Phenotypic Mutation 'Crater_lake' (pdf version)
List |< first << previous [record 17 of 132] next >> last >|
AlleleCrater_lake
Mutation Type nonsense
Chromosome11
Coordinate44,972,908 bp (GRCm38)
Base Change A ⇒ T (forward strand)
Gene Ebf1
Gene Name early B cell factor 1
Synonym(s) Olf1, O/E-1, Olf-1
Chromosomal Location 44,617,317-45,008,091 bp (+)
MGI Phenotype PHENOTYPE: Homozygotes for a targeted null mutation exhibit a reduced striatum due to excess apoptosis, altered facial branchiomotor neurone migration, and a block in B cell differentiation. Mutants are smaller than normal and many die prior to 4 weeks of age. [provided by MGI curators]
Accession Number

NCBI RefSeq: NM_001290709 (variant 1), NM_007897 (variant 2), NM_001290710 (variant 3), NM_001290711 (variant 4); MGI:95275

Mapped Yes 
Amino Acid Change Lysine changed to Stop codon
Institutional SourceBeutler Lab
Gene Model predicted gene model for protein(s): [ENSMUSP00000080020] [ENSMUSP00000099857] [ENSMUSP00000104891]
PDB Structure
DNA binding domain of Early B-cell Factor 1 (Ebf1) bound to DNA (crystal form II) [X-RAY DIFFRACTION]
DNA binding domain of Early B-cell Factor 1 (Ebf1) bound to DNA (Crystal form I) [X-RAY DIFFRACTION]
Early B-cell Factor 1 (Ebf1) bound to DNA [X-RAY DIFFRACTION]
SMART Domains Protein: ENSMUSP00000080020
Gene: ENSMUSG00000057098
AA Change: K361*

DomainStartEndE-ValueType
IPT 261 345 7.38e-8 SMART
HLH 346 395 5.4e-2 SMART
low complexity region 526 544 N/A INTRINSIC
low complexity region 564 575 N/A INTRINSIC
Predicted Effect probably null
SMART Domains Protein: ENSMUSP00000099857
Gene: ENSMUSG00000057098
AA Change: K362*

DomainStartEndE-ValueType
Pfam:COE1_DBD 17 247 8e-150 PFAM
IPT 262 346 7.38e-8 SMART
HLH 347 396 5.4e-2 SMART
low complexity region 527 545 N/A INTRINSIC
low complexity region 565 576 N/A INTRINSIC
Predicted Effect probably null
SMART Domains Protein: ENSMUSP00000104891
Gene: ENSMUSG00000057098
AA Change: K354*

DomainStartEndE-ValueType
IPT 254 338 7.38e-8 SMART
HLH 339 388 5.4e-2 SMART
low complexity region 519 537 N/A INTRINSIC
low complexity region 557 568 N/A INTRINSIC
Predicted Effect probably null
Phenotypic Category
Phenotypequestion? Literature verified References
FACS CD8+ T cells - increased
Penetrance  
Alleles Listed at MGI

All Mutations and Alleles(28) : Chemically induced (other)(1) Gene trapped(21) Spontaneous(1) Targeted(5)

Lab Alleles
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01150:Ebf1 APN 11 44869100 missense probably damaging 1.00
IGL02228:Ebf1 APN 11 44972912 missense probably damaging 1.00
IGL02430:Ebf1 APN 11 44924576 critical splice donor site probably null
Catastrophic UTSW 11 44883885 missense
oregano UTSW 11 44869169 missense probably damaging 1.00
Oregano2 UTSW 11 44990504 splice site probably null
R0102:Ebf1 UTSW 11 44991455 missense probably benign 0.02
R0102:Ebf1 UTSW 11 44991455 missense probably benign 0.02
R0141:Ebf1 UTSW 11 44908000 missense probably damaging 1.00
R0230:Ebf1 UTSW 11 44996122 missense probably damaging 1.00
R0243:Ebf1 UTSW 11 44869088 splice site probably benign
R0268:Ebf1 UTSW 11 44643413 missense probably damaging 0.96
R0414:Ebf1 UTSW 11 44924470 nonsense probably null
R0648:Ebf1 UTSW 11 44991510 missense probably damaging 0.99
R0765:Ebf1 UTSW 11 44869160 missense probably damaging 0.97
R1055:Ebf1 UTSW 11 44632775 missense probably damaging 0.98
R1432:Ebf1 UTSW 11 45004706 splice site probably benign
R1713:Ebf1 UTSW 11 44924566 missense probably damaging 1.00
R1749:Ebf1 UTSW 11 44908008 missense possibly damaging 0.68
R1989:Ebf1 UTSW 11 44621966 missense probably damaging 0.97
R2405:Ebf1 UTSW 11 44991522 missense probably damaging 0.98
R3110:Ebf1 UTSW 11 44643398 splice site probably benign
R4538:Ebf1 UTSW 11 44907995 missense probably benign 0.07
R4666:Ebf1 UTSW 11 44991557 missense probably damaging 0.99
R4855:Ebf1 UTSW 11 44972908 nonsense probably null
R4904:Ebf1 UTSW 11 44869169 missense probably damaging 1.00
R5137:Ebf1 UTSW 11 44991468 missense probably damaging 1.00
R5569:Ebf1 UTSW 11 44992401 missense possibly damaging 0.82
R5849:Ebf1 UTSW 11 44990504 splice site probably null
R5940:Ebf1 UTSW 11 44621221 missense probably damaging 1.00
R5989:Ebf1 UTSW 11 44996171 missense probably damaging 1.00
R6170:Ebf1 UTSW 11 44883885 missense probably damaging 1.00
R6512:Ebf1 UTSW 11 44992341 missense probably damaging 1.00
R6747:Ebf1 UTSW 11 44883814 missense probably damaging 1.00
Mode of Inheritance Autosomal Dominant
Local Stock
Repository
Last Updated 2018-10-25 12:06 PM by Diantha La Vine
Record Created 2016-11-07 7:43 AM
Record Posted 2018-07-18
Phenotypic Description
Figure 1. Crater_lake mice exhibit reduced B to T cell ratios. Flow cytometric analysis of peripheral blood was utilized to determine B and T cell frequencies. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 2. Crater_lake mice exhibit reduced frequencies of peripheral B cells. Flow cytometric analysis of peripheral blood was utilized to determine B cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 3. Crater_lake mice exhibit reduced percentages of peripheral IgD+ B cells. Flow cytometric analysis of peripheral blood was utilized to determine IgD B cell percentage. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 4. Crater_lake mice exhibit reduced frequencies of peripheral IgM+ B cells. Flow cytometric analysis of peripheral blood was utilized to determine B cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 5. Crater_lake mice exhibit increased frequencies of peripheral T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 6. Crater_lake mice exhibit increased frequencies of peripheral CD4+ T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 7. Crater_lake mice exhibit increased frequencies of peripheral CD8+ T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 8. Crater_lake mice exhibit reduced IgD expression on peripheral B cells. Flow cytometric analysis of peripheral blood was utilized to determine IgD MFI. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The crater_lake phenotype was identified among N-ethyl-N-nitrosourea (ENU)-mutagenized G3 mice of the pedigree R4855, some of which showed a reduced B to T cell ratio (Figure 1) due to a decreased frequency of B cells (Figure 2), IgD+ B cells (Figure 3), and IgM+ B cells (Figure 4) with a concomitant increased frequency of T cells (Figure 5), CD4+ T cells (Figure 6), and CD8+ T cells (Figure 7). Some mice also showed a reduced expression of IgD on B cells (Figure 8).

Nature of Mutation

Figure 9. Linkage mapping of the increased frequency of CD8+ T cells using a dominant (or additive) model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 91 mutations (X-axis) identified in the G1 male of pedigree R4855. Normalized phenotype data are shown for single locus linkage analysis without consideration of G2 dam identity. Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 91 mutations. All of the above phenotypes were linked by continuous variable mapping to a mutation in Ebf1:  an A to T transversion at base pair 44,972,908 (v38) on chromosome 11, or base pair 354,809 in the GenBank genomic region NC_000077 encoding Ebf1. The strongest association was found with an additive/dominant model of inheritance to the normalized frequency of CD8+ T cells, wherein 13 heterozygous mice departed phenotypically from 22 homozygous reference mice with a P value of 1.735 x 10-9; pedigree R4855 did not have any homozygous variant mice (Figure 9).  

 

The mutation corresponds to residue 1,279 in the mRNA sequence NM_007897 (and NM_001290711) within exon 11 of 16 total exons, residue 1,163 in the mRNA sequence NM_001290709 within exon 11 of 16 total exons, and residue 1,136 in the mRNA sequence NM_001290710 within exon 11 of 16 total exons.

 

354794 TTCCAGAGGTTACAGAAGGTCATTCCTCGGCAT

356    -F--Q--R--L--Q--K--V--I--P--R--H- variants 2 & 4

357    -F--Q--R--L--Q--K--V--I--P--R--H- variant 1

349    -F--Q--R--L--Q--K--V--I--P--R--H- variant 3

 

Genomic numbering corresponds to NC_000077. The mutated nucleotide is indicated in red. The mutation results in substitution of lysine 361 to a premature stop codon (K361*) in variants 2 and 4, a K362* substitution in variant 1, and a K354* substitution in variant 3 of the EBF1 protein.

Protein Prediction
Figure 10. Domain structure of the EBF1 protein. The crater_lake mutation results in substitution of lysine 362 to a premature stop codon variant 1 of EBF1. Other mutations found in EBF1 are noted. Click on each mutation for more information. DBD: DNA-binding domain; ZK: Zinc knuckle; TIG/IPT: transcription factor immunoglobulin/Ig plexin-like fold in transcription factors; HLHLH: helix-loop-helix-loop-helix.
Figure 11. Crystal structure of mouse EBF1. Figure generated by UCSF Chimera and is based on PDB:3MLP. See Figure 10 and the text for more information about the domains shown.

Early B cell factor 1 (EBF1; alternatively, EBF, O/E-1, or COE1) is a member of the COE (Collier-Olf-EBF) family of transcription factors. EBF1 has a DNA-binding domain (DBD), a TIG/IPT (transcription factor immunoglobulin (Ig)/Ig plexin-like fold in transcription factors) domain, a dimerization region similar to those found in basic helix-loop-helix proteins (termed the helix-loop-helix-loop-helix (HLHLH) domain), and a putative activation/multimerization domain that is rich in serine, threonine, and proline residues (Figure 10) (1-4). A RRARR motif between the DBD and TIG/IPT domain is predicted to be a nuclear localization sequence (5). A histidine and three cysteines within a fourteen residue motif, termed the ‘zinc knuckle’, coordinates a zinc ion and mediates DNA recognition (2;6).

 

The DBD has a ‘pseudoimmunoglobulin’ fold similar to those of Rel (see the record for Horus) family proteins [Figure 11; PDB:3MLP; (3;4)]. The fold has a core consisting of an anti-parallel β-barrel that contains nine β-strands arranged in two interacting sheets. An N-terminal α-helix packs against the bottom of this structure. The zinc knuckle coordinates zinc ions using three short α-helices within the His-X3-Cys-X2-Cys-X5-Cys motif. The TIG/IPT domain is predicted to promote the formation of multimers, and forms an Ig-like structure (4). The HLHLH domain has three putative α-helical motifs (H1, H2A and H2B) (1).

 

EBF1 homodimerizes before binding to target DNA sequences. EBF1 homodimers bind efficiently to inverted repeat DNA sequences consisting of two half-sites that are separated by a two base pair spacer; the optimal nucleotide target sequence of EBF1 is 5′-ATTCCCNNGGGAAT-3′ (2).

 

Ebf1 has two promoters, a distal promoter (α) and a proximal promoter (β), which produce two EBF1 proteins (7). The two proteins differ by 11 amino acids at the N-terminus. The proteins are predicted to have similar functions. Interleukin-7 signaling, E2A, and EBF1 activate the distal Ebf1 promoter, whereas Pax5, Ets1, and Pu.1 regulate the stronger proximal promoter (7).

 

The crater_lake mutation results in substitution of lysine 361 to a premature stop codon (K361*) in variants 2 and 4, a K362* substitution in variant 1, and a K354* substitution in variant 3 of the EBF1 protein; the site of the mutation in all variants is within the HLHLH domain.

Expression/Localization

Ebf1 is expressed in pre-B and early B-cell lines, but not in other hematopoietic cells (1). Ebf1 is expressed at increasing amounts as the common lymphoid progenitors progress to functional B cells. For example, Ebf1 expression is upregulated more than five-fold in the transition of pro-B cells to pre-B cells (7). In the mouse, Ebf1 is highly expressed in the lymph node, spleen, and adipose tissues; Ebf1 is expressed at low levels in other nonlymphoid tissues (1).

Background
Figure 12. B cell differentiation and EBF1.  Conventional B cell differentiation occurs in the bone marrow and spleen. In the bone marrow, development progresses from stem cells through the pro-B cell, pre-B cell and immature pre-B cell stages. Steps upstream of the pro-B stage are not shown for simplicity. During this differentiation, VDJ rearrangements at the immunoglobulin locus result in the generation and surface expression of the pre-B cell (pre-BCR), comprising of an Igm heavy (H) chain and surrogate light chains (VpreB and λ-5). Pre-BCR signaling is necessary for proliferation and further differentiation resulting in expression of a muture BCR, composed of rearranged heavy and light (L) chains, that is capable of binding antigen. Cells successfully completing ths checkpoint leave the bone marrow and proceed through two transitional (T) stages before becoming mature follicular B cells or marginal-zone B cells. The gray boxes list membrane markers and the stage of immunoglobin chain rearrangement associated with each step. Also listed are mouse knockouts (see text) and the resulting block in B cell develpment. D, diversity; J, joining; V, variable; SLC, surrogate light chain. The green bar below the diagram designates the timing of Pax5 expression, and the blue bar designates EBF1 expression. Factors activated by Pax5 are in green, while factors inhibited by Pax5 are in red.

During B cell differentiation from a common hematopoietic stem cell (HSC) progenitor to a mature B cell, PAX5 [see the record for glacier] and other lineage-specific B lymphoid transcription factors such as EBF1 and E2A function to both activate B lineage-specific genes as well as to repress the transcription of other lineage-inappropriate genes (Figure 12).

 

HSCs give rise to multipotent progenitors, which branch into myeloid and lymphoid lineages. The myeloid lineage starts with the common myeloid progenitor, which gives rise to the megakaryocyte-erythroid progenitors, granulocyte-macrophage progenitors, or early T-cell progenitors. In the lymphoid lineage, common lymphoid progenitors (CLPs) are divided into Ly6D-negative all-lymphoid progenitors (ALPs) and Ly6D-positive B cell biased lymphoid progenitors (BLPs) (8). The ALPs generate B cells, T cells, natural killer cells, and lymphoid dendritic cells. The BLPs are biased towards the B cell lineage. Ebf1 expression is initially expressed in the BLPs (9). E2A/E47 and HEB activate the expression of FOXO1, which acts with E2A to induce the expression of EBF1 (10). Expression of EBF1 (and FOXO1) in common lymphoid progenitors biases the cells towards B cell lymphopoiesis. EBF1 subsequently activates the expression of PAX5, which commits cells to the B cell fate (11).

 

EBF1 is a transcription factor that is required for B cell commitment, pro-B cell development, the transition to the pre-B cell stage, germinal center formation, and class switch recombination as well as for the proliferation, survival, and signaling of pro-B cells and peripheral B-cell subsets (e.g., B1 cells, follicular, and marginal zone B cells) (9;12). Ebf1-deficient (Ebf1-/-) mice exhibit premature death (incomplete penetrance), reduced body sizes, reduced subcutaneous adipose tissue amounts, reduced serum IgM levels, decreased numbers of pro-B cells, loss of mature B cells in the blood and spleen, increased osteoblast cell numbers, and abnormal bone ossification (13;14). The Ebf1-/- mice show no V(D)J recombination.  Mice expressing a spontaneous Ebf1 mutation (Ebf1Serv/+; MGI:5007783) also exhibited reduced B cell numbers. Exogenous expression of EBF1 in mouse hematopoietic stem cells promotes B cell development, but the development of other hematopoietic cell lineages is impaired (15).

 

EBF1 regulates early B lymphopoiesis through the activation of the transcription of B cell specific genes as well as repressing the expression of drivers of alternative lineages (Table 1). EBF1 is predicted to affect approximately 200 target genes (16).  In some cases (e.g., Cd79a), EBF1 contributes to epigenetic regulation of the target gene promoter through CpG demethylation and nucleosomal remodeling, subsequently promoting access for other transcriptional regulators (17).  

 

 

Table 1. Select EBF1 target genes. For additional putative target genes see (16).

EBF1-mediated regulation

Gene symbol

Function

References

Activation

Cd79a (Igα, mb-1)

Component of the pre-BCR and BCR; see the record for crab

(18-20)

CD79b (Igβ, B29)

Component of the pre-BCR and BCR

(10;16;21)

Blk

BCR-associated tyrosine kinase; see the record for blaenka

(10;16;22)

Cd19

BCR co-receptor; see the record for hive

(10;16)

Igll1 (λ5)

B cell marker

(10;16;23)

Vpreb1

Component of the pre-BCR

(10;16;24)

Hes1

Basic helix-loop-helix protein that functions in neurogenesis, myogenesis, hematopoiesis, and sex determination

(10;16)

Sox4

B and T cell transcription factor; required for B cell development

(10;16)

Pax5

Transcription factor; see the record for Apple

(10;25)

Pou2af1 (OCA-B/BOB-1/OBF1)

Transcription factor that functions in normal production of immunoglobulin isotypes, immune responses, and germinal center formation

(10;16;26;27)

Foxo1

Transcription factor in B cell signaling and proliferation

(10;28)

Ceacam1

Cell–cell adhesion molecule on leukocytes, epithelia, and endothelia

(16;29)

Cd53

Cell surface protein that contributes to the transduction of CD2-generated signals in T cells and natural killer cells

(16;29)

Dok3

Immunomodulatory adaptor

(16;30)

SLAMF1/CD150

Co-stimulatory receptor expressed on mature lymphocytes

(31)

Repression

Cebpa (C/EBPα)

Determinant of myeloid differentiation

(32-34)

Sfpi1 (PU.1)

Transcription factor in myeloid differentiation

(32;33)

Id2 and Id3

Transcription factors that inhibit the function of E2A proteins

(32;33;35)

Hnf1a

Transcription factor

(35)

Cd244

NK lineage genes

(36)

Cd160

Klrb1c

Nfil3

Transcription factor that promotes NK cell development

(36;37)

Pdcd1

Members of the CD28 family

(16)

Ctla4

Icosl

Ligand of the Icos receptor

Hlx

Homeobox factor that regulates Th1 differentiation

PKCθ

Serine threonine kinase; see the record for celina

(38)

Rag1 and Rag2

Enzymes required for V(D)J recombination; see the records for maladaptive (Rag1) and snowcock (Rag2)

(39)

Prdm1 (Blimp1)

Functions in plasma cell differentiation; EBF1 controls Prdm1 expression in immature B cells

(40)

 

EBF1 also has putative functions in the regulation of adipocyte morphology and lipolysis in white adipose tissue (34;41-43). Ebf1 heterozygous mice on high-fat diets showed increased white adipose tissue atrophy and attenuated insulin sensitivity compared to wild-type controls (41). In human adipocytes, 2,501 genes are putative EBF1 target genes, including PPARG, NCOR2, LIPE, and ADIPOQ (41). Ebf1-/- mice had increased formation of bone marrow adipocytes as well as loss of visceral white adipose tissue deposition (43;44).

 

EBF1 is a negative regulator of osteoblast differentiation and bone formation in a non cell-autonomous manner (45). Ebf1-/- mice exhibited increased numbers of osteoblasts as well as increases in bone formation parameters (43;44). However, mice with loss of EBF1 expression only in cells of the osteoblast lineage exhibited no overt phenotypes, including in osteoblast differentiation, bone formation, or bone mass (45).

 

EBF1 functions in in postnatal glomerular and podocyte maturation as well as the maintenance of kidney function (46). Kidneys from Ebf1-/- mice showed thinned cortices, reduced glomerular maturation, early albuminuria, elevated blood urea nitrogen levels, reduced glomerular filtration rate (46).

 

EBF1 functions in the regulation of GLUT4-mediated insulin-stimulated glucose uptake in muscle and adipose tissue by inhibiting GLUT4 expression (47). The Ebf1-/- mice were also slightly hypoglycemic and hypotriglyceridemic (43).

 

In the retina, EBF1 is required for specifying several retinal cell types and subtypes from postmitotic precursors (48). EBF1 is both necessary and sufficient for specifying non-AII glycinergic amacrine, type 2 OFF-cone bipolar and horizontal cells, but is only necessary (but not sufficient) for specifying ganglion cells (48). EBF1 is required for the suppression of Muller cell fate during retinogenesis as well as for the correct topographic projection of retinal ganglion cell axons at the optic chiasm (49).

Putative Mechanism

The phenotype of the crater_lake phenotype indicates loss of EBF1crater_lake function in regulating the expression of EBF1 target genes (Table 1).

Primers PCR Primer
Crater_lake(F):5'- TGTTTCTTCAAGAGGGTCAGTC -3'
Crater_lake(R):5'- CACACAATGTACCAAGATGAGTTG -3'

Sequencing Primer
Crater_lake_seq(F):5'- GGTCAGTCCCTTCATAGTAAACG -3'
Crater_lake_seq(R):5'- GTCTTGTCCAAGAGGGTA -3'
References
Science Writers Anne Murray
Illustrators Diantha La Vine
AuthorsXue Zhong and Bruce Beutler
List |< first << previous [record 17 of 132] next >> last >|