosomes, which disrupts class II trafficking, peptide complex formation, and class II-restricted antigen presentation (11). Cathepsin S also putatively functions in the cross presentation of MHC I molecules to CD8+ T cells (12). Cathepsin S also promotes epitope generation for a subset of antigens during antigen processing in antigen-presenting cell lines (13).

 

Cathepsin S has several substrates in addition to its function in MHC class II processing  (Table 1).

 

Table 1. Select cathepsin S substrates

Target

Description of target

Cathepsin S-induced effect

References

Ii (alternatively, CD74)

MHC class II chaperone

Removes Ii from MHC II to promote MHC II maturation and peptide loading

(11;13-16)

Leptin

Adipocyte-secreted hormone that regulates appetite, energy homoeostasis, body weight, neuroendocrine systems, and immune functions; see the record for potbelly

Inactivates leptin in white adipose tissue

(17)

MBP

An autoantigen in multiple sclerosis

Cathepsin degrades MBP

(18)

Rip1

Receptor involved in necroptosis

Limits macrophage necroptosis

(19)

PAR-2

G-protein coupled receptor expressed in keratinocytes and nociceptive neurons

Pain signaling through activation of transient receptor potential vanilloid 4 (TRPV4)

(20;21)

E-cadherin

Cell adhesion protein

Promotes tumor formation and angiogenesis

(22)

SLPI

Inhibitor of neutrophil elastase (see the record for Ruo)

SLPI inactivation

(23)

JAM-B

Component of tight and adherens junctions

Cathepsin S-derived blood brain barrier metastases

(24)

Collagen/elastin

Structural elements of the extracellular matrix and the basement membrane

Extracellular matrix remodeling in differentiation, wound healing, angiogenesis, metastasis, and conditions associated with inflammation

(25-29)

Laminin

Proteoglycans

Fibronectin

During adipogenesis, cathepsin S induces fibronectin degradation during the early steps of differentiation

(30)

bFGF

Matrix-derived angiogenic factors

Promotes angiogenesis and neoplastic progression

(25)

IGF

IL-36γ

Proinflammatory cytokine highly expressed in epithelial cells that is associated with psoriasis

Cathepsin S-induced cleavage activates IL-36γ

(31)

EGFR

Receptor tyrosine kinase (see the record for Velvet)

Cathepsin S regulates EGFR signaling by facilitating EGF-mediated EGFR degradation

(32)

MrgprC11

Receptor that binds select pruritogens in the periphery to mediate non-histaminergic itch

Cathepsin S-induced cleavage of MrgprC11 in nociceptive fibers evokes itch sensation in a ligand-independent manner

(33)

Endostatin

Anti-angiogenic protein

Releases a peptide from endostatin with increased angiostatic properties

(34)

Abbreviations: Ii, invariant chain; MBP, myelin basic protein; Rip1, receptor interacting protein kinase-1; PAR-2, protease-activated receptor-2; SLPI, secretory leukoprotease inhibitor; JAM-B, junctional adhesion molecule-B; bFGF, basic fibroblast growth factor; IGF, insulin growth factor; IL-36γ, interleukin 36-gamma; EGFR, epidermal growth factor receptor; MrgprC11, Mas-related G protein coupled receptor C11

 

Cathepsin S can be secreted from macrophages, smooth muscle cells, tumor cells, and endothelial cells [reviewed in (35)]. Secreted cathepsin S can remodel the extracellular matrix in several tissues through degradation of select extracellular matix proteins (Table 1). Cathepsin S can also degrade collagen fragments that are phagocytosed by fibroblasts, macrophages and smooth muscle cells. Extracellular degradation of collagen can be incomplete, leaving fragments that are phagocytosed. The phagosomes fuse with lysosomes containing cathepsins and complete the degradation.

 

Cathepsin S has putative functions in the development of several autoimmune and allergic conditions in humans, including multiple sclerosis, rheumatoid arthritis, and asthma. In addition, cathepsin S-mediated degradation of components of the extracellular matrix putatively promotes the initiation and progression of several diseases, including arthritis, atherosclerosis, and chronic obstructive pulmonary disease. Cathepsin S initiates the proteolytic processing of myelin basic protein, a putative autoantigen that contributes to the pathogenesis of multiple sclerosis (18). Cathepsin S secreted from tumors as well as tumor-associated macrophages and endothelial cells promotes cancer growth and neovascularization (36). Reduced cathepsin S expression resulted in aberrant tumor vascularization, reduced proliferation, and increased apoptosis.

 

Ctss-deficient (Ctss-/-) mice exhibited abnormal B lymphocyte antigen presentation, resistance to collagen-induced arthritis, salivary gland inflammation, and reduced susceptibility to autoimmune diabetes (9;37). Ctss-/- mice showed reduced blood glucose levels compared to wild-type mice after both normal chow and high-fat diets (38). Ctss-/- mouse also showed reduced T cell proliferative responses and B cell responses to acetylcholine receptor as well as reduced susceptibility to experimental autoimmune myasthenia gravis and reduced angiogenesis during wound healing (39;40). Ctss-/- mice had normal numbers of B and T cells as well as normal IgE responses, but showed impaired antibody class switching to IgG2a and IgG3 (16). Ctss-/- mice showed reduced social interaction and novelty recognition compared to wild-type mice (41). The Ctss-/- mice showed reduced dendritic spine density of the cortical neurons. The phenotypes were attributed to reduced cathepsin S-associated proteolysis of perisynaptic extracellular matrix proteins. Ctss-/- mice showed comparable body weights to wild-type mice, but reduced amounts of subscapular and gonadal fat pads, impaired adipocyte formation, lower trabecular bone mineral density, and lower cortical bone mass due to a change in the balance between adipocyte and osteoblast differentiation, increased bone turnover, and changed bone microarchitecture (42). Ctss-/- mice showed increased cardiac fibrosis, macrophage infiltration, and expression of inflammatory cytokines as well as aberrant accumulation of autophagosomes and reduced clearance of damaged mitochondria after angiotensin II-induced cardiac fibrosis compared to wild-type mice (43). Ctss-/- mice showed reduced numbers of microglia on the axotomized side after facial nerve axotomy; the Ctss-/- microglia abutted on injured motoneurons, but did not adhere to the injured neurons (6).

Primers PCR Primer
clip(F):5'- ATGTTCAATGTGCACCATCCC -3'
clip(R):5'- TAGGGATAGGAAGCGTCTGC -3'

Sequencing Primer
clip_seq(F):5'- GAGAAATGTCTGCCTTCCAATGGTC -3'
clip_seq(R):5'- ATAGGAAGCGTCTGCCTCTATGC -3'
References
Science Writers Anne Murray
Illustrators Diantha La Vine
AuthorsJin Huk Choi, James Butler, Beibei Fang, Bruce Beutler
List |< first << previous [record 20 of 132] next >> last >|