Phenotypic Mutation 'Pinnacles'

• Allele: Pinnacles
• Mutation Type: missense
• Chromosome: 17
• Coordinate: 86,476,851 bp (GRCm38)
• Base Change: C ⇒ T (forward strand)
• Gene: Prkce
• Gene Name: protein kinase C, epsilon
• Synonym(s): Pkce, PKCepsilon, PKC[e], 5830406C15Rik
• Chromosomal Location: 86,167,785-86,657,919 bp (+)
• MGI Phenotype: FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Protein kinase C (PKC) is a family of serine- and threonine-specific protein kinases that can be activated by calcium and the second messenger diacylglycerol. PKC family members phosphorylate a wide variety of protein targets and are known to be involved in diverse cellular signaling pathways. PKC family members also serve as major receptors for phorbol esters, a class of tumor promoters. Each member of the PKC family has a specific expression profile and is believed to play a distinct role in cells. The protein encoded by this gene is one of the PKC family members. This kinase has been shown to be involved in many different cellular functions, such as neuron channel activation, apoptosis, cardioprotection from ischemia, heat shock response, as well as insulin exocytosis. Knockout studies in mice suggest that this kinase is important for lipopolysaccharide (LPS)-mediated signaling in activated macrophages and may also play a role in controlling anxiety-like behavior. [provided by RefSeq, Jul 2008] ; PHENOTYPE: Homozygotes for a targeted null mutation exhibit reduced ethanol self-administration and are more sensitive to the acute behavioral effects of ethanol and other drugs that activate GABA(A) receptors. Mutants show reduced anxiety and stress hormones. [provided by MGI curators]
• Mapped: Yes
• Amino Acid Change: Threonine changed to Isoleucine
• Institutional Source: Beutler Lab
• Gene Model: predicted gene model for protein(s): [ENSMUSP00000094873] [ENSMUSP00000094874]
• AlphaFold: P16054
• SMART Domains: Protein: ENSMUSP00000094873; Gene: ENSMUSG00000045038; AA Change: T218I

Domain	Start	End	E-Value	Type
C2	7	114	5.78e-12	SMART
C1	170	220	4.48e-13	SMART
C1	243	292	8.29e-17	SMART
S_TKc	408	668	1.3e-104	SMART
S_TK_X	669	732	2.56e-25	SMART

• Predicted Effect: probably damaging ; PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
  (Using ENSMUST00000097274)
• SMART Domains: Protein: ENSMUSP00000094874; Gene: ENSMUSG00000045038; AA Change: T218I

Domain	Start	End	E-Value	Type
C2	7	114	5.78e-12	SMART
C1	170	220	4.48e-13	SMART
C1	243	292	8.29e-17	SMART
S_TKc	408	668	1.3e-104	SMART
S_TK_X	669	732	2.56e-25	SMART

• Predicted Effect: probably damaging ; PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
  (Using ENSMUST00000097275)
• Meta Mutation Damage Score: 0.4592
• Is this an essential gene?: Non Essential (E-score: 0.000)
• Phenotypic Category: Autosomal Recessive
• Mode of Inheritance: Autosomal Recessive
• Last Updated: 2019-10-23 1:57 PM by Anne Murray
• Record Created: 2016-11-09 3:03 PM
• Record Posted: 2018-12-19
• Science Writers: Anne Murray
• Illustrators: Diantha La Vine
• Authors: Ming Zeng, Xue Zhong, and Bruce Beutler

Accession Number

NCBI RefSeq: NM_011104; MGI:97599

Alleles Listed at MGI

All Mutations and Alleles(10) : Gene trapped(2) Targeted(6) Transgenic(2)

Phenotypic Description

Figure 1. Pinnacles mice exhibit decreased frequencies of peripheral CD11b+ dendritic cells in CD11c+ cells. Flow cytometric analysis of peripheral blood was utilized to determine DC cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The pinnacles phenotype was identified among N-ethyl-N-nitrosourea (ENU)-mutagenized G3 mice of the pedigree R4364, some of which showed reduced frequencies of CD11b+ dendritic cells in CD11c+ cells in the peripheral blood (Figure 1).

Nature of Mutation

Figure 2. Linkage mapping of decreased frequencies of peripheral CD11b+ dendritic cells in CD11c+ cells using a recessive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 37 mutations (X-axis) identified in the G1 male of pedigree R4364. Normalized phenotype data are shown for single locus linkage analysis without consideration of G2 dam identity. Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.Whole exome HiSeq sequencing of the G1 grandsire identified 37 mutations. The dendritic cell phenotype was linked by continuous variable mapping to a mutation in Prkce: a C to T transition at base pair 86,476,851 (v38) on chromosome 17, or base pair 309,298 in the GenBank genomic region NC_000083 encoding Prkce . Linkage was found with a recessive model of inheritance, wherein four variant homozygotes departed phenotypically from 15 homozygous reference mice and 22 heterozygous mice with a P value of 9.067 x 10 -5 ( Figure 2 ).

Whole exome HiSeq sequencing of the G1 grandsire identified 37 mutations. The dendritic cell phenotype was linked by continuous variable mapping to a mutation in Prkce: a C to T transition at base pair 86,476,851 (v38) on chromosome 17, or base pair 309,298 in the GenBank genomic region NC_000083 encoding Prkce. Linkage was found with a recessive model of inheritance, wherein four variant homozygotes departed phenotypically from 15 homozygous reference mice and 22 heterozygous mice with a P value of 9.067 x 10^-5 (Figure 2).

The mutation corresponds to residue 1,461 in the mRNA sequence NM_011104 within exon 5 of 15 total exons.

1445 CATGAGCTCATTATTACAAAGTGCGCTGGGCTG 213  -H--E--L--I--I--T--K--C--A--G--L-

The mutated nucleotide is indicated in red. The mutation results in a threonine (T) to isoleucine (I) substitution at position 218 (T218I) in the PKCε protein (Figure 3), and is strongly predicted by PolyPhen-2 to be damaging (score = 0.997).

Protein Prediction

Figure 3. Domain organization of PKCε. The pinnacles mutation results in a threonine to isoleucine substitution at position 218 (T218I). Abbreviations: DAG, diacylglycerol; ABM, actin-binding motif; AGC-kinase, protein kinase A /protein kinase G /protein kinase C -kinase

Prkce encodes protein kinase C epsilon (PKCε), a member of the protein kinase C (PKC) family of serine-threonine kinases. At least 11 mammalian PKC proteins are known with a wide range of tissue distribution, subcellular localization, and function. The PKC family belongs to the AGC-type kinase (protein kinase A/protein kinase G/protein kinase C) superfamily. PKC kinases can be split into three groups: conventional (α, βI [see the record for Untied]], βII, and γ), novel (δ [see the record for rigged], ϵ, η, θ [see the record for celina]), and atypical (ζ and ι/λ). These classifications are based on the structural motifs in the regulatory domain that account for cofactor dependence and interactions during induction of catalytic activity. The classical PKCs are dependent on calcium (Ca²⁺) and diacylglycerol (DAG), novel PKCs are regulated by diacylglycerol but are Ca²⁺ independent, and atypical PKCs are independent from both Ca²⁺ and diacylglycerol but are activated by other lipids.

PKC kinases share certain structural features. PKC kinases have highly conserved C-terminal catalytic domains consisting of motifs required for ATP-substrate binding and catalysis. The PKC kinases also have an N-terminal regulatory domain that maintains the enzyme in an inactive conformation. The regulatory and catalytic domains are attached to each other by a hinge region. Similar to other members of the PKC family, PKCε has a C2-like domain, two tandem cysteine-rich zinc finger C1/DAG domains (C1a and C1b), a kinase (C3/C4) domain, and a AGC-kinase C-terminal domain. PKCε has an actin-binding motif between the first and second cysteine-rich regions of the C1 domain (Figure 3) (1).

The C2-like domain is approximately 130 amino acids long and binds to anionic phospholipids present in membranes in a Ca²⁺-dependent manner (2). The C1 domains have a HX₁₂CX₂CX_nCX₂CX₄HX₂CX₇C motif, where H is histidine, C is cysteine, X is any other amino acid, and n is 13 or 14 (3). The C1 domains facilitate DAG and phorbol ester binding. In the C1b domain, the phorbol ester binds to a pocket between two β-sheets (4). The C1 domains also function as hydrophobic switches to anchor PKCs to the membrane (5). The C1 domain has two zinc-coordinating sites required for C1 domain folding. The kinase domain has a glycine-rich ATP-binding loop with a GXGXXG sequence that is found in protein kinases and nucleotide binding proteins. An invariant Lys (Lys409) promotes phosphoryl-transfer. The hinge region of PKCε has 14-3-3 consensus binding sites (6;7). The C-terminal lobe of the kinase domain is predominantly α-helical and contains the activation loop. Met458 connects the two lobes of the kinase domain and controls access to a cavity in the ATP binding pocket. Within the C-terminal catalytic domain is an ATP-binding site (C3) and a substrate-binding domain (C4). PKCε associates with actin in response to stimuli such as AA and DAG (1;8). Association with actin both anchors PKCε and activates the kinase by maintaining it in a catalytically active conformation (1). The PKCε-actin interaction also promotes the formation of F-actin by inhibiting the depolymerization of F-actin, increasing the rate of actin filament elongation, and overturning the inhibition of actin nucleation by thymosin β4 (9). The PKCε-F-actin complex is essential for glutamate exocytosis from dentate gyrus granule cells of the hippocampus (1).

Thr566 (in the activation loop), Thr710 (in a Thr-Pro turn motif), and Ser729 (in a Phe-Ser-Tyr motif) must be phosphorylated for full activation of PKCε (10). Non- or hypo-phosphorylated (immature) PKCε associates with anchoring proteins via its catalytic domain. Phospholipid-dependent kinase (PDK1) phosphorylates Thr566, while Thr710 and Ser729 are phosphorylated by conventional PKCs (11). PKCε is also phosphorylated by GSK3-β at Ser-346 and Ser-368 is autophosphorylated (12).

The pinnacles mutation results in a threonine to isoleucine substitution at position 218 (T218I); Thr218 is within the DAG1/C1a domain.

Expression/Localization

PKCε is expressed in several tissues, with highest expression in neuronal, hormonal, and immune cells (13;14). PKCε is overexpressed in tumor-derived cell lines and tumor specimens from various organ sites (15).

In their inactive conformations, most PKC proteins are localized in the cytosol and often associate with cytoskeletal proteins (16). Upon activation, PKCs translocate to the plasma membrane via a mechanism that involves phospholipase C (PLC)-derived DAG accumulation (17;18). Association with receptors for activated C-kinase-2 (RACK2) anchors PKCε in close proximity to its substrates and localizes active PKCε to the Golgi apparatus and myofilaments (19;20).

Background

Figure 4. Overview of PKCε functions. PKCε is activated by DAG, PIP 3 , and fatty acids. PKCε promotes activation of several signaling pathways, including RhoA/RhoC, Akt, JNK, NF-κB, MAPK/ERK, and integrin signaling to mediate several functions, including neurite outgrowth, apoptosis, adhesion, and motility. Several PKCε targets shown in the figure are detailed in Table 1 . Figure based on Akita .

Many functions have been ascribed to PKC kinases due to their widespread expression and variety of substrates. PKCs are involved in receptor desensitization, modulating membrane structure events, regulating transcription, mediating immune responses, regulating cell growth, and in learning and memory. A high degree of redundancy or cross talk among different PKC proteins can also occur, making the identification of isoform-specific roles difficult. The development of knockout mice for various PKC genes has enabled identification of the in vivo pathways and processes these proteins are involved in as opposed to their broad in vitro substrate specificity. Members of the PKC family play important roles in signaling for various growth factors, cytokines, and hormones including those involved in the regulation of cell growth, apoptosis, and differentiation of hematopoietic cells. These include platelet-derived growth factor (PDGF), insulin-like growth factor 1 (IGF-1), erythropoietin (EPO), thrombopoietin (TPO), stem cell factor (SCF), tumor necrosis factor (TNF), granulocyte-macrophage colony-stimulating factor (GM-CSF), G-CSF, M-CSF, type I and II interferons (IFNs) and various interleukins (ILs).

PKCε is activated by several factors, including second messengers, DAG, phosphatidylinositol 3,4,5-triphosphate (PIP₃), and fatty acids produced by platelet-derived growth factor (PDGF) and bradykinin (Figure 4) (21;22). PKCε has several functions, including promoting neuron growth during neuronal differentiation, ion channel regulation (23;24), regulation of nociceptor function (25;26), muscle contraction, metabolism, cancer cell invasion, regulation of apoptosis, postnatal myocardial development, protection against ischemic damage (27), activation of the immune system (28;29), and phagocytosis by macrophages (29;30) [reviewed in (31)].

PKCε has several known downstream targets (Table 1) and binding partners. One such binding partner is 14-3-3, which associates with PKCε during mitosis. The 14-3-3/PKCε complex is required for cytokinesis during abscission; the role of PKCε in cytokinesis is unknown, but it may involve RhoA (6). PDZ and LIM domain protein 5 (PDLIM5) is another PKCε binding protein, which binds N-type voltage- gated calcium channels (32). PKCε also binds peripherin, inducing its aggregation and the subsequent apoptosis of neuroblastoma cells (33).

Table 1. Select PKCε substrates

PKCε target	Description of target	Downstream effect	References
STAT3	Transcription factor	Increases STAT3 nuclear translocation and transcriptional activation; promotes icrotubule polymerization during cell motility	(34;35)
RhoA/RhoC	Rho family GTPases	Depolymerization of filamentous actin during cell motility	(36)
Akt	Serine/threonine kinase important for cell survival and proliferation, angiogenesis, metabolism, and protein translation	Akt activation; assembly of actomyosin filaments for contraction during cell motility	(37;38)
Calsequestrin	Calcium-binding protein	Reduces binding of calsequestrin to PKCε	(39)
VR1	Capsaicin receptor	Regulates nociceptor sensitization by ATP	(40)
α4 nicotinic  acetylcholine receptor (nAChR) subunit	The nAChR mediate fast cholinergic neurotransmission	Regulates recovery from receptor desensitization	(41)
MARCKS (myristoylated alanine rich protein kinase C substrate)	Regulatory component of the cytoskeleton	Putative regulates thyrotropin-releasing hormone-stimulated prolactin secretion	(42;43)
TRAM (see the record for Branch)	Adaptor protein in TLR4 (see the record for lps3)-associated signaling	Required for TLR4-associated signaling; PKCε-associated phosphorylation causes reduced TRAM at the cell membrane	(44)
Histone H1	Chromatin component	Putatively anchors activated PKCε in the nucleus where it can regulate gene expression	(45)
Protein kinase D1 (PKD1; see the record for Purnama for information about PKD2)	Serine/threonine kinase	Releases autoinhibition by the pleckstrin homology domain; may modulate PKD-dependent regulation of L-type (and N-type) calcium channels	(46)
eNOS (see the record for paul)	Nitric oxide synthase enzyme	Increased eNOS activity	(47)
γ2 subunit of GABAA receptors	Ion channel that mediates most inhibitory neurotransmission in the nervous system	Reduces the response of GABAA receptors to ethanol and benzodiazepines; development of this acute tolerance to ethanol	(48;49)
TRPV1 (see the record gingame for information about TRPV5)	Cation channel activated by capsaicin, heat, protons, leukotrienes and anandamide	Promotes bradykinin-mediated enhancement of TRPV1 function	(50)
NaV1.8	Sodium channel	Increases channel function	(51)
Keratin 8	Intermediate filament protein	Unknown; putatively regulates cell-cell contacts in epithelial cells	(52)
IQGAP1 (IQ motif-containing GTPase activating protein 1)	Calcium-sensitive GTPase scaffolding protein in the cytoskeleton	Unknown; putatively modulates IQGAP1 binding to Cdc42; IQGAP1 phosphorylation promotes neurite outgrowth	(53;54)
CMyBPC (cardiac myosin binding protein)	Myosin binding protein in the cytoskeleton that functions in cardiac contractility	Contributes to aberrant cardiac function in dilated cardiomyopathy	(55;56)
Fibroblast growth factor (FGFR) 1 and 2	Receptor that functions in proliferation, survival, and differentiation	Required for the sustained activation of Ras and ERK, which is essential for neuronal differentiation and cell survival	(57)

Figure 5. Toll-like receptor 4 (TLR4) signaling pathways. Once TLR4 homodimers recognize their ligands, they recruit combinations of adaptor proteins (MyD88, TICAM, TRAM, TIRAP) via homophilic TIR domain interactions. TLR4 signals through the MyD88-dependent pathway from the cell membrane to produce proinflammatory cytokines and is subsequently internalized into late endosomes to signal through the TICAM-dependent pathway to produce IFN. When bound to vesicular stomatitis virus glycoprotein G (VSV-G), TLR4 can signal through TRAM to induce IRF7 activation, a process that is partially dependent on TICAM. PKCε is required for TRAM phosphorylation.

PKCε has a known function in Toll-like receptor 4 (TLR4)-associated signaling (Figure 5; see the record for lps3). TLR4 senses lipopolysaccharide (LPS). Stimulation of TLR4 by LPS activates two branches of signaling, one defined by early NF-κB (see the record for finlay) activation (MyD88-dependent pathway, mediated by MyD88), and another distinguished by late NF-κB activation as well as interferon responsive factor (IRF)-3 activation leading to type I IFN production and costimulatory molecule upregulation (MyD88-independent pathway, mediated by Trif and TRAM). MyD88-dependent TLR4 signaling culminates in the activation of NF-κB-dependent transcription. Briefly, IRAK-1 and TRAF6 dissociate from the receptor complex, and freed TRAF6 interacts with TAK1, activating it to phosphorylate the IκB kinase (IKK) complex. The IKK complex phosphorylates IκB, targeting it for degradation and relieving its inhibition of NF-κB which translocates to the nucleus and activates expression of target genes including interleukin (IL)-6, IL-1, TNF, IL-12p40 and type I interferon, cytokines required for the inflammatory response. The MyD88-independent pathway relies on the adapter Trif, and its hallmark is the production of type I IFN. Trif signals to TRAF3 and TBK1, both of which are required for IRF-3 activation and subsequent IFN induction. PKCε is required for LPS-induced IKK and NF-kB activation and TNFa and IL-12 production; however, how/where PKCε fits in the TLR4 signaling pathway is unknown, but it is required for TRAM phosphorylation (28;58-61).

PKCε is overexpressed in several cancer types, including bladder (62), brain (63), breast (64), head and neck (36;65), lung (66), kidney (67), and prostate cancers (34;68). The mutations that result in PKCε overexpression have not been documented. PKCε overexpression is a prognostic biomarker of poorer overall and disease-free survival (64;65). PKCε promotes aggressive, invasive, and motile phenotypes in breast and prostate cancers (64). In a non-small cell lung carcinoma cell line, PKCε putatively promotes cell cycle dysregulation (66).

Chronic PKCε activation is linked to the development of diabetes (69). Increased PKCε activation results in the downregulation of the insulin receptor and lipid accumulation, and subsequent impaired glycogen synthesis and insulin resistance. In the hyperglycemic state, increased PKCε activity was associated with development of cardiomyopathy (70), nephropathy (71), and vascular disease. PKCε levels are reduced in the brains of Alzheimer’s disease patients (72). PKCε suppresses the production of Abeta, a factor associated with Alzheimer’s disease pathogenesis, by promoting alpha-secretase-mediated processing of amyloid precursor protein (APP) (73).

Prkce-deficient (Prkce^-/-) mice exhibited reduced T cell proliferation in response to anti-CD3E antibody, reduced serum IL-1b and TNFa levels, increased susceptibility to bacterial infection, reduced female fertility, reduced body sizes, and reduced total body fat amounts (28). Macrophages from the Prkce^-/- mice showed reduced apoptosis and nitric oxide production in response to LPS, LPS plus interferon-gamma (IFN-g), or LPS, IFN-g, and 15dPGJ2 compared to wild-type macrophages (28). A second Prkce^-/- mouse model showed normal development and function of CD3+ T cells (74). T cells from the mice showed comparable proliferative responses and IL-2 secretion in response to anti-CD3 antibodies or mitogenic stimuli (74). NF-kB transactivation and CD25, CD44, and CD69 induction after CD3/CD28 engagement were also normal. Keratinocytes from a third Prkce^-/- mouse model showed reduced TNFa production after stimulation with ethanol or 12-O-tetradecanoylphorbol-13-acetate (TPA) (75). Prkce^-/- mice showed reduced anxiety-like behavior with reduced levels of the stress hormones corticosterone and adrenocorticotrophic hormone as well as increased sensitivity to neurosteroid modulators of GABA_A receptors (76). Prkce^-/- mice fed a high-fat diet showed augmented insulin secretion and were protected from glucose intolerance (77). Epidermis-specific overexpression of PKCε causes mice to develop metastatic carcinomas (78).

Putative Mechanism

In addition to its roll in TLR4 signaling, T cell development, and phagocytosis by macrophages, PKCε is putatively involved in B-cell receptor-associated signaling (79). The role of PKCε in BCR signaling is unknown, but PKCε is highly expressed in B cells, and BCR activation results in PKCε translocation from the cytosol to the cell membrane and PI3K phosphorylation of PKCε (79). PKCε also regulates LPS-induced IL-12 synthesis in monocyte-derived dendritic cells (58); however, other roles in dendritic cells have not been documented.

Primers

PCR Primer
Pinnacles_pcr_F: GCATCCATTTAGGTTCGGACATTG
Pinnacles_pcr_R: AATCGATGATGCTTAAGCCAGC

Sequencing Primer
Pinnacles_seq_F: TTTAGGTTCGGACATTGACAGAAAG
Pinnacles_seq_R: GAGCCAACTCCCTTCATTTTTG

Genotyping

PCR program

1) 94°C 2:00
2) 94°C 0:30
3) 55°C 0:30
4) 72°C 1:00
5) repeat steps (2-4) 40x
6) 72°C 10:00
7) 4°C hold

The following sequence of 400 nucleotides is amplified (chromosome 17, + strand):

1   gcatccattt aggttcggac attgacagaa agggcacagc tctggtcgtg tctccaccga
61  gacctgatta gatctcgggg tgggatctgg ctggccctgg tcatcattca agcttcttct
121 gtttttgtcc ttgacagttt gcacttgcgt tgtccacaag cgatgtcatg agctcattat
181 tacaaagtgc gctgggctga agaaacagga aacccctgac gaggtaaata tttacagtga
241 tggaattctg tgccctcttc cttatcagcc tctcccttgt ctgcccctga tgtaaccccc
301 acgggagcct tatctctctg agctcctgaa gttgtcttca ttgtgttgag caaaaatgaa
361 gggagttggc tcctgcctgc tggcttaagc atcatcgatt 

Primer binding sites are underlined and the sequencing primers are highlighted; the mutated nucleotide is shown in red.

References

  1. Prekeris, R., Mayhew, M. W., Cooper, J. B., and Terrian, D. M. (1996) Identification and Localization of an Actin-Binding Motif that is Unique to the Epsilon Isoform of Protein Kinase C and Participates in the Regulation of Synaptic Function. J Cell Biol. 132, 77-90.

  2. Kikkawa, U., Matsuzaki, H., and Yamamoto, T. (2002) Protein Kinase C Delta (PKC Delta): Activation Mechanisms and Functions. J Biochem. 132, 831-839.

  3. Steinberg, S. F. (2008) Structural Basis of Protein Kinase C Isoform Function. Physiol Rev. 88, 1341-1378.

  4. Zhang, G., Kazanietz, M. G., Blumberg, P. M., and Hurley, J. H. (1995) Crystal Structure of the cys2 Activator-Binding Domain of Protein Kinase C Delta in Complex with Phorbol Ester. Cell. 81, 917-924.

  5. Xu, R. X., Pawelczyk, T., Xia, T. H., and Brown, S. C. (1997) NMR Structure of a Protein Kinase C-Gamma Phorbol-Binding Domain and Study of Protein-Lipid Micelle Interactions. Biochemistry. 36, 10709-10717.

  6. Saurin, A. T., Durgan, J., Cameron, A. J., Faisal, A., Marber, M. S., and Parker, P. J. (2008) The Regulated Assembly of a PKCepsilon Complex Controls the Completion of Cytokinesis. Nat Cell Biol. 10, 891-901.

  7. Kostelecky, B., Saurin, A. T., Purkiss, A., Parker, P. J., and McDonald, N. Q. (2009) Recognition of an Intra-Chain Tandem 14-3-3 Binding Site within PKCepsilon. EMBO Rep. 10, 983-989.

  8. Zeidman, R., Troller, U., Raghunath, A., Pahlman, S., and Larsson, C. (2002) Protein Kinase Cepsilon Actin-Binding Site is Important for Neurite Outgrowth during Neuronal Differentiation. Mol Biol Cell. 13, 12-24.

  9. Hernandez, R. M., Wescott, G. G., Mayhew, M. W., McJilton, M. A., and Terrian, D. M. (2001) Biochemical and Morphogenic Effects of the Interaction between Protein Kinase C-Epsilon and Actin in Vitro and in Cultured NIH3T3 Cells. J Cell Biochem. 83, 532-546.

  10. Takahashi, M., Mukai, H., Oishi, K., Isagawa, T., and Ono, Y. (2000) Association of Immature Hypophosphorylated Protein Kinase Cepsilon with an Anchoring Protein CG-NAP. J Biol Chem. 275, 34592-34596.

  11. Cenni, V., Doppler, H., Sonnenburg, E. D., Maraldi, N., Newton, A. C., and Toker, A. (2002) Regulation of Novel Protein Kinase C Epsilon by Phosphorylation. Biochem J. 363, 537-545.

  12. Durgan, J., Cameron, A. J., Saurin, A. T., Hanrahan, S., Totty, N., Messing, R. O., and Parker, P. J. (2008) The Identification and Characterization of Novel PKCepsilon Phosphorylation Sites Provide Evidence for Functional Cross-Talk within the PKC Superfamily. Biochem J. 411, 319-331.

  13. Ono, Y., Fujii, T., Ogita, K., Kikkawa, U., Igarashi, K., and Nishizuka, Y. (1988) The Structure, Expression, and Properties of Additional Members of the Protein Kinase C Family. J Biol Chem. 263, 6927-6932.

  14. Ohno, S., Akita, Y., Konno, Y., Imajoh, S., and Suzuki, K. (1988) A Novel Phorbol Ester receptor/protein Kinase, nPKC, Distantly Related to the Protein Kinase C Family. Cell. 53, 731-741.

  15. Gorin, M. A., and Pan, Q. (2009) Protein Kinase C Epsilon: An Oncogene and Emerging Tumor Biomarker. Mol Cancer. 8, 9-4598-8-9.

  16. Keenan, C., and Kelleher, D. (1998) Protein Kinase C and the Cytoskeleton. Cell Signal. 10, 225-232.

  17. Newton, A. C. (2001) Protein Kinase C: Structural and Spatial Regulation by Phosphorylation, Cofactors, and Macromolecular Interactions. Chem Rev. 101, 2353-2364.

  18. Collazos, A., Diouf, B., Guerineau, N. C., Quittau-Prevostel, C., Peter, M., Coudane, F., Hollande, F., and Joubert, D. (2006) A Spatiotemporally Coordinated Cascade of Protein Kinase C Activation Controls Isoform-Selective Translocation. Mol Cell Biol. 26, 2247-2261.

  19. Csukai, M., Chen, C. H., De Matteis, M. A., and Mochly-Rosen, D. (1997) The Coatomer Protein Beta'-COP, a Selective Binding Protein (RACK) for Protein Kinase Cepsilon. J Biol Chem. 272, 29200-29206.

  20. Huang, X., and Walker, J. W. (2004) Myofilament Anchoring of Protein Kinase C-Epsilon in Cardiac Myocytes. J Cell Sci. 117, 1971-1978.

  21. Moriya, S., Kazlauskas, A., Akimoto, K., Hirai, S., Mizuno, K., Takenawa, T., Fukui, Y., Watanabe, Y., Ozaki, S., and Ohno, S. (1996) Platelet-Derived Growth Factor Activates Protein Kinase C Epsilon through Redundant and Independent Signaling Pathways Involving Phospholipase C Gamma Or Phosphatidylinositol 3-Kinase. Proc Natl Acad Sci U S A. 93, 151-155.

  22. Graness, A., Adomeit, A., Heinze, R., Wetzker, R., and Liebmann, C. (1998) A Novel Mitogenic Signaling Pathway of Bradykinin in the Human Colon Carcinoma Cell Line SW-480 Involves Sequential Activation of a Gq/11 Protein, Phosphatidylinositol 3-Kinase Beta, and Protein Kinase Cepsilon. J Biol Chem. 273, 32016-32022.

  23. Fagerstrom, S., Pahlman, S., and Nanberg, E. (1998) Protein Kinase C-Dependent Tyrosine Phosphorylation of p130cas in Differentiating Neuroblastoma Cells. J Biol Chem. 273, 2336-2343.

  24. Hundle, B., McMahon, T., Dadgar, J., and Messing, R. O. (1995) Overexpression of Epsilon-Protein Kinase C Enhances Nerve Growth Factor-Induced Phosphorylation of Mitogen-Activated Protein Kinases and Neurite Outgrowth. J Biol Chem. 270, 30134-30140.

  25. Cesare, P., Dekker, L. V., Sardini, A., Parker, P. J., and McNaughton, P. A. (1999) Specific Involvement of PKC-Epsilon in Sensitization of the Neuronal Response to Painful Heat. Neuron. 23, 617-624.

  26. Khasar, S. G., Lin, Y. H., Martin, A., Dadgar, J., McMahon, T., Wang, D., Hundle, B., Aley, K. O., Isenberg, W., McCarter, G., Green, P. G., Hodge, C. W., Levine, J. D., and Messing, R. O. (1999) A Novel Nociceptor Signaling Pathway Revealed in Protein Kinase C Epsilon Mutant Mice. Neuron. 24, 253-260.

  27. Dorn, G. W.,2nd, and Mochly-Rosen, D. (2002) Intracellular Transport Mechanisms of Signal Transducers. Annu Rev Physiol. 64, 407-429.

  28. Castrillo, A., Pennington, D. J., Otto, F., Parker, P. J., Owen, M. J., and Bosca, L. (2001) Protein Kinase Cepsilon is Required for Macrophage Activation and Defense Against Bacterial Infection. J Exp Med. 194, 1231-1242.

  29. Larsen, E. C., DiGennaro, J. A., Saito, N., Mehta, S., Loegering, D. J., Mazurkiewicz, J. E., and Lennartz, M. R. (2000) Differential Requirement for Classic and Novel PKC Isoforms in Respiratory Burst and Phagocytosis in RAW 264.7 Cells. J Immunol. 165, 2809-2817.

  30. Larsen, E. C., Ueyama, T., Brannock, P. M., Shirai, Y., Saito, N., Larsson, C., Loegering, D., Weber, P. B., and Lennartz, M. R. (2002) A Role for PKC-Epsilon in Fc gammaR-Mediated Phagocytosis by RAW 264.7 Cells. J Cell Biol. 159, 939-944.

  31. Akita, Y. (2002) Protein Kinase C-Epsilon (PKC-Epsilon): Its Unique Structure and Function. J Biochem. 132, 847-852.

  32. Maeno-Hikichi, Y., Chang, S., Matsumura, K., Lai, M., Lin, H., Nakagawa, N., Kuroda, S., and Zhang, J. F. (2003) A PKC Epsilon-ENH-Channel Complex Specifically Modulates N-Type Ca2+ Channels. Nat Neurosci. 6, 468-475.

  33. Sunesson, L., Hellman, U., and Larsson, C. (2008) Protein Kinase Cepsilon Binds Peripherin and Induces its Aggregation, which is Accompanied by Apoptosis of Neuroblastoma Cells. J Biol Chem. 283, 16653-16664.

  34. Aziz, M. H., Manoharan, H. T., Church, D. R., Dreckschmidt, N. E., Zhong, W., Oberley, T. D., Wilding, G., and Verma, A. K. (2007) Protein Kinase Cepsilon Interacts with Signal Transducers and Activators of Transcription 3 (Stat3), Phosphorylates Stat3Ser727, and Regulates its Constitutive Activation in Prostate Cancer. Cancer Res. 67, 8828-8838.

  35. Aziz, M. H., Manoharan, H. T., Sand, J. M., and Verma, A. K. (2007) Protein Kinase Cepsilon Interacts with Stat3 and Regulates its Activation that is Essential for the Development of Skin Cancer. Mol Carcinog. 46, 646-653.

  36. Pan, Q., Bao, L. W., Teknos, T. N., and Merajver, S. D. (2006) Targeted Disruption of Protein Kinase C Epsilon Reduces Cell Invasion and Motility through Inactivation of RhoA and RhoC GTPases in Head and Neck Squamous Cell Carcinoma. Cancer Res. 66, 9379-9384.

  37. Zhang, J., Baines, C. P., Zong, C., Cardwell, E. M., Wang, G., Vondriska, T. M., and Ping, P. (2005) Functional Proteomic Analysis of a Three-Tier PKCepsilon-Akt-eNOS Signaling Module in Cardiac Protection. Am J Physiol Heart Circ Physiol. 288, H954-61.

  38. Matsumoto, M., Ogawa, W., Hino, Y., Furukawa, K., Ono, Y., Takahashi, M., Ohba, M., Kuroki, T., and Kasuga, M. (2001) Inhibition of Insulin-Induced Activation of Akt by a Kinase-Deficient Mutant of the Epsilon Isozyme of Protein Kinase C. J Biol Chem. 276, 14400-14406.

  39. Rodriguez, M. M., Chen, C. H., Smith, B. L., and Mochly-Rosen, D. (1999) Characterization of the Binding and Phosphorylation of Cardiac Calsequestrin by Epsilon Protein Kinase C. FEBS Lett. 454, 240-246.

  40. Numazaki, M., Tominaga, T., Toyooka, H., and Tominaga, M. (2002) Direct Phosphorylation of Capsaicin Receptor VR1 by Protein Kinase Cepsilon and Identification of Two Target Serine Residues. J Biol Chem. 277, 13375-13378.

  41. Lee, A. M., Wu, D. F., Dadgar, J., Wang, D., McMahon, T., and Messing, R. O. (2015) PKCepsilon Phosphorylates alpha4beta2 Nicotinic ACh Receptors and Promotes Recovery from Desensitization. Br J Pharmacol. 172, 4430-4441.

  42. Fujise, A., Mizuno, K., Ueda, Y., Osada, S., Hirai, S., Takayanagi, A., Shimizu, N., Owada, M. K., Nakajima, H., and Ohno, S. (1994) Specificity of the High Affinity Interaction of Protein Kinase C with a Physiological Substrate, Myristoylated Alanine-Rich Protein Kinase C Substrate. J Biol Chem. 269, 31642-31648.

  43. Akita, Y., Kawasaki, H., Ohno, S., Suzuki, K., and Kawashima, S. (2000) Involvement of Protein Kinase C Epsilon in Thyrotropin-Releasing Hormone-Stimulated Phosphorylation of the Myristoylated Alanine-Rich C Kinase Substrate in Rat Pituitary Clonal Cells. Electrophoresis. 21, 452-459.

  44. McGettrick, A. F., Brint, E. K., Palsson-McDermott, E. M., Rowe, D. C., Golenbock, D. T., Gay, N. J., Fitzgerald, K. A., and O'Neill, L. A. (2006) Trif-Related Adapter Molecule is Phosphorylated by PKC{Epsilon} during Toll-Like Receptor 4 Signaling. Proc Natl Acad Sci U S A. 103, 9196-9201.

  45. Zhao, M., Sutherland, C., Wilson, D. P., Deng, J., Macdonald, J. A., and Walsh, M. P. (2004) Identification of the Linker Histone H1 as a Protein Kinase Cepsilon-Binding Protein in Vascular Smooth Muscle. Biochem Cell Biol. 82, 538-546.

  46. Waldron, R. T., and Rozengurt, E. (2003) Protein Kinase C Phosphorylates Protein Kinase D Activation Loop Ser744 and Ser748 and Releases Autoinhibition by the Pleckstrin Homology Domain. J Biol Chem. 278, 154-163.

  47. Zhou, H. Z., Karliner, J. S., and Gray, M. O. (2002) Moderate Alcohol Consumption Induces Sustained Cardiac Protection by Activating PKC-Epsilon and Akt. Am J Physiol Heart Circ Physiol. 283, H165-74.

  48. Wallace, M. J., Newton, P. M., Oyasu, M., McMahon, T., Chou, W. H., Connolly, J., and Messing, R. O. (2007) Acute Functional Tolerance to Ethanol Mediated by Protein Kinase Cepsilon. Neuropsychopharmacology. 32, 127-136.

  49. Qi, Z. H., Song, M., Wallace, M. J., Wang, D., Newton, P. M., McMahon, T., Chou, W. H., Zhang, C., Shokat, K. M., and Messing, R. O. (2007) Protein Kinase C Epsilon Regulates Gamma-Aminobutyrate Type A Receptor Sensitivity to Ethanol and Benzodiazepines through Phosphorylation of gamma2 Subunits. J Biol Chem. 282, 33052-33063.

  50. Sugiura, T., Tominaga, M., Katsuya, H., and Mizumura, K. (2002) Bradykinin Lowers the Threshold Temperature for Heat Activation of Vanilloid Receptor 1. J Neurophysiol. 88, 544-548.

  51. Wu, D. F., Chandra, D., McMahon, T., Wang, D., Dadgar, J., Kharazia, V. N., Liang, Y. J., Waxman, S. G., Dib-Hajj, S. D., and Messing, R. O. (2012) PKCepsilon Phosphorylation of the Sodium Channel NaV1.8 Increases Channel Function and Produces Mechanical Hyperalgesia in Mice. J Clin Invest. 122, 1306-1315.

  52. Akita, Y. (2008) Protein Kinase Cepsilon: Multiple Roles in the Function of, and Signaling Mediated by, the Cytoskeleton. FEBS J. 275, 3995-4004.

  53. Grohmanova, K., Schlaepfer, D., Hess, D., Gutierrez, P., Beck, M., and Kroschewski, R. (2004) Phosphorylation of IQGAP1 Modulates its Binding to Cdc42, Revealing a New Type of Rho-GTPase Regulator. J Biol Chem. 279, 48495-48504.

  54. Li, Z., McNulty, D. E., Marler, K. J., Lim, L., Hall, C., Annan, R. S., and Sacks, D. B. (2005) IQGAP1 Promotes Neurite Outgrowth in a Phosphorylation-Dependent Manner. J Biol Chem. 280, 13871-13878.

  55. Goldspink, P. H., Montgomery, D. E., Walker, L. A., Urboniene, D., McKinney, R. D., Geenen, D. L., Solaro, R. J., and Buttrick, P. M. (2004) Protein Kinase Cepsilon Overexpression Alters Myofilament Properties and Composition during the Progression of Heart Failure. Circ Res. 95, 424-432.

  56. Montgomery, D. E., Rundell, V. L., Goldspink, P. H., Urboniene, D., Geenen, D. L., de Tombe, P. P., and Buttrick, P. M. (2005) Protein Kinase C Epsilon Induces Systolic Cardiac Failure Marked by Exhausted Inotropic Reserve and Intact Frank-Starling Mechanism. Am J Physiol Heart Circ Physiol. 289, H1881-8.

  57. Lonic, A., Powell, J. A., Kong, Y., Thomas, D., Holien, J. K., Truong, N., Parker, M. W., and Guthridge, M. A. (2013) Phosphorylation of Serine 779 in Fibroblast Growth Factor Receptor 1 and 2 by Protein Kinase C(Epsilon) Regulates Ras/mitogen-Activated Protein Kinase Signaling and Neuronal Differentiation. J Biol Chem. 288, 14874-14885.

  58. Aksoy, E., Amraoui, Z., Goriely, S., Goldman, M., and Willems, F. (2002) Critical Role of Protein Kinase C Epsilon for Lipopolysaccharide-Induced IL-12 Synthesis in Monocyte-Derived Dendritic Cells. Eur J Immunol. 32, 3040-3049.

  59. Diaz-Guerra, M. J., Bodelon, O. G., Velasco, M., Whelan, R., Parker, P. J., and Bosca, L. (1996) Up-Regulation of Protein Kinase C-Epsilon Promotes the Expression of Cytokine-Inducible Nitric Oxide Synthase in RAW 264.7 Cells. J Biol Chem. 271, 32028-32033.

  60. Sands, W. A., Bulut, V., Severn, A., Xu, D., and Liew, F. Y. (1994) Inhibition of Nitric Oxide Synthesis by Interleukin-4 may Involve Inhibiting the Activation of Protein Kinase C Epsilon. Eur J Immunol. 24, 2345-2350.

  61. Valledor, A. F., Xaus, J., Comalada, M., Soler, C., and Celada, A. (2000) Protein Kinase C Epsilon is Required for the Induction of Mitogen-Activated Protein Kinase Phosphatase-1 in Lipopolysaccharide-Stimulated Macrophages. J Immunol. 164, 29-37.

  62. Varga, A., Czifra, G., Tallai, B., Nemeth, T., Kovacs, I., Kovacs, L., and Biro, T. (2004) Tumor Grade-Dependent Alterations in the Protein Kinase C Isoform Pattern in Urinary Bladder Carcinomas. Eur Urol. 46, 462-465.

  63. Sharif, T. R., and Sharif, M. (1999) Overexpression of Protein Kinase C Epsilon in Astroglial Brain Tumor Derived Cell Lines and Primary Tumor Samples. Int J Oncol. 15, 237-243.

  64. Pan, Q., Bao, L. W., Kleer, C. G., Sabel, M. S., Griffith, K. A., Teknos, T. N., and Merajver, S. D. (2005) Protein Kinase C Epsilon is a Predictive Biomarker of Aggressive Breast Cancer and a Validated Target for RNA Interference Anticancer Therapy. Cancer Res. 65, 8366-8371.

  65. Martinez-Gimeno, C., Diaz-Meco, M. T., Dominguez, I., and Moscat, J. (1995) Alterations in Levels of Different Protein Kinase C Isotypes and their Influence on Behavior of Squamous Cell Carcinoma of the Oral Cavity: Epsilon PKC, a Novel Prognostic Factor for Relapse and Survival. Head Neck. 17, 516-525.

  66. Bae, K. M., Wang, H., Jiang, G., Chen, M. G., Lu, L., and Xiao, L. (2007) Protein Kinase C Epsilon is Overexpressed in Primary Human Non-Small Cell Lung Cancers and Functionally Required for Proliferation of Non-Small Cell Lung Cancer Cells in a p21/Cip1-Dependent Manner. Cancer Res. 67, 6053-6063.

  67. Huang, B., Cao, K., Li, X., Guo, S., Mao, X., Wang, Z., Zhuang, J., Pan, J., Mo, C., Chen, J., and Qiu, S. (2011) The Expression and Role of Protein Kinase C (PKC) Epsilon in Clear Cell Renal Cell Carcinoma. J Exp Clin Cancer Res. 30, 88-9966-30-88.

  68. Cornford, P., Evans, J., Dodson, A., Parsons, K., Woolfenden, A., Neoptolemos, J., and Foster, C. S. (1999) Protein Kinase C Isoenzyme Patterns Characteristically Modulated in Early Prostate Cancer. Am J Pathol. 154, 137-144.

  69. Ikeda, Y., Olsen, G. S., Ziv, E., Hansen, L. L., Busch, A. K., Hansen, B. F., Shafrir, E., and Mosthaf-Seedorf, L. (2001) Cellular Mechanism of Nutritionally Induced Insulin Resistance in Psammomys Obesus: Overexpression of Protein Kinase Cepsilon in Skeletal Muscle Precedes the Onset of Hyperinsulinemia and Hyperglycemia. Diabetes. 50, 584-592.

  70. Malhotra, A., Reich, D., Reich, D., Nakouzi, A., Sanghi, V., Geenen, D. L., and Buttrick, P. M. (1997) Experimental Diabetes is Associated with Functional Activation of Protein Kinase C Epsilon and Phosphorylation of Troponin I in the Heart, which are Prevented by Angiotensin II Receptor Blockade. Circ Res. 81, 1027-1033.

  71. Kapor-Drezgic, J., Zhou, X., Babazono, T., Dlugosz, J. A., Hohman, T., and Whiteside, C. (1999) Effect of High Glucose on Mesangial Cell Protein Kinase C-Delta and -Epsilon is Polyol Pathway-Dependent. J Am Soc Nephrol. 10, 1193-1203.

  72. Matsushima, H., Shimohama, S., Chachin, M., Taniguchi, T., and Kimura, J. (1996) Ca2+-Dependent and Ca2+-Independent Protein Kinase C Changes in the Brain of Patients with Alzheimer's Disease. J Neurochem. 67, 317-323.

  73. Kinouchi, T., Sorimachi, H., Maruyama, K., Mizuno, K., Ohno, S., Ishiura, S., and Suzuki, K. (1995) Conventional Protein Kinase C (PKC)-Alpha and Novel PKC Epsilon, but Not -Delta, Increase the Secretion of an N-Terminal Fragment of Alzheimer's Disease Amyloid Precursor Protein from PKC cDNA Transfected 3Y1 Fibroblasts. FEBS Lett. 364, 203-206.

  74. Gruber, T., Thuille, N., Hermann-Kleiter, N., Leitges, M., and Baier, G. (2005) Protein Kinase Cepsilon is Dispensable for TCR/CD3-Signaling. Mol Immunol. 42, 305-310.

  75. Wheeler, D. L., Ness, K. J., Oberley, T. D., and Verma, A. K. (2003) Protein Kinase Cepsilon is Linked to 12-O-Tetradecanoylphorbol-13-Acetate-Induced Tumor Necrosis Factor-Alpha Ectodomain Shedding and the Development of Metastatic Squamous Cell Carcinoma in Protein Kinase Cepsilon Transgenic Mice. Cancer Res. 63, 6547-6555.

  76. Hodge, C. W., Raber, J., McMahon, T., Walter, H., Sanchez-Perez, A. M., Olive, M. F., Mehmert, K., Morrow, A. L., and Messing, R. O. (2002) Decreased Anxiety-Like Behavior, Reduced Stress Hormones, and Neurosteroid Supersensitivity in Mice Lacking Protein Kinase Cepsilon. J Clin Invest. 110, 1003-1010.

  77. Schmitz-Peiffer, C., Laybutt, D. R., Burchfield, J. G., Gurisik, E., Narasimhan, S., Mitchell, C. J., Pedersen, D. J., Braun, U., Cooney, G. J., Leitges, M., and Biden, T. J. (2007) Inhibition of PKCepsilon Improves Glucose-Stimulated Insulin Secretion and Reduces Insulin Clearance. Cell Metab. 6, 320-328.

  78. Jansen, A. P., Verwiebe, E. G., Dreckschmidt, N. E., Wheeler, D. L., Oberley, T. D., and Verma, A. K. (2001) Protein Kinase C-Epsilon Transgenic Mice: A Unique Model for Metastatic Squamous Cell Carcinoma. Cancer Res. 61, 808-812.

  79. Ting, H. C., Christian, S. L., Burgess, A. E., and Gold, M. R. (2002) Activation and Phosphatidylinositol 3-Kinase-Dependent Phosphorylation of Protein Kinase C-Epsilon by the B Cell Antigen Receptor. Immunol Lett. 82, 205-215.