Phenotypic Mutation 'Rigged' (pdf version)
AlleleRigged
Mutation Type start codon destroyed
Chromosome14
Coordinate30,610,301 bp (GRCm38)
Base Change A ⇒ G (forward strand)
Gene Prkcd
Gene Name protein kinase C, delta
Synonym(s) Pkcd, D14Ertd420e, PKC[d], PKCdelta
Chromosomal Location 30,595,354-30,626,210 bp (-)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Protein kinase C (PKC) is a family of serine- and threonine-specific protein kinases that can be activated by calcium and the second messenger diacylglycerol. PKC family members phosphorylate a wide variety of protein targets and are known to be involved in diverse cellular signaling pathways. PKC family members also serve as major receptors for phorbol esters, a class of tumor promoters. Each member of the PKC family has a specific expression profile and is believed to play distinct roles in cells. The protein encoded by this gene is one of the PKC family members. Studies both in human and mice demonstrate that this kinase is involved in B cell signaling and in the regulation of growth, apoptosis, and differentiation of a variety of cell types. Alternatively spliced transcript variants encoding the same protein have been observed. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit decreased neutrophil cell numbers and activity, increased B cell numbers and proliferation, increased acute inflammation, and increased IgG1 and IgA serum levels. [provided by MGI curators]
Accession Number

NCBI RefSeq: NM_001310682 (variant 1), NM_011103 (variant 2); MGI:97598

Mapped Yes 
Amino Acid Change Methionine changed to Threonine
Institutional SourceBeutler Lab
Gene Model predicted gene model for protein(s): [ENSMUSP00000022521] [ENSMUSP00000107821] [ENSMUSP00000107822] [ENSMUSP00000107825] [ENSMUSP00000107826] [ENSMUSP00000107829] [ENSMUSP00000107830]
PDB Structure PROTEIN KINASE C DELTA CYS2 DOMAIN [X-RAY DIFFRACTION]
PROTEIN KINASE C DELTA CYS2 DOMAIN COMPLEXED WITH PHORBOL-13-ACETATE [X-RAY DIFFRACTION]
Structural and functional characterization of an anesthetic binding site in the second cysteine-rich domain of protein kinase Cdelta [X-RAY DIFFRACTION]
Structural and functional characterization of an anesthetic binding site in the second cysteine-rich domain of protein kinase Cdelta [X-RAY DIFFRACTION]
Structural and functional characterization of an anesthetic binding site in the second cysteine-rich domain of protein kinase Cdelta [X-RAY DIFFRACTION]
Structural and functional characterization of an anesthetic binding site in the second cysteine-rich domain of protein kinase C delta [X-RAY DIFFRACTION]
Structural and functional characterization of an anesthetic binding site in the second cysteine-rich domain of protein kinase C delta [X-RAY DIFFRACTION]
Structural and functional characterization of an anesthetic binding site in the second cysteine-rich domain of protein kinase C delta [X-RAY DIFFRACTION]
SMART Domains Protein: ENSMUSP00000022521
Gene: ENSMUSG00000021948
AA Change: M1T

DomainStartEndE-ValueType
C2 11 100 1.28e0 SMART
C1 159 208 1.38e-13 SMART
C1 231 280 3.19e-18 SMART
S_TKc 373 627 1.17e-97 SMART
S_TK_X 628 691 8.92e-25 SMART
Predicted Effect probably null

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
(Using ENSMUST00000022521)
SMART Domains Protein: ENSMUSP00000107821
Gene: ENSMUSG00000021948

DomainStartEndE-ValueType
C1 44 93 1.38e-13 SMART
C1 116 165 3.19e-18 SMART
S_TKc 258 512 1.17e-97 SMART
Predicted Effect probably benign
SMART Domains Protein: ENSMUSP00000107822
Gene: ENSMUSG00000021948

DomainStartEndE-ValueType
C1 44 93 1.38e-13 SMART
C1 116 165 3.19e-18 SMART
S_TKc 232 486 1.17e-97 SMART
Predicted Effect probably benign
SMART Domains Protein: ENSMUSP00000107825
Gene: ENSMUSG00000021948

DomainStartEndE-ValueType
C1 44 93 1.38e-13 SMART
C1 116 165 3.19e-18 SMART
S_TKc 258 512 1.17e-97 SMART
S_TK_X 513 576 8.92e-25 SMART
Predicted Effect probably benign
SMART Domains Protein: ENSMUSP00000107826
Gene: ENSMUSG00000021948

DomainStartEndE-ValueType
C1 44 93 1.38e-13 SMART
C1 116 165 3.19e-18 SMART
S_TKc 232 486 1.17e-97 SMART
S_TK_X 487 550 8.92e-25 SMART
Predicted Effect probably benign
SMART Domains Protein: ENSMUSP00000107827
Gene: ENSMUSG00000021948

DomainStartEndE-ValueType
C2 11 100 1.28e0 SMART
C1 159 208 1.38e-13 SMART
C1 231 280 3.19e-18 SMART
S_TKc 347 601 1.17e-97 SMART
S_TK_X 602 665 8.92e-25 SMART
Predicted Effect noncoding transcript
SMART Domains Protein: ENSMUSP00000107829
Gene: ENSMUSG00000021948
AA Change: M1T

DomainStartEndE-ValueType
C2 11 100 1.28e0 SMART
C1 159 208 1.38e-13 SMART
C1 231 280 3.19e-18 SMART
S_TKc 347 601 1.17e-97 SMART
S_TK_X 602 665 8.92e-25 SMART
Predicted Effect probably null

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
(Using ENSMUST00000112210)
SMART Domains Protein: ENSMUSP00000107830
Gene: ENSMUSG00000021948
AA Change: M1T

DomainStartEndE-ValueType
C2 11 100 1.28e0 SMART
C1 159 208 1.38e-13 SMART
C1 231 280 3.19e-18 SMART
S_TKc 373 627 1.17e-97 SMART
S_TK_X 628 691 8.92e-25 SMART
Predicted Effect probably null

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
(Using ENSMUST00000112211)
Meta Mutation Damage Score 0.9696 question?
Is this an essential gene? Possibly essential (E-score: 0.598) question?
Phenotypic Category
Phenotypequestion? Literature verified References
DSS: sensitive day 10
DSS: sensitive day 7
FACS NK cells - decreased
Candidate Explorer Status CE: excellent candidate; Verification probability: 0.852; ML prob: 0.796; human score: 4
Single pedigree
Linkage Analysis Data
Penetrance  
Alleles Listed at MGI

All Mutations and Alleles(11) : Gene trapped(2) Targeted(8) Transgenic(1)

Lab Alleles
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00467:Prkcd APN 14 30602422 splice site probably benign
IGL00715:Prkcd APN 14 30596003 missense probably damaging 1.00
IGL01914:Prkcd APN 14 30607426 missense possibly damaging 0.49
IGL02177:Prkcd APN 14 30605887 missense probably damaging 1.00
IGL02547:Prkcd APN 14 30599469 missense probably damaging 1.00
IGL02681:Prkcd APN 14 30601233 critical splice acceptor site probably null
rigged2 UTSW 14 30599743 missense probably damaging 1.00
IGL03014:Prkcd UTSW 14 30607337 missense probably damaging 1.00
R0240:Prkcd UTSW 14 30602088 missense probably damaging 0.97
R0240:Prkcd UTSW 14 30602088 missense probably damaging 0.97
R1385:Prkcd UTSW 14 30607405 missense probably damaging 1.00
R1567:Prkcd UTSW 14 30607448 missense probably benign 0.35
R2114:Prkcd UTSW 14 30605851 missense probably damaging 1.00
R2983:Prkcd UTSW 14 30599478 missense probably damaging 1.00
R3716:Prkcd UTSW 14 30599712 missense probably benign 0.00
R4162:Prkcd UTSW 14 30601197 missense probably damaging 0.98
R4164:Prkcd UTSW 14 30601197 missense probably damaging 0.98
R4180:Prkcd UTSW 14 30610304 utr 5 prime probably benign
R4637:Prkcd UTSW 14 30598765 missense probably benign 0.00
R4750:Prkcd UTSW 14 30610301 start codon destroyed probably null 0.99
R4756:Prkcd UTSW 14 30599666 missense probably benign 0.00
R4849:Prkcd UTSW 14 30599743 missense probably damaging 1.00
R4850:Prkcd UTSW 14 30599743 missense probably damaging 1.00
R4893:Prkcd UTSW 14 30599425 missense probably damaging 1.00
R4914:Prkcd UTSW 14 30605438 critical splice donor site probably null
R4925:Prkcd UTSW 14 30607613 missense probably damaging 0.98
R5644:Prkcd UTSW 14 30607413 missense probably benign 0.06
R5832:Prkcd UTSW 14 30605821 missense probably damaging 0.99
R5910:Prkcd UTSW 14 30595981 missense probably benign 0.01
R6049:Prkcd UTSW 14 30607297 missense possibly damaging 0.95
R6322:Prkcd UTSW 14 30599663 missense probably damaging 1.00
R7177:Prkcd UTSW 14 30599707 missense probably damaging 1.00
R7358:Prkcd UTSW 14 30605836 missense probably benign
R7494:Prkcd UTSW 14 30609193 missense probably benign 0.00
R7554:Prkcd UTSW 14 30609263 missense probably damaging 0.96
R7778:Prkcd UTSW 14 30605815 critical splice donor site probably null
R7810:Prkcd UTSW 14 30598450 splice site probably null
R8020:Prkcd UTSW 14 30609244 missense possibly damaging 0.58
R8145:Prkcd UTSW 14 30602062 missense probably benign 0.03
R8417:Prkcd UTSW 14 30609251 missense probably benign 0.36
Z1176:Prkcd UTSW 14 30610249 missense possibly damaging 0.78
Mode of Inheritance Autosomal Recessive
Local Stock
Repository
Last Updated 2019-10-23 1:57 PM by Diantha La Vine
Record Created 2016-11-08 12:37 PM
Record Posted 2018-07-18
Phenotypic Description

Figure 1. Rigged mice exhibited susceptibility to dextran sodium sulfate (DSS)-induced colitis at 7 days post-DSS treatment. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 2. Rigged mice exhibited susceptibility to dextran sodium sulfate (DSS)-induced colitis at 10 days post-DSS treatment. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The rigged phenotype was identified among N-ethyl-N-nitrosourea (ENU)-mutagenized G3 mice of the pedigree R4750, some of which showed susceptibility to dextran sodium sulfate (DSS)-induced colitis at 7 (Figure 1) and 10 days (Figure 2) post-DSS treatment.

Nature of Mutation

Figure 3. Linkage mapping of the DSS susceptibility phentoype (day 10) using a recessive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 90 mutations (X-axis) identified in the G1 male of pedigree R4750. Normalized phenotype data are shown for single locus linkage analysis without consideration of G2 dam identity. Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 90 mutations. The DSS susceptibility phenotype was linked by continuous variable mapping to a mutation in Prkcd: a T to C transition at base pair 30,610,301 (v38) on chromosome 14, or base pair 16,114 in the GenBank genomic region NC_000080 encoding Prkcd. The strongest association was found with a recessive model of inheritance to the day 10 DSS phenotype, wherein three variant homozygotes departed phenotypically from 14 homozygous reference mice and 16 heterozygous mice with a P value of 4.274 x 10-5 (Figure 3).  

 

The mutation corresponds to residue 10 in the mRNA sequence NM_001310682 within exon 1 of 17 total exons.

 

9 ATGGCACCCTTCCTGCGC

1 -M--A--P--F--L--R-

 

The mutated nucleotide is indicated in red. The mutation results in a methionine to threonine substitution at position 1 (M1T) in the PRKCD protein, and is strongly predicted by PolyPhen-2 to be damaging (score = 0.988).

Illustration of Mutations in
Gene & Protein
Protein Prediction
Figure 4. Domain organization of PRKCD. The location of the Rigged mutation is indicated. Orange ovals represent phosphorylation sites. Additional mutations found in PRKCD are noted in red. Click on each mutation for more information.

Prkcd encodes PKCδ, a member of the protein kinase C (PKC) family of serine-threonine kinases. At least 11 mammalian PKC proteins are known with a wide range of tissue distribution, subcellular localization, and function. The PKC family belongs to the AGC-type kinase (protein kinase A/protein kinase G/protein kinase C) superfamily. 

 

PKC kinases share certain structural features. PKC kinases have highly conserved catalytic domains consisting of motifs required for ATP-substrate binding and catalysis. The PKC kinases also have a regulatory domain that maintains the enzyme in an inactive conformation. The regulatory and catalytic domains are attached to each other by a hinge region. PKC kinases can be split into three groups: conventional (α, βI, βII, and γ), novel (δ, ϵ, η, θ), and atypical (ζ and ι/λ). These classifications are based on the structural motifs in the regulatory domain that account for cofactor dependence and interactions during induction of catalytic activity. PKCδ is a novel PKC that requires diacylglycerol (DAG) to become activated; PKCδ can also bind phorbol ester, bombesin, serum, platelet-derived growth factor, and epidermal growth factor (1;2).

 

Similar to other members of the PKC family (see the record for celina [Prkcq] and Untied [Prkcb]), PKCδ has a C2-like domain, two tandem cysteine-rich zinc finger C1 domains (C1a and C1b), a kinase (C3/C4) domain, and a AGC-kinase C-terminal domain (Figure 4).

 

The C2-like domain is approximately 130 amino acids long and binds to anionic phospholipids present in membranes in a Ca2+-dependent manner (3)

 

The C1 domains have a HX12CX2CXnCX2CX4HX2CX7C motif, where H is histidine, C is cysteine, X is any other amino acid, and n is 13 or 14. The C1 domains facilitate DAG and phorbol ester binding. In the C1b domain, the phorbol ester binds to a pocket between two β-sheets [PDB:3UGD; (4)]. The C1 domains also function as hydrophobic switches to anchor PKCs to the membrane (5). The C1 domain has two zinc-coordinating sites required for C1 domain folding. 

 

The kinase domain has a glycine-rich ATP-binding loop with a GXGXXG sequence (amino acids 387-392) that is found in protein kinases and nucleotide binding proteins. An invariant Lys (Lys409) promotes phosphoryl-transfer. The C-terminal lobe of the kinase domain is predominantly α-helical and contains the activation loop. Met458 connects the two lobes of the kinase domain and controls access to a cavity in the ATP binding pocket. Within the C-terminal catalytic domain is an ATP-binding site (C3) and a substrate-binding domain (C4). 

 

PKCδ is sequentially phosphorylated at Thr505, Ser643, and Ser662 (6-8). First, Thr505 within the activation loop is phosphorylated by PDK-1 (or a related enzyme). Second, Ser643 and Ser662 within the AGC-kinase C-terminal domain are phosphorylated; Ser642 is autophosphorylated, and Ser662 is phosphorylated by an unidentified kinase (9;10). Phosphorylation of the AGC-kinase C-terminal domain regulates the function of PKCδ by controlling both intra- and inter-molecular interactions [SMART; (11;12)]. Ser643 is within a turn motif, and Ser662 is in a hydrophobic pocket. Phosphorylated PKCδ is in a mature and stable conformation that can be activated by DAG or phorbol ester. PKCδ is also phosphorylated at several tyrosine residues (Tyr52, Tyr155, Tyr187, Tyr311, Tyr322, and Tyr565) after cell stimulation (8;13-17). Tyrosine phosphorylation may regulate the catalytic activity of PKCδ. Phosphorylation of Tyr311 promotes PKCδ degradation after ubiquitination (17;18).

 

A catalytically active fragment of PKCδ is generated in cells induced to undergo apoptosis by ionizing radiation, DNA-damaging drugs, and anti-Fas (see the record for cherry) antibody (19-21)­. Caspase-3, or a related enzyme, cleaves PKCδ between Asp327 and Asn328. The catalytically active fragment of PKCδ inhibits the function of DNA-dependent protein kinase (DNA-PKCS; see the record for clover) and promotes DNA damage-induced apoptosis (22).

 

The rigged mutation results in a methionine to threonine substitution at position 1 (M1T) in the PKCδ protein. The next methionine is at residue 32. Both residues are within the C2 domain.

Expression/Localization

In their inactive conformations, most PKC proteins are localized in the cytosol and often associate with cytoskeletal proteins (23). Upon activation, PKCs translocate to the plasma membrane via a mechanism that involves phospholipase C (PLC)-derived DAG accumulation (7;24).

Background
Figure 5. BCR Signaling. Pre-BCR engagement results in the activation of SYK (spleen tyrosine kinase), which together with Src-family  kinases (LYN, FYN, BLK), phosphorylates many substrates and triggering signaling pathways that are involved in both proliferation and differentiation of pre-B cells. These include activation of phosphoinositide 3 kinase (PI3K) by phosphorylating the coreceptor CD19 and/or the adaptor protein B-cell PI3K adaptor (BCAP). PI3K activation results in the generation of phosphatidylinosital-3,4,5-triphosphate (PIP3), which recruits plekstrin-homology domain signaling molecules to the membrane including the serine threonine protein kinase B (PKB) and its activating kinase 3- phosphoinositide-dependent protein kinase 1 (PDK1). Signaling through this pathway pathway suppresses recombination-activating gene 1 (RAG1) and RAG2 expression, blocks Igk (the k chain of the immunoglobin light chain) gene recombination and induces cell proliferation. SYK also phosphorylates SH2-domain containing leukocyte protein of SLP65, resulting in the organization of a molecular complex that includes Bruton’s tyrosine kinase (BTK) and phospholipase Cg2 (PLCg2). This complex controls downregulation of l-5, a component of the surrogate light chain (SLC), and upregulates the expression of RAG proteins and the interferon-regulatory factor 4 (IRF4). IRF4 positively regulates Igk recombination. SLP65 also modulates PKB activity either directly or by altering the activity of SYK, CD19, or PI3K. Alternatively, SLP65 may regulate PKB activity by activating lipid phosphatases such as SH2-domain containing inositol-5 phosphate (SHIP) and altering PIP3 levels. Multiple downstream signaling pathways are activated by BCR stimulation and lead to a multitude of cellular responses. Following aggregation and localization of BCR molecules, the tails of Igα and Igβ become phosphorylated by Src family kinases (typically Lyn) and by SYK. These phosphotyrosines then act as docking sites for the SH2 domains of SYK, resulting in SYK phosphorylation and activation. SYK phosphorylates a number of downstream targets including BLNK, PLC-g2 and protein kinase C β (PKCβ). BCR stimulation also activates phosphatidylinositol 3 kinase (PI3K) resulting in the generation of 3′-phosphorylated phosphoinositides. One of these lipids, phosphatidylinositol-3,4,5-triphosphate (PIP3), binds selectively to the pleckstrin homology (PH) domain of Btk, facilitating membrane recruitment of the kinase. Phosphorylated BLNK also provides docking sites for Btk, as well as PLC-g2, which results in the additional phosphorylation and activation of PLC-γ2 by Btk leading to the hydrolysis of phosphatidylinositol-3,4-diphosphate (PIP2) to inositol-1,4,5-trisphosphate (IP3) and diacylglycerol (DAG). Soluble IP3 and membrane-bound DAG initiate downstream signal transduction pathways involving calcium (Ca2+) mobilization and PKC, respectively. The recruitment of Vav, Nck and Ras by BLNK to the BCR activates MAP kinase cascades such as JNK, p38 and extracellular signal regulated kinase (ERK). Together, these signals allow the activation of multiple transcription factors, including nuclear factor of activated T cells (NF-AT), nuclear factor (NF)-κB and AP-1, which subsequently regulate biological responses including cell proliferation, differentiation and apoptosis, as well as the secretion of antigen-specific antibodies. Other molecules that play important roles in BCR signaling include Bcl10, mucosa-associated lymphoid tissue translocation gene 1 (MALT1), and caspase recruitment domain family, member 11 (CARMA1 or CARD11), which are involved in NF-κB activation along with PKCβ. This image is interactive. Click on the image to view mutations found within the pathway (red) and the genes affected by these mutations (black). Click on the mutations for more specific information. This image is interactive. Click to view additional mutations. Click on each mutation for more information.

Many functions have been ascribed to PKC kinases due to their widespread expression and variety of substrates. PKCs are involved in receptor desensitization, modulating membrane structure events, regulating transcription, mediating immune responses, regulating cell growth, and in learning and memory. A high degree of redundancy or cross talk among different PKC proteins can also occur, making the identification of isoform-specific roles difficult. The development of knockout mice for various PKC genes has enabled identification of the in vivo pathways and processes these proteins are involved in as opposed to their broad in vitro substrate specificity. 

 

Members of the PKC family play important roles in signaling for various growth factors, cytokines, and hormones including those involved in the regulation of cell growth, apoptosis, and differentiation of hematopoietic cells. These include platelet-derived growth factor (PDGF), insulin-like growth factor 1 (IGF-1), erythropoietin (EPO), thrombopoietin (TPO), stem cell factor (SCF), tumor necrosis factor (TNF), granulocyte-macrophage colony-stimulating factor (GM-CSF), G-CSF, M-CSF, type I and II interferons (IFNs) and various interleukins (ILs).

 

PKCδ functions in B-cell receptor-mediated signaling. Engagement of the BCR initiates receptor aggregation, resulting in activation of receptor-associated Src-family kinases, as well as Syk and Bruton’s tyrosine kinase (Btk)/Tec family kinases. These initial events facilitate the recruitment and activation of additional kinases and adaptor proteins within membrane raft microdomains leading to the formation of a mature BCR ‘signalosome’ and promoting the full activation of several downstream signaling cascades including the generation of the second messengers DAG and IP3. Soluble IP3 and membrane-bound DAG initiate downstream signal transduction pathways involving Ca2+ and PKC isoforms, respectively. These, together with additional signal transduction cascades, lead to the activation of multiple transcription factors, including nuclear factor of activated T cells (NF-AT), NF-κB and activator protein 1, which subsequently regulate biological responses including cell proliferation, differentiation and apoptosis, as well as the secretion of antigen-specific antibodies.

 

Mutations in PRKCD are linked to autoimmune lymphoproliferative syndrome, type III (ALPS3; OMIM: #615559; (25-27)). ALPS3 patients exhibit variable phenotypes, but most have lymphadenopathy associated with variable autoimmune manifestations. Some patients may have recurrent infections. Lymphocyte accumulation results from a combination of impaired apoptosis and excessive proliferation. PKCs have long been known to play important roles in the development of cancer. Phorbol esters are known to promote tumor formation and partially do so by activating PKC enzymes, thus promoting cellular survival and proliferation [reviewed by (28)]. PKCs were originally thought to be pro-mitogenic kinases, but this activity can be PKC-isozyme-dependent and cell-type dependent, as many PKCs can also inhibit cell cycle progression and promote apoptosis. Altered PKC levels are found in many types of human cancers.

 

Prkcd-deficient (Prkcd-/-) mice are viable, but often develop autoimmune disease as well as enlarged lymph nodes and spleens with multiple germinal centers (29). Prkcd-/- mice have increased numbers of IgM+ B cells in the spleen and lymph nodes, but normal numbers of splenic and peritoneal CD5+ B cells (29;30). The number of neutrophils in the cerebral cortex and striatum of the Prkcd-/- mice was reduced compared to wild-type mice (31). The levels of IgG1, IgM, and IgA were elevated in the serum from the mice (29;30;32). Some mice exhibited reduced glucose-stimulated insulin secretion compared to wild-type mice (33). Prkcd-/- mice exhibited normal B-cell receptor-mediated activation in response to stimulation, but the induction of tolerance was defective (30). Prkcd-/- mice exhibited less ossification and delayed chondrocyte maturation in long bones compared to wild-type controls (34).

Putative Mechanism
Figure 6. PKCδ functions in oxidant-induced disruption of the microtubule cytoskeleton and regulation of permeability barrier of colonic epithelia.

PKCδ mediates intestinal inflammatory responses to specific challenges. PKCδ expression levels in the intestine increase in response to endotoxin or 2,4,6-trinitrobenzenesulfonic acid (TNBS) challenge, and PKCδ is activated in intestinal epithelial cells in response to TNF-α treatment. PKCδ functions in oxidant-induced disruption of the microtubule cytoskeleton and permeability barrier of colonic epithelia in vitro (35). PKCδ activation is also associated with increased injury susceptibility in neonatal rat colon (36). The colitis susceptibility phenotype observed in the Rigged mice is consistent with loss of PKCδ function.

Primers PCR Primer
Rigged_pcr_F: AACTGGGTGCTTCTGTCTTC
Rigged_pcr_R: CCTGGCATGTACAGCTGTTC

Sequencing Primer
Rigged_seq_F: ATCCTCAGCTGGGTCGTTCAG
Rigged_seq_R: CTGTAATTGCCTAAGGATCACAGGC
Genotyping

PCR program

1) 94°C 2:00
2) 94°C 0:30
3) 55°C 0:30
4) 72°C 1:00
5) repeat steps (2-4) 40x
6) 72°C 10:00
7) 4°C hold


The following sequence of 419 nucleotides is amplified (chromosome 14, - strand):


1   cctggcatgt acagctgttc tgtaattgcc taaggatcac aggctcaaat gcttccaggg
61  ccccattcag gaatggggac agtggcctgg cttggtagac tgacagaaaa gcagctacca
121 tgttgctcta ttgcctcggc ttcatgctca ctgtacaatc tcactccagg ctccatcatg
181 gcacccttcc tgcgcatctc cttcaattcc tatgagctgg gctccctgca agttgaggac
241 gaagcaagcc agcctttctg tgctgtgaag atgaaggagg cactcagcac aggtagggtt
301 ggaagggtcc ctagaggggc atggggctca gggtgaaggg aggcttccct tcttctctag
361 atcctcttgc cttcctgaac gacccagctg aggatgcagg aagacagaag cacccagtt


Primer binding sites are underlined and the sequencing primers are highlighted; the mutated nucleotide is shown in red.

References
Science Writers Anne Murray
Illustrators Diantha La Vine
AuthorsEmre Turer, William McAlpine, Kuan-Wen Wang, Tianshi Lu, and Bruce Beutler