Phenotypic Mutation 'Crater_lake' (pdf version)
Allele | Crater_lake |
Mutation Type |
nonsense
|
Chromosome | 11 |
Coordinate | 44,863,735 bp (GRCm39) |
Base Change | A ⇒ T (forward strand) |
Gene |
Ebf1
|
Gene Name | early B cell factor 1 |
Synonym(s) | Olf1, O/E-1, Olf-1 |
Chromosomal Location |
44,508,144-44,898,918 bp (+) (GRCm39)
|
MGI Phenotype |
PHENOTYPE: Homozygotes for a targeted null mutation exhibit a reduced striatum due to excess apoptosis, altered facial branchiomotor neurone migration, and a block in B cell differentiation. Mutants are smaller than normal and many die prior to 4 weeks of age. [provided by MGI curators]
|
Accession Number | NCBI RefSeq: NM_001290709 (variant 1), NM_007897 (variant 2), NM_001290710 (variant 3), NM_001290711 (variant 4); MGI:95275
|
Mapped | Yes |
Amino Acid Change |
Lysine changed to Stop codon
|
Institutional Source | Beutler Lab |
Gene Model |
predicted gene model for protein(s):
[ENSMUSP00000080020]
[ENSMUSP00000099857]
[ENSMUSP00000104891]
|
AlphaFold |
Q07802 |
PDB Structure |
DNA binding domain of Early B-cell Factor 1 (Ebf1) bound to DNA (crystal form II) [X-RAY DIFFRACTION]
DNA binding domain of Early B-cell Factor 1 (Ebf1) bound to DNA (Crystal form I) [X-RAY DIFFRACTION]
Early B-cell Factor 1 (Ebf1) bound to DNA [X-RAY DIFFRACTION]
|
SMART Domains |
Protein: ENSMUSP00000080020 Gene: ENSMUSG00000057098 AA Change: K361*
Domain | Start | End | E-Value | Type |
IPT
|
261 |
345 |
7.38e-8 |
SMART |
HLH
|
346 |
395 |
5.4e-2 |
SMART |
low complexity region
|
526 |
544 |
N/A |
INTRINSIC |
low complexity region
|
564 |
575 |
N/A |
INTRINSIC |
|
Predicted Effect |
probably null
|
SMART Domains |
Protein: ENSMUSP00000099857 Gene: ENSMUSG00000057098 AA Change: K362*
Domain | Start | End | E-Value | Type |
Pfam:COE1_DBD
|
17 |
247 |
8e-150 |
PFAM |
IPT
|
262 |
346 |
7.38e-8 |
SMART |
HLH
|
347 |
396 |
5.4e-2 |
SMART |
low complexity region
|
527 |
545 |
N/A |
INTRINSIC |
low complexity region
|
565 |
576 |
N/A |
INTRINSIC |
|
Predicted Effect |
probably null
|
SMART Domains |
Protein: ENSMUSP00000104891 Gene: ENSMUSG00000057098 AA Change: K354*
Domain | Start | End | E-Value | Type |
IPT
|
254 |
338 |
7.38e-8 |
SMART |
HLH
|
339 |
388 |
5.4e-2 |
SMART |
low complexity region
|
519 |
537 |
N/A |
INTRINSIC |
low complexity region
|
557 |
568 |
N/A |
INTRINSIC |
|
Predicted Effect |
probably null
|
Meta Mutation Damage Score |
0.9755 |
Is this an essential gene? |
Probably essential (E-score: 0.896) |
Phenotypic Category |
Autosomal Dominant |
Candidate Explorer Status |
loading ... |
Single pedigree Linkage Analysis Data
|
|
Penetrance | |
Alleles Listed at MGI | All Mutations and Alleles(28) : Chemically induced (other)(1) Gene trapped(21) Spontaneous(1) Targeted(5)
|
Lab Alleles |
Allele | Source | Chr | Coord | Type | Predicted Effect | PPH Score |
IGL01150:Ebf1
|
APN |
11 |
44759927 |
missense |
probably damaging |
1.00 |
IGL02228:Ebf1
|
APN |
11 |
44863739 |
missense |
probably damaging |
1.00 |
IGL02430:Ebf1
|
APN |
11 |
44815403 |
critical splice donor site |
probably null |
|
Befuddled
|
UTSW |
11 |
44523602 |
missense |
probably damaging |
0.98 |
Catastrophic
|
UTSW |
11 |
44774712 |
missense |
probably damaging |
1.00 |
Crabapple
|
UTSW |
11 |
44774666 |
missense |
probably damaging |
1.00 |
ebby
|
UTSW |
11 |
44774641 |
missense |
probably damaging |
1.00 |
Oregano
|
UTSW |
11 |
44759996 |
missense |
probably damaging |
1.00 |
Oregano2
|
UTSW |
11 |
44881331 |
splice site |
probably null |
|
Realtor
|
UTSW |
11 |
44511374 |
missense |
probably benign |
0.05 |
Vie
|
UTSW |
11 |
44863742 |
missense |
probably damaging |
1.00 |
R0102:Ebf1
|
UTSW |
11 |
44882282 |
missense |
probably benign |
0.02 |
R0102:Ebf1
|
UTSW |
11 |
44882282 |
missense |
probably benign |
0.02 |
R0141:Ebf1
|
UTSW |
11 |
44798827 |
missense |
probably damaging |
1.00 |
R0230:Ebf1
|
UTSW |
11 |
44886949 |
missense |
probably damaging |
1.00 |
R0243:Ebf1
|
UTSW |
11 |
44759915 |
splice site |
probably benign |
|
R0268:Ebf1
|
UTSW |
11 |
44534240 |
missense |
probably damaging |
0.96 |
R0414:Ebf1
|
UTSW |
11 |
44815297 |
nonsense |
probably null |
|
R0648:Ebf1
|
UTSW |
11 |
44882337 |
missense |
probably damaging |
0.99 |
R0765:Ebf1
|
UTSW |
11 |
44759987 |
missense |
probably damaging |
0.97 |
R1055:Ebf1
|
UTSW |
11 |
44523602 |
missense |
probably damaging |
0.98 |
R1432:Ebf1
|
UTSW |
11 |
44895533 |
splice site |
probably benign |
|
R1713:Ebf1
|
UTSW |
11 |
44815393 |
missense |
probably damaging |
1.00 |
R1749:Ebf1
|
UTSW |
11 |
44798835 |
missense |
possibly damaging |
0.68 |
R1989:Ebf1
|
UTSW |
11 |
44512793 |
missense |
probably damaging |
0.97 |
R2405:Ebf1
|
UTSW |
11 |
44882349 |
missense |
probably damaging |
0.98 |
R3110:Ebf1
|
UTSW |
11 |
44534225 |
splice site |
probably benign |
|
R4538:Ebf1
|
UTSW |
11 |
44798822 |
missense |
probably benign |
0.07 |
R4666:Ebf1
|
UTSW |
11 |
44882384 |
missense |
probably damaging |
0.99 |
R4855:Ebf1
|
UTSW |
11 |
44863735 |
nonsense |
probably null |
|
R4904:Ebf1
|
UTSW |
11 |
44759996 |
missense |
probably damaging |
1.00 |
R5137:Ebf1
|
UTSW |
11 |
44882295 |
missense |
probably damaging |
1.00 |
R5569:Ebf1
|
UTSW |
11 |
44883228 |
missense |
possibly damaging |
0.82 |
R5849:Ebf1
|
UTSW |
11 |
44881331 |
splice site |
probably null |
|
R5940:Ebf1
|
UTSW |
11 |
44512048 |
missense |
probably damaging |
1.00 |
R5989:Ebf1
|
UTSW |
11 |
44886998 |
missense |
probably damaging |
1.00 |
R6170:Ebf1
|
UTSW |
11 |
44774712 |
missense |
probably damaging |
1.00 |
R6512:Ebf1
|
UTSW |
11 |
44883168 |
missense |
probably damaging |
1.00 |
R6747:Ebf1
|
UTSW |
11 |
44774641 |
missense |
probably damaging |
1.00 |
R7031:Ebf1
|
UTSW |
11 |
44512795 |
missense |
possibly damaging |
0.95 |
R7042:Ebf1
|
UTSW |
11 |
44882338 |
missense |
probably damaging |
0.99 |
R8065:Ebf1
|
UTSW |
11 |
44511374 |
missense |
probably benign |
0.05 |
R8067:Ebf1
|
UTSW |
11 |
44511374 |
missense |
probably benign |
0.05 |
R8125:Ebf1
|
UTSW |
11 |
44863742 |
missense |
probably damaging |
1.00 |
R8413:Ebf1
|
UTSW |
11 |
44534274 |
missense |
possibly damaging |
0.92 |
R8863:Ebf1
|
UTSW |
11 |
44774666 |
missense |
probably damaging |
1.00 |
R9178:Ebf1
|
UTSW |
11 |
44895548 |
missense |
probably benign |
0.20 |
R9178:Ebf1
|
UTSW |
11 |
44883276 |
missense |
probably benign |
0.04 |
R9511:Ebf1
|
UTSW |
11 |
44815393 |
missense |
probably benign |
0.03 |
R9603:Ebf1
|
UTSW |
11 |
44509006 |
start codon destroyed |
probably null |
0.07 |
|
Mode of Inheritance |
Autosomal Dominant |
Local Stock | |
Repository | |
Last Updated |
2019-09-04 9:42 PM
by Diantha La Vine
|
Record Created |
2016-11-07 7:43 AM
|
Record Posted |
2018-07-18 |
Phenotypic Description |
The crater_lake phenotype was identified among N-ethyl-N-nitrosourea (ENU)-mutagenized G3 mice of the pedigree R4855, some of which showed a reduced B to T cell ratio (Figure 1) due to a decreased frequency of B cells (Figure 2), IgD+ B cells (Figure 3), and IgM+ B cells (Figure 4) with a concomitant increased frequency of T cells (Figure 5), CD4+ T cells (Figure 6), and CD8+ T cells (Figure 7). Some mice also showed a reduced expression of IgD on B cells (Figure 8).
|
Nature of Mutation |
Whole exome HiSeq sequencing of the G1 grandsire identified 91 mutations. All of the above phenotypes were linked by continuous variable mapping to a mutation in Ebf1: an A to T transversion at base pair 44,972,908 (v38) on chromosome 11, or base pair 354,809 in the GenBank genomic region NC_000077 encoding Ebf1. The strongest association was found with an additive/dominant model of inheritance to the normalized frequency of CD8+ T cells, wherein 13 heterozygous mice departed phenotypically from 22 homozygous reference mice with a P value of 1.735 x 10-9; pedigree R4855 did not have any homozygous variant mice (Figure 9). The mutation corresponds to residue 1,279 in the mRNA sequence NM_007897 (and NM_001290711) within exon 11 of 16 total exons, residue 1,163 in the mRNA sequence NM_001290709 within exon 11 of 16 total exons, and residue 1,136 in the mRNA sequence NM_001290710 within exon 11 of 16 total exons.
354794 TTCCAGAGGTTACAGAAGGTCATTCCTCGGCAT
356 -F--Q--R--L--Q--K--V--I--P--R--H- variants 2 & 4
357 -F--Q--R--L--Q--K--V--I--P--R--H- variant 1
349 -F--Q--R--L--Q--K--V--I--P--R--H- variant 3
|
Genomic numbering corresponds to NC_000077. The mutated nucleotide is indicated in red. The mutation results in substitution of lysine 361 to a premature stop codon (K361*) in variants 2 and 4, a K362* substitution in variant 1, and a K354* substitution in variant 3 of the EBF1 protein.
|
Illustration of Mutations in
Gene & Protein |
|
---|
Protein Prediction |
Early B cell factor 1 (EBF1; alternatively, EBF, O/E-1, or COE1) is a member of the COE (Collier-Olf-EBF) family of transcription factors. EBF1 has a DNA-binding domain (DBD), a TIG/IPT (transcription factor immunoglobulin (Ig)/Ig plexin-like fold in transcription factors) domain, a dimerization region similar to those found in basic helix-loop-helix proteins (termed the helix-loop-helix-loop-helix (HLHLH) domain), and a putative activation/multimerization domain that is rich in serine, threonine, and proline residues (Figure 10) (1-4). A RRARR motif between the DBD and TIG/IPT domain is predicted to be a nuclear localization sequence (5). A histidine and three cysteines within a fourteen residue motif, termed the ‘zinc knuckle’, coordinates a zinc ion and mediates DNA recognition (2;6). The DBD has a ‘pseudoimmunoglobulin’ fold similar to those of Rel (see the record for Horus) family proteins [Figure 11; PDB:3MLP; (3;4)]. The fold has a core consisting of an anti-parallel β-barrel that contains nine β-strands arranged in two interacting sheets. An N-terminal α-helix packs against the bottom of this structure. The zinc knuckle coordinates zinc ions using three short α-helices within the His-X3-Cys-X2-Cys-X5-Cys motif. The TIG/IPT domain is predicted to promote the formation of multimers, and forms an Ig-like structure (4). The HLHLH domain has three putative α-helical motifs (H1, H2A and H2B) (1). EBF1 homodimerizes before binding to target DNA sequences. EBF1 homodimers bind efficiently to inverted repeat DNA sequences consisting of two half-sites that are separated by a two base pair spacer; the optimal nucleotide target sequence of EBF1 is 5′-ATTCCCNNGGGAAT-3′ (2). Ebf1 has two promoters, a distal promoter (α) and a proximal promoter (β), which produce two EBF1 proteins (7). The two proteins differ by 11 amino acids at the N-terminus. The proteins are predicted to have similar functions. Interleukin-7 signaling, E2A, and EBF1 activate the distal Ebf1 promoter, whereas Pax5, Ets1, and Pu.1 regulate the stronger proximal promoter (7). The crater_lake mutation results in substitution of lysine 361 to a premature stop codon (K361*) in variants 2 and 4, a K362* substitution in variant 1, and a K354* substitution in variant 3 of the EBF1 protein; the site of the mutation in all variants is within the HLHLH domain.
|
Expression/Localization | Ebf1 is expressed in pre-B and early B-cell lines, but not in other hematopoietic cells (1). Ebf1 is expressed at increasing amounts as the common lymphoid progenitors progress to functional B cells. For example, Ebf1 expression is upregulated more than five-fold in the transition of pro-B cells to pre-B cells (7). In the mouse, Ebf1 is highly expressed in the lymph node, spleen, and adipose tissues; Ebf1 is expressed at low levels in other nonlymphoid tissues (1).
|
Background |
During B cell differentiation from a common hematopoietic stem cell (HSC) progenitor to a mature B cell, PAX5 [see the record for glacier] and other lineage-specific B lymphoid transcription factors such as EBF1 and E2A function to both activate B lineage-specific genes as well as to repress the transcription of other lineage-inappropriate genes (Figure 12). HSCs give rise to multipotent progenitors, which branch into myeloid and lymphoid lineages. The myeloid lineage starts with the common myeloid progenitor, which gives rise to the megakaryocyte-erythroid progenitors, granulocyte-macrophage progenitors, or early T-cell progenitors. In the lymphoid lineage, common lymphoid progenitors (CLPs) are divided into Ly6D-negative all-lymphoid progenitors (ALPs) and Ly6D-positive B cell biased lymphoid progenitors (BLPs) (8). The ALPs generate B cells, T cells, natural killer cells, and lymphoid dendritic cells. The BLPs are biased towards the B cell lineage. Ebf1 expression is initially expressed in the BLPs (9). E2A/E47 and HEB activate the expression of FOXO1, which acts with E2A to induce the expression of EBF1 (10). Expression of EBF1 (and FOXO1) in common lymphoid progenitors biases the cells towards B cell lymphopoiesis. EBF1 subsequently activates the expression of PAX5, which commits cells to the B cell fate (11). EBF1 is a transcription factor that is required for B cell commitment, pro-B cell development, the transition to the pre-B cell stage, germinal center formation, and class switch recombination as well as for the proliferation, survival, and signaling of pro-B cells and peripheral B-cell subsets (e.g., B1 cells, follicular, and marginal zone B cells) (9;12). Ebf1-deficient (Ebf1-/-) mice exhibit premature death (incomplete penetrance), reduced body sizes, reduced subcutaneous adipose tissue amounts, reduced serum IgM levels, decreased numbers of pro-B cells, loss of mature B cells in the blood and spleen, increased osteoblast cell numbers, and abnormal bone ossification (13;14). The Ebf1-/- mice show no V(D)J recombination. Mice expressing a spontaneous Ebf1 mutation (Ebf1Serv/+; MGI:5007783) also exhibited reduced B cell numbers. Exogenous expression of EBF1 in mouse hematopoietic stem cells promotes B cell development, but the development of other hematopoietic cell lineages is impaired (15). EBF1 regulates early B lymphopoiesis through the activation of the transcription of B cell specific genes as well as repressing the expression of drivers of alternative lineages (Table 1). EBF1 is predicted to affect approximately 200 target genes (16). In some cases (e.g., Cd79a), EBF1 contributes to epigenetic regulation of the target gene promoter through CpG demethylation and nucleosomal remodeling, subsequently promoting access for other transcriptional regulators (17). Table 1. Select EBF1 target genes. For additional putative target genes see (16).
EBF1-mediated regulation
|
Gene symbol
|
Function
|
References
|
Activation
|
Cd79a (Igα, mb-1)
|
Component of the pre-BCR and BCR; see the record for crab
|
(18-20)
|
CD79b (Igβ, B29)
|
Component of the pre-BCR and BCR
|
(10;16;21)
|
Blk
|
BCR-associated tyrosine kinase; see the record for blaenka
|
(10;16;22)
|
Cd19
|
BCR co-receptor; see the record for hive
|
(10;16)
|
Igll1 (λ5)
|
B cell marker
|
(10;16;23)
|
Vpreb1
|
Component of the pre-BCR
|
(10;16;24)
|
Hes1
|
Basic helix-loop-helix protein that functions in neurogenesis, myogenesis, hematopoiesis, and sex determination
|
(10;16)
|
Sox4
|
B and T cell transcription factor; required for B cell development
|
(10;16)
|
Pax5
|
Transcription factor; see the record for Apple
|
(10;25)
|
Pou2af1 (OCA-B/BOB-1/OBF1)
|
Transcription factor that functions in normal production of immunoglobulin isotypes, immune responses, and germinal center formation
|
(10;16;26;27)
|
Foxo1
|
Transcription factor in B cell signaling and proliferation
|
(10;28)
|
Ceacam1
|
Cell–cell adhesion molecule on leukocytes, epithelia, and endothelia
|
(16;29)
|
Cd53
|
Cell surface protein that contributes to the transduction of CD2-generated signals in T cells and natural killer cells
|
(16;29)
|
Dok3
|
Immunomodulatory adaptor
|
(16;30)
|
SLAMF1/CD150
|
Co-stimulatory receptor expressed on mature lymphocytes
|
(31)
|
Repression
|
Cebpa (C/EBPα)
|
Determinant of myeloid differentiation
|
(32-34)
|
Sfpi1 (PU.1)
|
Transcription factor in myeloid differentiation
|
(32;33)
|
Id2 and Id3
|
Transcription factors that inhibit the function of E2A proteins
|
(32;33;35)
|
Hnf1a
|
Transcription factor
|
(35)
|
Cd244
|
NK lineage genes
|
(36)
|
Cd160
|
Klrb1c
|
Nfil3
|
Transcription factor that promotes NK cell development
|
(36;37)
|
Pdcd1
|
Members of the CD28 family
|
(16)
|
Ctla4
|
Icosl
|
Ligand of the Icos receptor
|
Hlx
|
Homeobox factor that regulates Th1 differentiation
|
PKCθ
|
Serine threonine kinase; see the record for celina
|
(38)
|
Rag1 and Rag2
|
Enzymes required for V(D)J recombination; see the records for maladaptive (Rag1) and snowcock (Rag2)
|
(39)
|
Prdm1 (Blimp1)
|
Functions in plasma cell differentiation; EBF1 controls Prdm1 expression in immature B cells
|
(40)
|
EBF1 also has putative functions in the regulation of adipocyte morphology and lipolysis in white adipose tissue (34;41-43). Ebf1 heterozygous mice on high-fat diets showed increased white adipose tissue atrophy and attenuated insulin sensitivity compared to wild-type controls (41). In human adipocytes, 2,501 genes are putative EBF1 target genes, including PPARG, NCOR2, LIPE, and ADIPOQ (41). Ebf1-/- mice had increased formation of bone marrow adipocytes as well as loss of visceral white adipose tissue deposition (43;44). EBF1 is a negative regulator of osteoblast differentiation and bone formation in a non cell-autonomous manner (45). Ebf1-/- mice exhibited increased numbers of osteoblasts as well as increases in bone formation parameters (43;44). However, mice with loss of EBF1 expression only in cells of the osteoblast lineage exhibited no overt phenotypes, including in osteoblast differentiation, bone formation, or bone mass (45). EBF1 functions in in postnatal glomerular and podocyte maturation as well as the maintenance of kidney function (46). Kidneys from Ebf1-/- mice showed thinned cortices, reduced glomerular maturation, early albuminuria, elevated blood urea nitrogen levels, reduced glomerular filtration rate (46). EBF1 functions in the regulation of GLUT4-mediated insulin-stimulated glucose uptake in muscle and adipose tissue by inhibiting GLUT4 expression (47). The Ebf1-/- mice were also slightly hypoglycemic and hypotriglyceridemic (43). In the retina, EBF1 is required for specifying several retinal cell types and subtypes from postmitotic precursors (48). EBF1 is both necessary and sufficient for specifying non-AII glycinergic amacrine, type 2 OFF-cone bipolar and horizontal cells, but is only necessary (but not sufficient) for specifying ganglion cells (48). EBF1 is required for the suppression of Muller cell fate during retinogenesis as well as for the correct topographic projection of retinal ganglion cell axons at the optic chiasm (49).
|
Putative Mechanism | The phenotype of the crater_lake phenotype indicates loss of EBF1crater_lake function in regulating the expression of EBF1 target genes (Table 1).
|
Primers |
PCR Primer
Crater_lake_pcr_F: TGTTTCTTCAAGAGGGTCAGTC
Crater_lake_pcr_R: CACACAATGTACCAAGATGAGTTG
Sequencing Primer
Crater_lake_seq_F: GGTCAGTCCCTTCATAGTAAACG
Crater_lake_seq_R: GTCTTGTCCAAGAGGGTA
|
Genotyping | PCR program 1) 94°C 2:00 2) 94°C 0:30 3) 55°C 0:30 4) 72°C 1:00 5) repeat steps (2-4) 40x 6) 72°C 10:00 7) 4°C hold
The following sequence of 407 nucleotides is amplified (chromosome 11, + strand):
1 tgtttcttca agagggtcag tcccttcata gtaaacgaaa tagatggtgg aaaggccatg 61 acagactgaa gagtatctat taaatgttaa gagttatatc tgcaccatct gtgctgaaaa 121 tcatgcttca gttcctgaaa tgtttaaacc ttgtgacttc ttccttacag cactcaatga 181 acccaccatc gactacggct tccagaggtt acagaaggtc attcctcggc atcctggtga 241 cccagagcgc ttgccaaagg tcagaatccc cacccccacc cctcacaccc cacccaccca 301 acctggacat ggtttctaga aagttggatt tgagaatggc aaaataccct cttggacaag 361 acaaaaaata attcatagat aaccaactca tcttggtaca ttgtgtg
Primer binding sites are underlined and the sequencing primers are highlighted; the mutated nucleotide is shown in red. |
References | 1. Hagman, J., Belanger, C., Travis, A., Turck, C. W., and Grosschedl, R. (1993) Cloning and Functional Characterization of Early B-Cell Factor, a Regulator of Lymphocyte-Specific Gene Expression. Genes Dev. 7, 760-773.
4. Siponen, M. I., Wisniewska, M., Lehtio, L., Johansson, I., Svensson, L., Raszewski, G., Nilsson, L., Sigvardsson, M., and Berglund, H. (2010) Structural Determination of Functional Domains in Early B-Cell Factor (EBF) Family of Transcription Factors Reveals Similarities to Rel DNA-Binding Proteins and a Novel Dimerization Motif. J Biol Chem. 285, 25875-25879.
6. Fields, S., Ternyak, K., Gao, H., Ostraat, R., Akerlund, J., and Hagman, J. (2008) The 'Zinc Knuckle' Motif of Early B Cell Factor is Required for Transcriptional Activation of B Cell-Specific Genes. Mol Immunol. 45, 3786-3796.
7. Roessler, S., Gyory, I., Imhof, S., Spivakov, M., Williams, R. R., Busslinger, M., Fisher, A. G., and Grosschedl, R. (2007) Distinct Promoters Mediate the Regulation of Ebf1 Gene Expression by Interleukin-7 and Pax5. Mol Cell Biol. 27, 579-594.
8. Inlay, M. A., Bhattacharya, D., Sahoo, D., Serwold, T., Seita, J., Karsunky, H., Plevritis, S. K., Dill, D. L., and Weissman, I. L. (2009) Ly6d Marks the Earliest Stage of B-Cell Specification and Identifies the Branchpoint between B-Cell and T-Cell Development. Genes Dev. 23, 2376-2381.
9. Vilagos, B., Hoffmann, M., Souabni, A., Sun, Q., Werner, B., Medvedovic, J., Bilic, I., Minnich, M., Axelsson, E., Jaritz, M., and Busslinger, M. (2012) Essential Role of EBF1 in the Generation and Function of Distinct Mature B Cell Types. J Exp Med. 209, 775-792.
10. Zandi, S., Mansson, R., Tsapogas, P., Zetterblad, J., Bryder, D., and Sigvardsson, M. (2008) EBF1 is Essential for B-Lineage Priming and Establishment of a Transcription Factor Network in Common Lymphoid Progenitors. J Immunol. 181, 3364-3372.
11. Decker, T., Pasca di Magliano, M., McManus, S., Sun, Q., Bonifer, C., Tagoh, H., and Busslinger, M. (2009) Stepwise Activation of Enhancer and Promoter Regions of the B Cell Commitment Gene Pax5 in Early Lymphopoiesis. Immunity. 30, 508-520.
12. Gyory, I., Boller, S., Nechanitzky, R., Mandel, E., Pott, S., Liu, E., and Grosschedl, R. (2012) Transcription Factor Ebf1 Regulates Differentiation Stage-Specific Signaling, Proliferation, and Survival of B Cells. Genes Dev. 26, 668-682.
14. Hesslein, D. G., Fretz, J. A., Xi, Y., Nelson, T., Zhou, S., Lorenzo, J. A., Schatz, D. G., and Horowitz, M. C. (2009) Ebf1-Dependent Control of the Osteoblast and Adipocyte Lineages. Bone. 44, 537-546.
15. Zhang, Z., Cotta, C. V., Stephan, R. P., deGuzman, C. G., and Klug, C. A. (2003) Enforced Expression of EBF in Hematopoietic Stem Cells Restricts Lymphopoiesis to the B Cell Lineage. EMBO J. 22, 4759-4769.
16. Treiber, T., Mandel, E. M., Pott, S., Gyory, I., Firner, S., Liu, E. T., and Grosschedl, R. (2010) Early B Cell Factor 1 Regulates B Cell Gene Networks by Activation, Repression, and Transcription- Independent Poising of Chromatin. Immunity. 32, 714-725.
17. Maier, H., Ostraat, R., Gao, H., Fields, S., Shinton, S. A., Medina, K. L., Ikawa, T., Murre, C., Singh, H., Hardy, R. R., and Hagman, J. (2004) Early B Cell Factor Cooperates with Runx1 and Mediates Epigenetic Changes Associated with Mb-1 Transcription. Nat Immunol. 5, 1069-1077.
18. Feldhaus, A. L., Mbangkollo, D., Arvin, K. L., Klug, C. A., and Singh, H. (1992) BLyF, a Novel Cell-Type- and Stage-Specific Regulator of the B-Lymphocyte Gene Mb-1. Mol Cell Biol. 12, 1126-1133.
20. Sigvardsson, M., Clark, D. R., Fitzsimmons, D., Doyle, M., Akerblad, P., Breslin, T., Bilke, S., Li, R., Yeamans, C., Zhang, G., and Hagman, J. (2002) Early B-Cell Factor, E2A, and Pax-5 Cooperate to Activate the Early B Cell-Specific Mb-1 Promoter. Mol Cell Biol. 22, 8539-8551.
26. Kim, U., Qin, X. F., Gong, S., Stevens, S., Luo, Y., Nussenzweig, M., and Roeder, R. G. (1996) The B-Cell-Specific Transcription Coactivator OCA-B/OBF-1/Bob-1 is Essential for Normal Production of Immunoglobulin Isotypes. Nature. 383, 542-547.
27. Schubart, D. B., Rolink, A., Kosco-Vilbois, M. H., Botteri, F., and Matthias, P. (1996) B-Cell-Specific Coactivator OBF-1/OCA-B/Bob1 Required for Immune Response and Germinal Centre Formation. Nature. 383, 538-542.
28. Dengler, H. S., Baracho, G. V., Omori, S. A., Bruckner, S., Arden, K. C., Castrillon, D. H., DePinho, R. A., and Rickert, R. C. (2008) Distinct Functions for the Transcription Factor Foxo1 at various Stages of B Cell Differentiation. Nat Immunol. 9, 1388-1398.
29. Mansson, R., Lagergren, A., Hansson, F., Smith, E., and Sigvardsson, M. (2007) The CD53 and CEACAM-1 Genes are Genetic Targets for Early B Cell Factor. Eur J Immunol. 37, 1365-1376.
31. Schwartz, A. M., Putlyaeva, L. V., Covich, M., Klepikova, A. V., Akulich, K. A., Vorontsov, I. E., Korneev, K. V., Dmitriev, S. E., Polanovsky, O. L., Sidorenko, S. P., Kulakovskiy, I. V., and Kuprash, D. V. (2016) Early B-Cell Factor 1 (EBF1) is Critical for Transcriptional Control of SLAMF1 Gene in Human B Cells. Biochim Biophys Acta. 1859, 1259-1268.
32. Pongubala, J. M., Northrup, D. L., Lancki, D. W., Medina, K. L., Treiber, T., Bertolino, E., Thomas, M., Grosschedl, R., Allman, D., and Singh, H. (2008) Transcription Factor EBF Restricts Alternative Lineage Options and Promotes B Cell Fate Commitment Independently of Pax5. Nat Immunol. 9, 203-215.
33. Thal, M. A., Carvalho, T. L., He, T., Kim, H. G., Gao, H., Hagman, J., and Klug, C. A. (2009) Ebf1-Mediated Down-Regulation of Id2 and Id3 is Essential for Specification of the B Cell Lineage. Proc Natl Acad Sci U S A. 106, 552-557.
35. Nechanitzky, R., Akbas, D., Scherer, S., Gyory, I., Hoyler, T., Ramamoorthy, S., Diefenbach, A., and Grosschedl, R. (2013) Transcription Factor EBF1 is Essential for the Maintenance of B Cell Identity and Prevention of Alternative Fates in Committed Cells. Nat Immunol. 14, 867-875.
36. Lukin, K., Fields, S., Guerrettaz, L., Straign, D., Rodriguez, V., Zandi, S., Mansson, R., Cambier, J. C., Sigvardsson, M., and Hagman, J. (2011) A Dose-Dependent Role for EBF1 in Repressing Non-B-Cell-Specific Genes. Eur J Immunol. 41, 1787-1793.
37. Gascoyne, D. M., Long, E., Veiga-Fernandes, H., de Boer, J., Williams, O., Seddon, B., Coles, M., Kioussis, D., and Brady, H. J. (2009) The Basic Leucine Zipper Transcription Factor E4BP4 is Essential for Natural Killer Cell Development. Nat Immunol. 10, 1118-1124.
38. Kikuchi, H., Nakayama, M., Kuribayashi, F., Imajoh-Ohmi, S., Nishitoh, H., Takami, Y., and Nakayama, T. (2014) Protein Kinase Ctheta Gene Expression is Oppositely Regulated by GCN5 and EBF1 in Immature B Cells. FEBS Lett. 588, 1739-1742.
40. Kikuchi, H., Nakayama, M., Takami, Y., Kuribayashi, F., and Nakayama, T. (2012) EBF1 Acts as a Powerful Repressor of Blimp-1 Gene Expression in Immature B Cells. Biochem Biophys Res Commun. 422, 780-785.
41. Gao, H., Mejhert, N., Fretz, J. A., Arner, E., Lorente-Cebrian, S., Ehrlund, A., Dahlman-Wright, K., Gong, X., Stromblad, S., Douagi, I., Laurencikiene, J., Dahlman, I., Daub, C. O., Ryden, M., Horowitz, M. C., and Arner, P. (2014) Early B Cell Factor 1 Regulates Adipocyte Morphology and Lipolysis in White Adipose Tissue. Cell Metab. 19, 981-992.
42. Akerblad, P., Lind, U., Liberg, D., Bamberg, K., and Sigvardsson, M. (2002) Early B-Cell Factor (O/E-1) is a Promoter of Adipogenesis and Involved in Control of Genes Important for Terminal Adipocyte Differentiation. Mol Cell Biol. 22, 8015-8025.
43. Fretz, J. A., Nelson, T., Xi, Y., Adams, D. J., Rosen, C. J., and Horowitz, M. C. (2010) Altered Metabolism and Lipodystrophy in the Early B-Cell Factor 1-Deficient Mouse. Endocrinology. 151, 1611-1621.
44. Hesslein, D. G., Fretz, J. A., Xi, Y., Nelson, T., Zhou, S., Lorenzo, J. A., Schatz, D. G., and Horowitz, M. C. (2009) Ebf1-Dependent Control of the Osteoblast and Adipocyte Lineages. Bone. 44, 537-546.
45. Zee, T., Boller, S., Gyory, I., Makinistoglu, M. P., Tuckermann, J. P., Grosschedl, R., and Karsenty, G. (2013) The Transcription Factor Early B-Cell Factor 1 Regulates Bone Formation in an Osteoblast-Nonautonomous Manner. FEBS Lett. 587, 711-716.
46. Fretz, J. A., Nelson, T., Velazquez, H., Xi, Y., Moeckel, G. W., and Horowitz, M. C. (2014) Early B-Cell Factor 1 is an Essential Transcription Factor for Postnatal Glomerular Maturation. Kidney Int. 85, 1091-1102.
|
Science Writers | Anne Murray |
Illustrators | Diantha La Vine |
Authors | Xue Zhong and Bruce Beutler |