Phenotypic Mutation 'Rigged'

• Allele: Rigged
• Mutation Type: start codon destroyed
• Chromosome: 14
• Coordinate: 30,332,258 bp (GRCm39)
• Base Change: A ⇒ G (forward strand)
• Gene: Prkcd
• Gene Name: protein kinase C, delta
• Synonym(s): PKC[d], D14Ertd420e, Pkcd, PKCdelta
• Chromosomal Location: 30,317,311-30,348,167 bp (-) (GRCm39)
• MGI Phenotype: FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Protein kinase C (PKC) is a family of serine- and threonine-specific protein kinases that can be activated by calcium and the second messenger diacylglycerol. PKC family members phosphorylate a wide variety of protein targets and are known to be involved in diverse cellular signaling pathways. PKC family members also serve as major receptors for phorbol esters, a class of tumor promoters. Each member of the PKC family has a specific expression profile and is believed to play distinct roles in cells. The protein encoded by this gene is one of the PKC family members. Studies both in human and mice demonstrate that this kinase is involved in B cell signaling and in the regulation of growth, apoptosis, and differentiation of a variety of cell types. Alternatively spliced transcript variants encoding the same protein have been observed. [provided by RefSeq, Jul 2008] ; PHENOTYPE: Mice homozygous for a null allele exhibit decreased neutrophil cell numbers and activity, increased B cell numbers and proliferation, increased acute inflammation, and increased IgG1 and IgA serum levels. [provided by MGI curators]
• Mapped: Yes
• Amino Acid Change: Methionine changed to Threonine
• Institutional Source: Beutler Lab
• Gene Model: predicted gene model for protein(s): [ENSMUSP00000022521] [ENSMUSP00000107821] [ENSMUSP00000107822] [ENSMUSP00000107825] [ENSMUSP00000107826] [ENSMUSP00000107829] [ENSMUSP00000107830]
• AlphaFold: P28867
• PDB Structure: PROTEIN KINASE C DELTA CYS2 DOMAIN [X-RAY DIFFRACTION] ; PROTEIN KINASE C DELTA CYS2 DOMAIN COMPLEXED WITH PHORBOL-13-ACETATE [X-RAY DIFFRACTION] ; Structural and functional characterization of an anesthetic binding site in the second cysteine-rich domain of protein kinase Cdelta [X-RAY DIFFRACTION] ; Structural and functional characterization of an anesthetic binding site in the second cysteine-rich domain of protein kinase Cdelta [X-RAY DIFFRACTION] ; Structural and functional characterization of an anesthetic binding site in the second cysteine-rich domain of protein kinase Cdelta [X-RAY DIFFRACTION] ; Structural and functional characterization of an anesthetic binding site in the second cysteine-rich domain of protein kinase C delta [X-RAY DIFFRACTION] ; Structural and functional characterization of an anesthetic binding site in the second cysteine-rich domain of protein kinase C delta [X-RAY DIFFRACTION] ; Structural and functional characterization of an anesthetic binding site in the second cysteine-rich domain of protein kinase C delta [X-RAY DIFFRACTION]
• SMART Domains: Protein: ENSMUSP00000022521; Gene: ENSMUSG00000021948; AA Change: M1T

Domain	Start	End	E-Value	Type
C2	11	100	1.28e0	SMART
C1	159	208	1.38e-13	SMART
C1	231	280	3.19e-18	SMART
S_TKc	373	627	1.17e-97	SMART
S_TK_X	628	691	8.92e-25	SMART

• Predicted Effect: probably null ; PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
  (Using ENSMUST00000022521)
• SMART Domains: Protein: ENSMUSP00000107821; Gene: ENSMUSG00000021948

Domain	Start	End	E-Value	Type
C1	44	93	1.38e-13	SMART
C1	116	165	3.19e-18	SMART
S_TKc	258	512	1.17e-97	SMART

• Predicted Effect: probably benign
• SMART Domains: Protein: ENSMUSP00000107822; Gene: ENSMUSG00000021948

Domain	Start	End	E-Value	Type
C1	44	93	1.38e-13	SMART
C1	116	165	3.19e-18	SMART
S_TKc	232	486	1.17e-97	SMART

• Predicted Effect: probably benign
• SMART Domains: Protein: ENSMUSP00000107825; Gene: ENSMUSG00000021948

Domain	Start	End	E-Value	Type
C1	44	93	1.38e-13	SMART
C1	116	165	3.19e-18	SMART
S_TKc	258	512	1.17e-97	SMART
S_TK_X	513	576	8.92e-25	SMART

• Predicted Effect: probably benign
• SMART Domains: Protein: ENSMUSP00000107826; Gene: ENSMUSG00000021948

Domain	Start	End	E-Value	Type
C1	44	93	1.38e-13	SMART
C1	116	165	3.19e-18	SMART
S_TKc	232	486	1.17e-97	SMART
S_TK_X	487	550	8.92e-25	SMART

• Predicted Effect: probably benign
• SMART Domains: Protein: ENSMUSP00000107827; Gene: ENSMUSG00000021948

Domain	Start	End	E-Value	Type
C2	11	100	1.28e0	SMART
C1	159	208	1.38e-13	SMART
C1	231	280	3.19e-18	SMART
S_TKc	347	601	1.17e-97	SMART
S_TK_X	602	665	8.92e-25	SMART

• Predicted Effect: noncoding transcript
• SMART Domains: Protein: ENSMUSP00000107829; Gene: ENSMUSG00000021948; AA Change: M1T

Domain	Start	End	E-Value	Type
C2	11	100	1.28e0	SMART
C1	159	208	1.38e-13	SMART
C1	231	280	3.19e-18	SMART
S_TKc	347	601	1.17e-97	SMART
S_TK_X	602	665	8.92e-25	SMART

• Predicted Effect: probably null ; PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
  (Using ENSMUST00000112210)
• SMART Domains: Protein: ENSMUSP00000107830; Gene: ENSMUSG00000021948; AA Change: M1T

Domain	Start	End	E-Value	Type
C2	11	100	1.28e0	SMART
C1	159	208	1.38e-13	SMART
C1	231	280	3.19e-18	SMART
S_TKc	373	627	1.17e-97	SMART
S_TK_X	628	691	8.92e-25	SMART

• Predicted Effect: probably null ; PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
  (Using ENSMUST00000112211)
• Meta Mutation Damage Score: 0.9696
• Is this an essential gene?: Possibly nonessential (E-score: 0.420)
• Phenotypic Category: Autosomal Recessive
• Mode of Inheritance: Autosomal Recessive
• Last Updated: 2019-10-23 1:57 PM by Diantha La Vine
• Record Created: 2016-11-08 12:37 PM
• Record Posted: 2018-07-18
• Science Writers: Anne Murray
• Illustrators: Diantha La Vine
• Authors: Emre Turer, William McAlpine, Kuan-Wen Wang, Tianshi Lu, and Bruce Beutler

Accession Number

NCBI RefSeq: NM_001310682 (variant 1), NM_011103 (variant 2); MGI:97598

Alleles Listed at MGI

All Mutations and Alleles(11) : Gene trapped(2) Targeted(8) Transgenic(1)

Phenotypic Description

Figure 1. Rigged mice exhibited susceptibility to dextran sodium sulfate (DSS)-induced colitis at 7 days post-DSS treatment . Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 2. Rigged mice exhibited susceptibility to dextran sodium sulfate (DSS)-induced colitis at 10 days post-DSS treatment . Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The rigged phenotype was identified among N-ethyl-N-nitrosourea (ENU)-mutagenized G3 mice of the pedigree R4750, some of which showed susceptibility to dextran sodium sulfate (DSS)-induced colitis at 7 (Figure 1) and 10 days (Figure 2) post-DSS treatment.

Nature of Mutation

Figure 3. Linkage mapping of the DSS susceptibility phentoype (day 10) using a recessive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 90 mutations (X-axis) identified in the G1 male of pedigree R4750. Normalized phenotype data are shown for single locus linkage analysis without consideration of G2 dam identity. Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 90 mutations. The DSS susceptibility phenotype was linked by continuous variable mapping to a mutation in Prkcd: a T to C transition at base pair 30,610,301 (v38) on chromosome 14, or base pair 16,114 in the GenBank genomic region NC_000080 encoding Prkcd. The strongest association was found with a recessive model of inheritance to the day 10 DSS phenotype, wherein three variant homozygotes departed phenotypically from 14 homozygous reference mice and 16 heterozygous mice with a P value of 4.274 x 10^-5 (Figure 3).  

The mutation corresponds to residue 10 in the mRNA sequence NM_001310682 within exon 1 of 17 total exons.

9 ATGGCACCCTTCCTGCGC 1 -M--A--P--F--L--R-

The mutated nucleotide is indicated in red. The mutation results in a methionine to threonine substitution at position 1 (M1T) in the PRKCD protein, and is strongly predicted by PolyPhen-2 to be damaging (score = 0.988).

Protein Prediction

Figure 4. Domain organization of PRKCD. The location of the Rigged mutation is indicated. Orange ovals represent phosphorylation sites. Additional mutations found in PRKCD are noted in red. Click on each mutation for more information.

Prkcd encodes PKCδ, a member of the protein kinase C (PKC) family of serine-threonine kinases. At least 11 mammalian PKC proteins are known with a wide range of tissue distribution, subcellular localization, and function. The PKC family belongs to the AGC-type kinase (protein kinase A/protein kinase G/protein kinase C) superfamily. 

PKC kinases share certain structural features. PKC kinases have highly conserved catalytic domains consisting of motifs required for ATP-substrate binding and catalysis. The PKC kinases also have a regulatory domain that maintains the enzyme in an inactive conformation. The regulatory and catalytic domains are attached to each other by a hinge region. PKC kinases can be split into three groups: conventional (α, βI, βII, and γ), novel (δ, ϵ, η, θ), and atypical (ζ and ι/λ). These classifications are based on the structural motifs in the regulatory domain that account for cofactor dependence and interactions during induction of catalytic activity. PKCδ is a novel PKC that requires diacylglycerol (DAG) to become activated; PKCδ can also bind phorbol ester, bombesin, serum, platelet-derived growth factor, and epidermal growth factor (1;2).

Similar to other members of the PKC family (see the record for celina [Prkcq] and Untied [Prkcb]), PKCδ has a C2-like domain, two tandem cysteine-rich zinc finger C1 domains (C1a and C1b), a kinase (C3/C4) domain, and a AGC-kinase C-terminal domain (Figure 4).

The C2-like domain is approximately 130 amino acids long and binds to anionic phospholipids present in membranes in a Ca²⁺-dependent manner (3). 

The C1 domains have a HX₁₂CX₂CX_nCX₂CX₄HX₂CX₇C motif, where H is histidine, C is cysteine, X is any other amino acid, and n is 13 or 14. The C1 domains facilitate DAG and phorbol ester binding. In the C1b domain, the phorbol ester binds to a pocket between two β-sheets [PDB:3UGD; (4)]. The C1 domains also function as hydrophobic switches to anchor PKCs to the membrane (5). The C1 domain has two zinc-coordinating sites required for C1 domain folding. 

The kinase domain has a glycine-rich ATP-binding loop with a GXGXXG sequence (amino acids 387-392) that is found in protein kinases and nucleotide binding proteins. An invariant Lys (Lys409) promotes phosphoryl-transfer. The C-terminal lobe of the kinase domain is predominantly α-helical and contains the activation loop. Met458 connects the two lobes of the kinase domain and controls access to a cavity in the ATP binding pocket. Within the C-terminal catalytic domain is an ATP-binding site (C3) and a substrate-binding domain (C4). 

PKCδ is sequentially phosphorylated at Thr505, Ser643, and Ser662 (6-8). First, Thr505 within the activation loop is phosphorylated by PDK-1 (or a related enzyme). Second, Ser643 and Ser662 within the AGC-kinase C-terminal domain are phosphorylated; Ser642 is autophosphorylated, and Ser662 is phosphorylated by an unidentified kinase (9;10). Phosphorylation of the AGC-kinase C-terminal domain regulates the function of PKCδ by controlling both intra- and inter-molecular interactions [SMART; (11;12)]. Ser643 is within a turn motif, and Ser662 is in a hydrophobic pocket. Phosphorylated PKCδ is in a mature and stable conformation that can be activated by DAG or phorbol ester. PKCδ is also phosphorylated at several tyrosine residues (Tyr52, Tyr155, Tyr187, Tyr311, Tyr322, and Tyr565) after cell stimulation (8;13-17). Tyrosine phosphorylation may regulate the catalytic activity of PKCδ. Phosphorylation of Tyr311 promotes PKCδ degradation after ubiquitination (17;18).

A catalytically active fragment of PKCδ is generated in cells induced to undergo apoptosis by ionizing radiation, DNA-damaging drugs, and anti-Fas (see the record for cherry) antibody (19-21)­. Caspase-3, or a related enzyme, cleaves PKCδ between Asp327 and Asn328. The catalytically active fragment of PKCδ inhibits the function of DNA-dependent protein kinase (DNA-PK_CS; see the record for clover) and promotes DNA damage-induced apoptosis (22).

The rigged mutation results in a methionine to threonine substitution at position 1 (M1T) in the PKCδ protein. The next methionine is at residue 32. Both residues are within the C2 domain.

Expression/Localization

In their inactive conformations, most PKC proteins are localized in the cytosol and often associate with cytoskeletal proteins (23). Upon activation, PKCs translocate to the plasma membrane via a mechanism that involves phospholipase C (PLC)-derived DAG accumulation (7;24).

Background

Figure 5. BCR Signaling. Pre-BCR engagement results in the activation of SYK (spleen tyrosine kinase), which together with Src-family  kinases (LYN, FYN, BLK), phosphorylates many substrates and triggering signaling pathways that are involved in both proliferation and differentiation of pre-B cells. These include activation of phosphoinositide 3 kinase (PI3K) by phosphorylating the coreceptor CD19 and/or the adaptor protein B-cell PI3K adaptor (BCAP). PI3K activation results in the generation of phosphatidylinosital-3,4,5-triphosphate (PIP3), which recruits plekstrin-homology domain signaling molecules to the membrane including the serine threonine protein kinase B (PKB) and its activating kinase 3- phosphoinositide-dependent protein kinase 1 (PDK1). Signaling through this pathway pathway suppresses recombination-activating gene 1 (RAG1) and RAG2 expression, blocks Igk (the k chain of the immunoglobin light chain) gene recombination and induces cell proliferation. SYK also phosphorylates SH2-domain containing leukocyte protein of SLP65, resulting in the organization of a molecular complex that includes Bruton’s tyrosine kinase (BTK) and phospholipase Cg2 (PLCg2). This complex controls downregulation of l-5, a component of the surrogate light chain (SLC), and upregulates the expression of RAG proteins and the interferon-regulatory factor 4 (IRF4). IRF4 positively regulates Igk recombination. SLP65 also modulates PKB activity either directly or by altering the activity of SYK, CD19, or PI3K. Alternatively, SLP65 may regulate PKB activity by activating lipid phosphatases such as SH2-domain containing inositol-5 phosphate (SHIP) and altering PIP3 levels. Multiple downstream signaling pathways are activated by BCR stimulation and lead to a multitude of cellular responses. Following aggregation and localization of BCR molecules, the tails of Igα and Igβ become phosphorylated by Src family kinases (typically Lyn) and by SYK. These phosphotyrosines then act as docking sites for the SH2 domains of SYK, resulting in SYK phosphorylation and activation. SYK phosphorylates a number of downstream targets including BLNK, PLC-g2 and protein kinase C β (PKCβ). BCR stimulation also activates phosphatidylinositol 3 kinase (PI3K) resulting in the generation of 3′-phosphorylated phosphoinositides. One of these lipids, phosphatidylinositol-3,4,5-triphosphate (PIP3), binds selectively to the pleckstrin homology (PH) domain of Btk, facilitating membrane recruitment of the kinase. Phosphorylated BLNK also provides docking sites for Btk, as well as PLC-g2, which results in the additional phosphorylation and activation of PLC-γ2 by Btk leading to the hydrolysis of phosphatidylinositol-3,4-diphosphate (PIP2) to inositol-1,4,5-trisphosphate (IP3) and diacylglycerol (DAG). Soluble IP3 and membrane-bound DAG initiate downstream signal transduction pathways involving calcium (Ca2+) mobilization and PKC, respectively. The recruitment of Vav, Nck and Ras by BLNK to the BCR activates MAP kinase cascades such as JNK, p38 and extracellular signal regulated kinase (ERK). Together, these signals allow the activation of multiple transcription factors, including nuclear factor of activated T cells (NF-AT), nuclear factor (NF)-κB and AP-1, which subsequently regulate biological responses including cell proliferation, differentiation and apoptosis, as well as the secretion of antigen-specific antibodies. Other molecules that play important roles in BCR signaling include Bcl10, mucosa-associated lymphoid tissue translocation gene 1 (MALT1), and caspase recruitment domain family, member 11 (CARMA1 or CARD11), which are involved in NF-κB activation along with PKCβ. This image is interactive. Click on the image to view mutations found within the pathway (red) and the genes affected by these mutations (black). Click on the mutations for more specific information. This image is interactive. Click to view additional mutations. Click on each mutation for more information.

Many functions have been ascribed to PKC kinases due to their widespread expression and variety of substrates. PKCs are involved in receptor desensitization, modulating membrane structure events, regulating transcription, mediating immune responses, regulating cell growth, and in learning and memory. A high degree of redundancy or cross talk among different PKC proteins can also occur, making the identification of isoform-specific roles difficult. The development of knockout mice for various PKC genes has enabled identification of the in vivo pathways and processes these proteins are involved in as opposed to their broad in vitro substrate specificity. 

Members of the PKC family play important roles in signaling for various growth factors, cytokines, and hormones including those involved in the regulation of cell growth, apoptosis, and differentiation of hematopoietic cells. These include platelet-derived growth factor (PDGF), insulin-like growth factor 1 (IGF-1), erythropoietin (EPO), thrombopoietin (TPO), stem cell factor (SCF), tumor necrosis factor (TNF), granulocyte-macrophage colony-stimulating factor (GM-CSF), G-CSF, M-CSF, type I and II interferons (IFNs) and various interleukins (ILs).

PKCδ functions in B-cell receptor-mediated signaling. Engagement of the BCR initiates receptor aggregation, resulting in activation of receptor-associated Src-family kinases, as well as Syk and Bruton’s tyrosine kinase (Btk)/Tec family kinases. These initial events facilitate the recruitment and activation of additional kinases and adaptor proteins within membrane raft microdomains leading to the formation of a mature BCR ‘signalosome’ and promoting the full activation of several downstream signaling cascades including the generation of the second messengers DAG and IP₃. Soluble IP₃ and membrane-bound DAG initiate downstream signal transduction pathways involving Ca²⁺ and PKC isoforms, respectively. These, together with additional signal transduction cascades, lead to the activation of multiple transcription factors, including nuclear factor of activated T cells (NF-AT), NF-κB and activator protein 1, which subsequently regulate biological responses including cell proliferation, differentiation and apoptosis, as well as the secretion of antigen-specific antibodies.

Mutations in PRKCD are linked to autoimmune lymphoproliferative syndrome, type III (ALPS3; OMIM: #615559; (25-27)). ALPS3 patients exhibit variable phenotypes, but most have lymphadenopathy associated with variable autoimmune manifestations. Some patients may have recurrent infections. Lymphocyte accumulation results from a combination of impaired apoptosis and excessive proliferation. PKCs have long been known to play important roles in the development of cancer. Phorbol esters are known to promote tumor formation and partially do so by activating PKC enzymes, thus promoting cellular survival and proliferation [reviewed by (28)]. PKCs were originally thought to be pro-mitogenic kinases, but this activity can be PKC-isozyme-dependent and cell-type dependent, as many PKCs can also inhibit cell cycle progression and promote apoptosis. Altered PKC levels are found in many types of human cancers.

Prkcd-deficient (Prkcd^-/-) mice are viable, but often develop autoimmune disease as well as enlarged lymph nodes and spleens with multiple germinal centers (29). Prkcd^-/- mice have increased numbers of IgM+ B cells in the spleen and lymph nodes, but normal numbers of splenic and peritoneal CD5+ B cells (29;30). The number of neutrophils in the cerebral cortex and striatum of the Prkcd^-/- mice was reduced compared to wild-type mice (31). The levels of IgG1, IgM, and IgA were elevated in the serum from the mice (29;30;32). Some mice exhibited reduced glucose-stimulated insulin secretion compared to wild-type mice (33). Prkcd^-/- mice exhibited normal B-cell receptor-mediated activation in response to stimulation, but the induction of tolerance was defective (30). Prkcd^-/- mice exhibited less ossification and delayed chondrocyte maturation in long bones compared to wild-type controls (34).

Putative Mechanism

Figure 6. PKCδ functions in oxidant-induced disruption of the microtubule cytoskeleton and regulation of permeability barrier of colonic epithelia.

PKCδ mediates intestinal inflammatory responses to specific challenges. PKCδ expression levels in the intestine increase in response to endotoxin or 2,4,6-trinitrobenzenesulfonic acid (TNBS) challenge, and PKCδ is activated in intestinal epithelial cells in response to TNF-α treatment. PKCδ functions in oxidant-induced disruption of the microtubule cytoskeleton and permeability barrier of colonic epithelia in vitro (35). PKCδ activation is also associated with increased injury susceptibility in neonatal rat colon (36). The colitis susceptibility phenotype observed in the Rigged mice is consistent with loss of PKCδ function.

Primers

PCR Primer
Rigged_pcr_F: AACTGGGTGCTTCTGTCTTC
Rigged_pcr_R: CCTGGCATGTACAGCTGTTC

Sequencing Primer
Rigged_seq_F: ATCCTCAGCTGGGTCGTTCAG
Rigged_seq_R: CTGTAATTGCCTAAGGATCACAGGC

Genotyping

PCR program

1) 94°C 2:00
2) 94°C 0:30
3) 55°C 0:30
4) 72°C 1:00
5) repeat steps (2-4) 40x
6) 72°C 10:00
7) 4°C hold

The following sequence of 419 nucleotides is amplified (chromosome 14, - strand):

1   cctggcatgt acagctgttc tgtaattgcc taaggatcac aggctcaaat gcttccaggg
61  ccccattcag gaatggggac agtggcctgg cttggtagac tgacagaaaa gcagctacca
121 tgttgctcta ttgcctcggc ttcatgctca ctgtacaatc tcactccagg ctccatcatg
181 gcacccttcc tgcgcatctc cttcaattcc tatgagctgg gctccctgca agttgaggac
241 gaagcaagcc agcctttctg tgctgtgaag atgaaggagg cactcagcac aggtagggtt
301 ggaagggtcc ctagaggggc atggggctca gggtgaaggg aggcttccct tcttctctag
361 atcctcttgc cttcctgaac gacccagctg aggatgcagg aagacagaag cacccagtt

Primer binding sites are underlined and the sequencing primers are highlighted; the mutated nucleotide is shown in red.

References

  1. Ohno, S., Mizuno, K., Adachi, Y., Hata, A., Akita, Y., Akimoto, K., Osada, S., Hirai, S., and Suzuki, K. (1994) Activation of Novel Protein Kinases C Delta and C Epsilon upon Mitogenic Stimulation of Quiescent Rat 3Y1 Fibroblasts. J Biol Chem. 269, 17495-17501.

  2. Olivier, A. R., and Parker, P. J. (1994) Bombesin, Platelet-Derived Growth Factor, and Diacylglycerol Induce Selective Membrane Association and Down-Regulation of Protein Kinase C Isotypes in Swiss 3T3 Cells. J Biol Chem. 269, 2758-2763.

  3. Kikkawa, U., Matsuzaki, H., and Yamamoto, T. (2002) Protein Kinase C Delta (PKC Delta): Activation Mechanisms and Functions. J Biochem. 132, 831-839.

  4. Zhang, G., Kazanietz, M. G., Blumberg, P. M., and Hurley, J. H. (1995) Crystal Structure of the cys2 Activator-Binding Domain of Protein Kinase C Delta in Complex with Phorbol Ester. Cell. 81, 917-924.

  5. Xu, R. X., Pawelczyk, T., Xia, T. H., and Brown, S. C. (1997) NMR Structure of a Protein Kinase C-Gamma Phorbol-Binding Domain and Study of Protein-Lipid Micelle Interactions. Biochemistry. 36, 10709-10717.

  6. Parekh, D. B., Ziegler, W., and Parker, P. J. (2000) Multiple Pathways Control Protein Kinase C Phosphorylation. EMBO J. 19, 496-503.

  7. Newton, A. C. (2001) Protein Kinase C: Structural and Spatial Regulation by Phosphorylation, Cofactors, and Macromolecular Interactions. Chem Rev. 101, 2353-2364.

  8. Konishi, H., Yamauchi, E., Taniguchi, H., Yamamoto, T., Matsuzaki, H., Takemura, Y., Ohmae, K., Kikkawa, U., and Nishizuka, Y. (2001) Phosphorylation Sites of Protein Kinase C Delta in H2O2-Treated Cells and its Activation by Tyrosine Kinase in Vitro. Proc Natl Acad Sci U S A. 98, 6587-6592.

  9. Le Good, J. A., Ziegler, W. H., Parekh, D. B., Alessi, D. R., Cohen, P., and Parker, P. J. (1998) Protein Kinase C Isotypes Controlled by Phosphoinositide 3-Kinase through the Protein Kinase PDK1. Science. 281, 2042-2045.

  10. Ziegler, W. H., Parekh, D. B., Le Good, J. A., Whelan, R. D., Kelly, J. J., Frech, M., Hemmings, B. A., and Parker, P. J. (1999) Rapamycin-Sensitive Phosphorylation of PKC on a Carboxy-Terminal Site by an Atypical PKC Complex. Curr Biol. 9, 522-529.

  11. Parker, P. J., and Parkinson, S. J. (2001) AGC Protein Kinase Phosphorylation and Protein Kinase C. Biochem Soc Trans. 29, 860-863.

  12. Newton, A. C. (2003) Regulation of the ABC Kinases by Phosphorylation: Protein Kinase C as a Paradigm. Biochem J. 370, 361-371.

  13. Denning, M. F., Dlugosz, A. A., Howett, M. K., and Yuspa, S. H. (1993) Expression of an Oncogenic rasHa Gene in Murine Keratinocytes Induces Tyrosine Phosphorylation and Reduced Activity of Protein Kinase C Delta. J Biol Chem. 268, 26079-26081.

  14. Li, W., Mischak, H., Yu, J. C., Wang, L. M., Mushinski, J. F., Heidaran, M. A., and Pierce, J. H. (1994) Tyrosine Phosphorylation of Protein Kinase C-Delta in Response to its Activation. J Biol Chem. 269, 2349-2352.

  15. Szallasi, Z., Denning, M. F., Chang, E. Y., Rivera, J., Yuspa, S. H., Lehel, C., Olah, Z., Anderson, W. B., and Blumberg, P. M. (1995) Development of a Rapid Approach to Identification of Tyrosine Phosphorylation Sites: Application to PKC Delta Phosphorylated upon Activation of the High Affinity Receptor for IgE in Rat Basophilic Leukemia Cells. Biochem Biophys Res Commun. 214, 888-894.

  16. Li, W., Chen, X. H., Kelley, C. A., Alimandi, M., Zhang, J., Chen, Q., Bottaro, D. P., and Pierce, J. H. (1996) Identification of Tyrosine 187 as a Protein Kinase C-Delta Phosphorylation Site. J Biol Chem. 271, 26404-26409.

  17. Blake, R. A., Garcia-Paramio, P., Parker, P. J., and Courtneidge, S. A. (1999) Src Promotes PKCdelta Degradation. Cell Growth Differ. 10, 231-241.

  18. Lu, Z., Liu, D., Hornia, A., Devonish, W., Pagano, M., and Foster, D. A. (1998) Activation of Protein Kinase C Triggers its Ubiquitination and Degradation. Mol Cell Biol. 18, 839-845.

  19. Emoto, Y., Manome, Y., Meinhardt, G., Kisaki, H., Kharbanda, S., Robertson, M., Ghayur, T., Wong, W. W., Kamen, R., and Weichselbaum, R. (1995) Proteolytic Activation of Protein Kinase C Delta by an ICE-Like Protease in Apoptotic Cells. EMBO J. 14, 6148-6156.

  20. Ghayur, T., Hugunin, M., Talanian, R. V., Ratnofsky, S., Quinlan, C., Emoto, Y., Pandey, P., Datta, R., Huang, Y., Kharbanda, S., Allen, H., Kamen, R., Wong, W., and Kufe, D. (1996) Proteolytic Activation of Protein Kinase C Delta by an ICE/CED 3-Like Protease Induces Characteristics of Apoptosis. J Exp Med. 184, 2399-2404.

  21. Mizuno, K., Noda, K., Araki, T., Imaoka, T., Kobayashi, Y., Akita, Y., Shimonaka, M., Kishi, S., and Ohno, S. (1997) The Proteolytic Cleavage of Protein Kinase C Isotypes, which Generates Kinase and Regulatory Fragments, Correlates with Fas-Mediated and 12-O-Tetradecanoyl-Phorbol-13-Acetate-Induced Apoptosis. Eur J Biochem. 250, 7-18.

  22. Bharti, A., Kraeft, S. K., Gounder, M., Pandey, P., Jin, S., Yuan, Z. M., Lees-Miller, S. P., Weichselbaum, R., Weaver, D., Chen, L. B., Kufe, D., and Kharbanda, S. (1998) Inactivation of DNA-Dependent Protein Kinase by Protein Kinase Cdelta: Implications for Apoptosis. Mol Cell Biol. 18, 6719-6728.

  23. Keenan, C., and Kelleher, D. (1998) Protein Kinase C and the Cytoskeleton. Cell Signal. 10, 225-232.

  24. Collazos, A., Diouf, B., Guerineau, N. C., Quittau-Prevostel, C., Peter, M., Coudane, F., Hollande, F., and Joubert, D. (2006) A Spatiotemporally Coordinated Cascade of Protein Kinase C Activation Controls Isoform-Selective Translocation. Mol Cell Biol. 26, 2247-2261.

  25. Kuehn, H. S., Niemela, J. E., Rangel-Santos, A., Zhang, M., Pittaluga, S., Stoddard, J. L., Hussey, A. A., Evbuomwan, M. O., Priel, D. A., Kuhns, D. B., Park, C. L., Fleisher, T. A., Uzel, G., and Oliveira, J. B. (2013) Loss-of-Function of the Protein Kinase C Delta (PKCdelta) Causes a B-Cell Lymphoproliferative Syndrome in Humans. Blood. 121, 3117-3125.

  26. Belot, A., Kasher, P. R., Trotter, E. W., Foray, A. P., Debaud, A. L., Rice, G. I., Szynkiewicz, M., Zabot, M. T., Rouvet, I., Bhaskar, S. S., Daly, S. B., Dickerson, J. E., Mayer, J., O'Sullivan, J., Juillard, L., Urquhart, J. E., Fawdar, S., Marusiak, A. A., Stephenson, N., Waszkowycz, B., W Beresford, M., Biesecker, L. G., C M Black, G., Rene, C., Eliaou, J. F., Fabien, N., Ranchin, B., Cochat, P., Gaffney, P. M., Rozenberg, F., Lebon, P., Malcus, C., Crow, Y. J., Brognard, J., and Bonnefoy, N. (2013) Protein Kinase Cdelta Deficiency Causes Mendelian Systemic Lupus Erythematosus with B Cell-Defective Apoptosis and Hyperproliferation. Arthritis Rheum. 65, 2161-2171.

  27. Salzer, E., Santos-Valente, E., Klaver, S., Ban, S. A., Emminger, W., Prengemann, N. K., Garncarz, W., Mullauer, L., Kain, R., Boztug, H., Heitger, A., Arbeiter, K., Eitelberger, F., Seidel, M. G., Holter, W., Pollak, A., Pickl, W. F., Forster-Waldl, E., and Boztug, K. (2013) B-Cell Deficiency and Severe Autoimmunity Caused by Deficiency of Protein Kinase C Delta. Blood. 121, 3112-3116.

  28. Griner, E. M., and Kazanietz, M. G. (2007) Protein Kinase C and Other Diacylglycerol Effectors in Cancer. Nat Rev Cancer. 7, 281-294.

  29. Miyamoto, A., Nakayama, K., Imaki, H., Hirose, S., Jiang, Y., Abe, M., Tsukiyama, T., Nagahama, H., Ohno, S., Hatakeyama, S., and Nakayama, K. I. (2002) Increased Proliferation of B Cells and Auto-Immunity in Mice Lacking Protein Kinase Cdelta. Nature. 416, 865-869.

  30. Mecklenbrauker, I., Saijo, K., Zheng, N. Y., Leitges, M., and Tarakhovsky, A. (2002) Protein Kinase Cdelta Controls Self-Antigen-Induced B-Cell Tolerance. Nature. 416, 860-865.

  31. Chou, W. H., Choi, D. S., Zhang, H., Mu, D., McMahon, T., Kharazia, V. N., Lowell, C. A., Ferriero, D. M., and Messing, R. O. (2004) Neutrophil Protein Kinase Cdelta as a Mediator of Stroke-Reperfusion Injury. J Clin Invest. 114, 49-56.

  32. Nojima, T., Hayashi, K., Goitsuka, R., Nakayama, K., Nakayama, K., and Kitamura, D. (2006) Double Knockout Mice show BASH and PKCdelta have Different Epistatic Relationships in B Cell Maturation and CD40-Mediated Activation. Immunol Lett. 105, 48-54.

  33. Uchida, T., Iwashita, N., Ohara-Imaizumi, M., Ogihara, T., Nagai, S., Choi, J. B., Tamura, Y., Tada, N., Kawamori, R., Nakayama, K. I., Nagamatsu, S., and Watada, H. (2007) Protein Kinase Cdelta Plays a Non-Redundant Role in Insulin Secretion in Pancreatic Beta Cells. J Biol Chem. 282, 2707-2716.

  34. Tu, X., Joeng, K. S., Nakayama, K. I., Nakayama, K., Rajagopal, J., Carroll, T. J., McMahon, A. P., and Long, F. (2007) Noncanonical Wnt Signaling through G Protein-Linked PKCdelta Activation Promotes Bone Formation. Dev Cell. 12, 113-127.

  35. Banan, A., Fields, J. Z., Farhadi, A., Talmage, D. A., Zhang, L., and Keshavarzian, A. (2002) Activation of Delta-Isoform of Protein Kinase C is Required for Oxidant-Induced Disruption of both the Microtubule Cytoskeleton and Permeability Barrier of Intestinal Epithelia. J Pharmacol Exp Ther. 303, 17-28.

  36. Conte, M., Soper, B., Chang, Q., and Tepperman, B. (2004) The Role of PKCdelta and PKCepsilon in the Neonatal Rat Colon in Response to Hypoxia Challenge. Pediatr Res. 55, 27-33.