Phenotypic Mutation 'Tortilla' (pdf version)
Mutation Type splice site
Coordinate74,379,417 bp (GRCm38)
Base Change G ⇒ T (forward strand)
Gene Pcdh15
Gene Name protocadherin 15
Synonym(s) Gm9815, nmf19, Ush1f
Chromosomal Location 73,099,342-74,649,737 bp (+)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the cadherin superfamily. Family members encode integral membrane proteins that mediate calcium-dependent cell-cell adhesion. It plays an essential role in maintenance of normal retinal and cochlear function. Mutations in this gene result in hearing loss and Usher Syndrome Type IF (USH1F). Extensive alternative splicing resulting in multiple isoforms has been observed in the mouse ortholog. Similar alternatively spliced transcripts are inferred to occur in human, and additional variants are likely to occur. [provided by RefSeq, Dec 2008]
PHENOTYPE: Homozygotes for severe mutations exhibit circling, head-tossing, hyperactivity, impaired swimming and profound deafness. Mice have defects in cochlea and degeneration of hair cells, spiral ganglion cells and saccular macula. Females are poor mothers. [provided by MGI curators]
Accession Number

NCBI RefSeq: NM_023115.3, NM_001142735.1, NM_001142736.1, NM_001142737.1, NM_001142740.1, NM_001142738.1, NM_001142739.1, NM_001142741.1, NM_001142742.1, NM_001142743.1, NM_001142746.1, NM_001142760.1, NM_001142747.1, NM_001142748.1; MGI: 1891428

Mapped Yes 
Amino Acid Change
Institutional SourceBeutler Lab
Gene Model predicted gene model for protein(s): [ENSMUSP00000068561] [ENSMUSP00000090076 ] [ENSMUSP00000101064 ] [ENSMUSP00000101066 ] [ENSMUSP00000101069] [ENSMUSP00000121130 ] [ENSMUSP00000120056 ] [ENSMUSP00000114326] [ENSMUSP00000115399] [ENSMUSP00000121939 ] [ENSMUSP00000117731 ] [ENSMUSP00000122911 ] [ENSMUSP00000118833 ] [ENSMUSP00000142173 ] [ENSMUSP00000118201 ] [ENSMUSP00000142313 ] [ENSMUSP00000142238 ] [ENSMUSP00000122940 ] [ENSMUSP00000141973 ] [ENSMUSP00000141594 ] [ENSMUSP00000141920 ] [ENSMUSP00000135501 ] [ENSMUSP00000122466 ] [ENSMUSP00000119662 ] [ENSMUSP00000141792 ] [ENSMUSP00000135849 ] [ENSMUSP00000120618] [ENSMUSP00000121534] [ENSMUSP00000122606] [ENSMUSP00000123647] [ENSMUSP00000134863] [ENSMUSP00000135495]   † probably from a misspliced transcript
SMART Domains Protein: ENSMUSP00000068561
Gene: ENSMUSG00000052613

signal peptide 1 26 N/A INTRINSIC
CA 64 145 1.22e-1 SMART
CA 174 263 5.48e-8 SMART
CA 304 393 1.94e-8 SMART
CA 426 507 2.29e-10 SMART
CA 531 644 2.34e-16 SMART
CA 668 746 1.93e-26 SMART
CA 770 853 5.69e-15 SMART
CA 877 963 6.85e-9 SMART
CA 984 1071 3.09e-16 SMART
CA 1095 1179 4.49e-4 SMART
transmembrane domain 1304 1326 N/A INTRINSIC
low complexity region 1347 1374 N/A INTRINSIC
low complexity region 1583 1600 N/A INTRINSIC
low complexity region 1662 1682 N/A INTRINSIC
low complexity region 1689 1702 N/A INTRINSIC
low complexity region 1706 1756 N/A INTRINSIC
Predicted Effect probably benign
SMART Domains Protein: ENSMUSP00000090076
Gene: ENSMUSG00000052613

signal peptide 1 26 N/A INTRINSIC
CA 64 145 1.22e-1 SMART
CA 174 263 5.48e-8 SMART
CA 304 393 1.94e-8 SMART
CA 426 507 2.29e-10 SMART
CA 531 613 4.88e-14 SMART
CA 638 715 4.65e-20 SMART
CA 739 817 1.93e-26 SMART
CA 841 924 5.69e-15 SMART
CA 948 1034 6.85e-9 SMART
CA 1055 1142 3.09e-16 SMART
CA 1166 1250 4.49e-4 SMART
transmembrane domain 1377 1399 N/A INTRINSIC
low complexity region 1415 1442 N/A INTRINSIC
low complexity region 1651 1668 N/A INTRINSIC
low complexity region 1730 1750 N/A INTRINSIC
low complexity region 1757 1770 N/A INTRINSIC
low complexity region 1774 1824 N/A INTRINSIC
Predicted Effect probably null
SMART Domains Protein: ENSMUSP00000101064
Gene: ENSMUSG00000052613

signal peptide 1 26 N/A INTRINSIC
CA 64 145 1.22e-1 SMART
CA 174 263 5.48e-8 SMART
CA 304 393 1.94e-8 SMART
CA 426 507 2.29e-10 SMART
CA 531 613 4.88e-14 SMART
CA 638 715 4.65e-20 SMART
CA 739 817 1.93e-26 SMART
CA 841 924 5.69e-15 SMART
CA 948 1034 6.85e-9 SMART
CA 1055 1142 3.09e-16 SMART
CA 1166 1250 4.49e-4 SMART
transmembrane domain 1375 1397 N/A INTRINSIC
low complexity region 1418 1445 N/A INTRINSIC
low complexity region 1656 1673 N/A INTRINSIC
low complexity region 1735 1755 N/A INTRINSIC
low complexity region 1762 1775 N/A INTRINSIC
low complexity region 1779 1829 N/A INTRINSIC
Predicted Effect probably null
SMART Domains Protein: ENSMUSP00000101066
Gene: ENSMUSG00000052613

signal peptide 1 26 N/A INTRINSIC
CA 69 150 1.22e-1 SMART
CA 179 268 5.48e-8 SMART
CA 309 398 1.94e-8 SMART
CA 431 512 2.29e-10 SMART
CA 536 618 4.88e-14 SMART
CA 643 720 4.65e-20 SMART
CA 744 822 1.93e-26 SMART
CA 846 929 5.69e-15 SMART
CA 953 1039 6.85e-9 SMART
CA 1060 1147 3.09e-16 SMART
CA 1171 1255 4.49e-4 SMART
transmembrane domain 1380 1402 N/A INTRINSIC
low complexity region 1423 1450 N/A INTRINSIC
low complexity region 1661 1678 N/A INTRINSIC
low complexity region 1740 1760 N/A INTRINSIC
low complexity region 1767 1780 N/A INTRINSIC
low complexity region 1784 1834 N/A INTRINSIC
Predicted Effect probably null
SMART Domains Protein: ENSMUSP00000101069
Gene: ENSMUSG00000052613

signal peptide 1 26 N/A INTRINSIC
CA 64 145 1.22e-1 SMART
CA 174 263 5.48e-8 SMART
CA 304 393 1.94e-8 SMART
CA 426 507 2.29e-10 SMART
CA 531 644 2.34e-16 SMART
CA 668 746 1.93e-26 SMART
CA 770 853 5.69e-15 SMART
CA 877 963 6.85e-9 SMART
CA 984 1071 3.09e-16 SMART
CA 1095 1179 4.49e-4 SMART
transmembrane domain 1304 1326 N/A INTRINSIC
low complexity region 1347 1374 N/A INTRINSIC
low complexity region 1585 1602 N/A INTRINSIC
low complexity region 1664 1684 N/A INTRINSIC
low complexity region 1691 1704 N/A INTRINSIC
low complexity region 1708 1758 N/A INTRINSIC
Predicted Effect probably benign
SMART Domains Protein: ENSMUSP00000121130
Gene: ENSMUSG00000052613

CA 30 118 7.87e-9 SMART
CA 142 224 4.88e-14 SMART
CA 249 326 4.65e-20 SMART
CA 350 428 1.93e-26 SMART
CA 452 535 5.69e-15 SMART
CA 559 645 6.85e-9 SMART
CA 666 753 3.09e-16 SMART
CA 777 861 4.49e-4 SMART
transmembrane domain 986 1008 N/A INTRINSIC
low complexity region 1029 1056 N/A INTRINSIC
Predicted Effect probably null
SMART Domains Protein: ENSMUSP00000120056
Gene: ENSMUSG00000052613

signal peptide 1 26 N/A INTRINSIC
CA 64 145 1.22e-1 SMART
CA 174 263 5.48e-8 SMART
CA 304 393 1.94e-8 SMART
CA 426 507 2.29e-10 SMART
CA 531 613 4.88e-14 SMART
CA 638 715 4.65e-20 SMART
CA 739 817 1.93e-26 SMART
CA 841 924 5.69e-15 SMART
CA 948 1034 6.85e-9 SMART
CA 1055 1122 4.52e-2 SMART
Predicted Effect probably null
SMART Domains Protein: ENSMUSP00000114326
Gene: ENSMUSG00000052613

signal peptide 1 26 N/A INTRINSIC
CA 64 145 1.22e-1 SMART
CA 174 263 5.48e-8 SMART
CA 304 393 1.94e-8 SMART
CA 426 507 2.29e-10 SMART
CA 531 613 4.88e-14 SMART
low complexity region 649 665 N/A INTRINSIC
Predicted Effect probably benign
SMART Domains Protein: ENSMUSP00000115399
Gene: ENSMUSG00000052613

signal peptide 1 26 N/A INTRINSIC
CA 64 145 1.22e-1 SMART
CA 174 263 5.48e-8 SMART
CA 304 393 1.94e-8 SMART
low complexity region 430 468 N/A INTRINSIC
low complexity region 521 584 N/A INTRINSIC
low complexity region 610 641 N/A INTRINSIC
low complexity region 657 685 N/A INTRINSIC
Predicted Effect probably benign
SMART Domains Protein: ENSMUSP00000121939
Gene: ENSMUSG00000052613

signal peptide 1 26 N/A INTRINSIC
CA 42 123 1.22e-1 SMART
CA 152 241 5.48e-8 SMART
CA 282 371 1.94e-8 SMART
CA 404 485 2.29e-10 SMART
CA 509 591 4.88e-14 SMART
CA 616 693 4.65e-20 SMART
CA 717 795 1.93e-26 SMART
CA 819 902 5.69e-15 SMART
CA 926 1012 6.85e-9 SMART
CA 1033 1120 3.09e-16 SMART
CA 1144 1228 4.49e-4 SMART
transmembrane domain 1353 1375 N/A INTRINSIC
low complexity region 1396 1423 N/A INTRINSIC
low complexity region 1634 1651 N/A INTRINSIC
low complexity region 1713 1733 N/A INTRINSIC
low complexity region 1740 1753 N/A INTRINSIC
low complexity region 1757 1807 N/A INTRINSIC
Predicted Effect probably null
SMART Domains Protein: ENSMUSP00000117731
Gene: ENSMUSG00000052613

signal peptide 1 26 N/A INTRINSIC
CA 42 123 1.22e-1 SMART
CA 152 241 5.48e-8 SMART
CA 282 371 1.94e-8 SMART
CA 404 485 2.29e-10 SMART
CA 509 591 4.88e-14 SMART
CA 616 693 4.65e-20 SMART
CA 717 795 1.93e-26 SMART
CA 819 902 5.69e-15 SMART
CA 926 1012 6.85e-9 SMART
CA 1033 1120 3.09e-16 SMART
CA 1144 1228 4.49e-4 SMART
transmembrane domain 1355 1377 N/A INTRINSIC
low complexity region 1393 1420 N/A INTRINSIC
low complexity region 1631 1648 N/A INTRINSIC
low complexity region 1710 1730 N/A INTRINSIC
low complexity region 1737 1750 N/A INTRINSIC
low complexity region 1754 1804 N/A INTRINSIC
Predicted Effect probably null
SMART Domains Protein: ENSMUSP00000122911
Gene: ENSMUSG00000052613

signal peptide 1 26 N/A INTRINSIC
CA 64 145 1.22e-1 SMART
CA 174 263 5.48e-8 SMART
CA 304 393 1.94e-8 SMART
CA 426 507 2.29e-10 SMART
CA 531 613 4.88e-14 SMART
CA 638 715 4.65e-20 SMART
CA 739 817 1.93e-26 SMART
CA 841 924 5.69e-15 SMART
CA 948 1034 6.85e-9 SMART
CA 1055 1142 3.09e-16 SMART
CA 1166 1250 4.49e-4 SMART
transmembrane domain 1375 1397 N/A INTRINSIC
low complexity region 1418 1445 N/A INTRINSIC
low complexity region 1654 1671 N/A INTRINSIC
low complexity region 1733 1753 N/A INTRINSIC
low complexity region 1760 1773 N/A INTRINSIC
low complexity region 1777 1827 N/A INTRINSIC
Predicted Effect probably null
SMART Domains Protein: ENSMUSP00000118833
Gene: ENSMUSG00000052613

signal peptide 1 26 N/A INTRINSIC
CA 64 145 1.22e-1 SMART
CA 174 263 5.48e-8 SMART
CA 304 393 1.94e-8 SMART
CA 426 507 2.29e-10 SMART
CA 531 613 4.88e-14 SMART
CA 638 715 4.65e-20 SMART
CA 739 817 1.93e-26 SMART
CA 841 924 5.69e-15 SMART
CA 948 1034 6.85e-9 SMART
CA 1055 1142 3.09e-16 SMART
CA 1166 1250 4.49e-4 SMART
transmembrane domain 1375 1397 N/A INTRINSIC
low complexity region 1418 1445 N/A INTRINSIC
low complexity region 1477 1494 N/A INTRINSIC
Predicted Effect probably null
SMART Domains Protein: ENSMUSP00000142173
Gene: ENSMUSG00000052613

signal peptide 1 26 N/A INTRINSIC
CA 69 150 1.22e-1 SMART
CA 179 268 5.48e-8 SMART
CA 309 398 1.94e-8 SMART
CA 431 512 2.29e-10 SMART
CA 536 618 4.88e-14 SMART
CA 643 720 4.65e-20 SMART
CA 744 822 1.93e-26 SMART
CA 846 929 5.69e-15 SMART
CA 953 1039 6.85e-9 SMART
CA 1060 1147 3.09e-16 SMART
CA 1171 1255 4.49e-4 SMART
transmembrane domain 1382 1404 N/A INTRINSIC
low complexity region 1420 1447 N/A INTRINSIC
low complexity region 1477 1494 N/A INTRINSIC
Predicted Effect probably null
SMART Domains Protein: ENSMUSP00000118201
Gene: ENSMUSG00000052613

signal peptide 1 26 N/A INTRINSIC
CA 64 145 6e-4 SMART
CA 174 263 2.8e-10 SMART
CA 304 393 9.4e-11 SMART
CA 426 507 1.2e-12 SMART
CA 531 613 2.3e-16 SMART
CA 638 726 3.4e-6 SMART
low complexity region 783 846 N/A INTRINSIC
low complexity region 872 903 N/A INTRINSIC
low complexity region 919 947 N/A INTRINSIC
Predicted Effect probably null
SMART Domains Protein: ENSMUSP00000142313
Gene: ENSMUSG00000052613

signal peptide 1 26 N/A INTRINSIC
CA 69 150 1.22e-1 SMART
CA 179 268 5.48e-8 SMART
CA 309 398 1.94e-8 SMART
CA 431 512 2.29e-10 SMART
CA 536 618 4.88e-14 SMART
CA 643 720 4.65e-20 SMART
CA 744 822 1.93e-26 SMART
CA 846 929 5.69e-15 SMART
CA 953 1039 6.85e-9 SMART
CA 1060 1147 3.09e-16 SMART
CA 1171 1255 4.49e-4 SMART
transmembrane domain 1380 1402 N/A INTRINSIC
low complexity region 1423 1450 N/A INTRINSIC
low complexity region 1480 1510 N/A INTRINSIC
low complexity region 1512 1530 N/A INTRINSIC
low complexity region 1583 1646 N/A INTRINSIC
low complexity region 1672 1703 N/A INTRINSIC
low complexity region 1719 1747 N/A INTRINSIC
Predicted Effect probably null
SMART Domains Protein: ENSMUSP00000142238
Gene: ENSMUSG00000052613

signal peptide 1 26 N/A INTRINSIC
CA 64 145 6e-4 SMART
CA 174 263 2.8e-10 SMART
CA 304 393 9.4e-11 SMART
CA 426 514 3.8e-11 SMART
CA 538 620 2.3e-16 SMART
CA 645 722 2.3e-22 SMART
CA 746 824 9.3e-29 SMART
CA 848 931 2.8e-17 SMART
CA 955 1041 3.3e-11 SMART
CA 1062 1149 1.5e-18 SMART
CA 1173 1257 2.3e-6 SMART
transmembrane domain 1382 1404 N/A INTRINSIC
low complexity region 1425 1452 N/A INTRINSIC
low complexity region 1482 1512 N/A INTRINSIC
low complexity region 1514 1532 N/A INTRINSIC
low complexity region 1585 1648 N/A INTRINSIC
low complexity region 1674 1705 N/A INTRINSIC
low complexity region 1721 1749 N/A INTRINSIC
Predicted Effect probably null
SMART Domains Protein: ENSMUSP00000122940
Gene: ENSMUSG00000052613

signal peptide 1 26 N/A INTRINSIC
CA 64 145 1.22e-1 SMART
low complexity region 209 225 N/A INTRINSIC
CA 267 356 1.94e-8 SMART
CA 389 470 2.29e-10 SMART
CA 494 576 4.88e-14 SMART
CA 601 678 4.65e-20 SMART
CA 702 780 1.93e-26 SMART
CA 804 887 5.69e-15 SMART
CA 911 997 6.85e-9 SMART
CA 1018 1105 3.09e-16 SMART
CA 1129 1213 4.49e-4 SMART
transmembrane domain 1340 1362 N/A INTRINSIC
low complexity region 1378 1405 N/A INTRINSIC
low complexity region 1614 1631 N/A INTRINSIC
low complexity region 1693 1713 N/A INTRINSIC
low complexity region 1720 1733 N/A INTRINSIC
low complexity region 1737 1787 N/A INTRINSIC
Predicted Effect probably null
SMART Domains Protein: ENSMUSP00000141973
Gene: ENSMUSG00000052613

signal peptide 1 26 N/A INTRINSIC
CA 64 145 1.22e-1 SMART
CA 174 263 5.48e-8 SMART
CA 304 393 1.94e-8 SMART
CA 426 507 2.29e-10 SMART
CA 531 613 4.88e-14 SMART
CA 638 715 4.65e-20 SMART
CA 739 817 1.93e-26 SMART
CA 841 924 5.69e-15 SMART
CA 948 1034 6.85e-9 SMART
CA 1055 1142 3.09e-16 SMART
CA 1166 1250 4.49e-4 SMART
transmembrane domain 1375 1397 N/A INTRINSIC
low complexity region 1418 1445 N/A INTRINSIC
low complexity region 1477 1494 N/A INTRINSIC
Predicted Effect probably null
SMART Domains Protein: ENSMUSP00000141594
Gene: ENSMUSG00000052613

CA 43 120 2.3e-22 SMART
CA 144 222 9.3e-29 SMART
CA 246 329 2.8e-17 SMART
CA 353 439 3.3e-11 SMART
CA 460 547 1.5e-18 SMART
CA 571 655 2.3e-6 SMART
transmembrane domain 780 802 N/A INTRINSIC
low complexity region 823 850 N/A INTRINSIC
low complexity region 1051 1068 N/A INTRINSIC
low complexity region 1130 1150 N/A INTRINSIC
low complexity region 1157 1170 N/A INTRINSIC
low complexity region 1174 1224 N/A INTRINSIC
Predicted Effect probably null
SMART Domains Protein: ENSMUSP00000141920
Gene: ENSMUSG00000052613

signal peptide 1 26 N/A INTRINSIC
CA 64 145 6e-4 SMART
CA 174 263 2.8e-10 SMART
CA 304 393 9.4e-11 SMART
CA 426 507 1.2e-12 SMART
CA 531 613 2.3e-16 SMART
CA 638 715 2.3e-22 SMART
CA 739 817 9.3e-29 SMART
CA 841 924 2.8e-17 SMART
CA 948 1034 3.3e-11 SMART
CA 1055 1142 1.5e-18 SMART
CA 1166 1250 2.3e-6 SMART
transmembrane domain 1377 1399 N/A INTRINSIC
low complexity region 1415 1442 N/A INTRINSIC
low complexity region 1514 1531 N/A INTRINSIC
Predicted Effect probably null
SMART Domains Protein: ENSMUSP00000135501
Gene: ENSMUSG00000052613

signal peptide 1 26 N/A INTRINSIC
CA 69 150 1.22e-1 SMART
CA 179 268 5.48e-8 SMART
CA 309 398 1.94e-8 SMART
CA 431 512 2.29e-10 SMART
CA 536 618 4.88e-14 SMART
CA 643 720 4.65e-20 SMART
CA 744 822 1.93e-26 SMART
CA 846 929 5.69e-15 SMART
CA 953 1039 6.85e-9 SMART
CA 1060 1147 3.09e-16 SMART
CA 1171 1255 4.49e-4 SMART
transmembrane domain 1380 1402 N/A INTRINSIC
low complexity region 1423 1450 N/A INTRINSIC
low complexity region 1482 1499 N/A INTRINSIC
Predicted Effect probably null
SMART Domains Protein: ENSMUSP00000122466
Gene: ENSMUSG00000052613

signal peptide 1 26 N/A INTRINSIC
CA 64 145 1.22e-1 SMART
CA 174 263 5.48e-8 SMART
CA 304 393 1.94e-8 SMART
CA 426 507 2.29e-10 SMART
CA 531 613 4.88e-14 SMART
CA 638 715 4.65e-20 SMART
CA 739 817 1.93e-26 SMART
CA 841 924 5.69e-15 SMART
CA 948 1034 6.85e-9 SMART
CA 1055 1142 3.09e-16 SMART
CA 1166 1250 4.49e-4 SMART
transmembrane domain 1375 1397 N/A INTRINSIC
low complexity region 1418 1445 N/A INTRINSIC
Predicted Effect probably null
SMART Domains Protein: ENSMUSP00000119662
Gene: ENSMUSG00000052613

signal peptide 1 26 N/A INTRINSIC
CA 69 150 1.22e-1 SMART
CA 179 268 5.48e-8 SMART
CA 309 398 1.94e-8 SMART
CA 431 519 7.87e-9 SMART
CA 543 625 4.88e-14 SMART
CA 650 727 4.65e-20 SMART
CA 751 829 1.93e-26 SMART
CA 853 936 5.69e-15 SMART
CA 960 1046 6.85e-9 SMART
CA 1067 1154 3.09e-16 SMART
CA 1178 1262 4.49e-4 SMART
transmembrane domain 1387 1409 N/A INTRINSIC
low complexity region 1430 1457 N/A INTRINSIC
low complexity region 1489 1519 N/A INTRINSIC
low complexity region 1521 1539 N/A INTRINSIC
low complexity region 1592 1655 N/A INTRINSIC
low complexity region 1681 1712 N/A INTRINSIC
low complexity region 1728 1756 N/A INTRINSIC
Predicted Effect probably null
SMART Domains Protein: ENSMUSP00000141792
Gene: ENSMUSG00000052613

signal peptide 1 26 N/A INTRINSIC
CA 69 150 1.22e-1 SMART
CA 179 268 5.48e-8 SMART
CA 309 398 1.94e-8 SMART
CA 431 512 2.29e-10 SMART
CA 536 618 4.88e-14 SMART
CA 643 720 4.65e-20 SMART
CA 744 822 1.93e-26 SMART
CA 846 929 5.69e-15 SMART
CA 953 1039 6.85e-9 SMART
CA 1060 1147 3.09e-16 SMART
CA 1171 1255 4.49e-4 SMART
transmembrane domain 1380 1402 N/A INTRINSIC
low complexity region 1423 1450 N/A INTRINSIC
low complexity region 1661 1678 N/A INTRINSIC
low complexity region 1740 1760 N/A INTRINSIC
low complexity region 1767 1780 N/A INTRINSIC
low complexity region 1784 1834 N/A INTRINSIC
Predicted Effect probably null
SMART Domains Protein: ENSMUSP00000135849
Gene: ENSMUSG00000052613

signal peptide 1 26 N/A INTRINSIC
CA 69 150 1.22e-1 SMART
CA 179 268 5.48e-8 SMART
CA 309 398 1.94e-8 SMART
CA 431 512 2.29e-10 SMART
CA 536 618 4.88e-14 SMART
CA 643 720 4.65e-20 SMART
CA 744 822 1.93e-26 SMART
CA 846 929 5.69e-15 SMART
CA 953 1039 6.85e-9 SMART
CA 1060 1127 4.52e-2 SMART
Predicted Effect probably null
SMART Domains Protein: ENSMUSP00000120618
Gene: ENSMUSG00000052613

signal peptide 1 26 N/A INTRINSIC
CA 64 145 1.22e-1 SMART
CA 174 263 5.48e-8 SMART
CA 304 393 1.94e-8 SMART
CA 426 513 2.52e-7 SMART
CA 534 601 4.52e-2 SMART
Predicted Effect probably benign
SMART Domains Protein: ENSMUSP00000121534
Gene: ENSMUSG00000052613

signal peptide 1 26 N/A INTRINSIC
CA 64 145 1.22e-1 SMART
CA 174 263 5.48e-8 SMART
CA 304 393 1.94e-8 SMART
CA 426 507 2.29e-10 SMART
CA 531 613 4.88e-14 SMART
low complexity region 649 665 N/A INTRINSIC
Predicted Effect probably benign
SMART Domains Protein: ENSMUSP00000122606
Gene: ENSMUSG00000052613

signal peptide 1 26 N/A INTRINSIC
CA 64 145 1.22e-1 SMART
CA 174 263 5.48e-8 SMART
low complexity region 313 326 N/A INTRINSIC
Predicted Effect probably benign
SMART Domains Protein: ENSMUSP00000123647
Gene: ENSMUSG00000052613

signal peptide 1 26 N/A INTRINSIC
CA 64 145 1.22e-1 SMART
CA 174 263 5.48e-8 SMART
Blast:CA 304 363 1e-33 BLAST
low complexity region 364 399 N/A INTRINSIC
low complexity region 452 515 N/A INTRINSIC
low complexity region 541 572 N/A INTRINSIC
low complexity region 588 616 N/A INTRINSIC
Predicted Effect probably benign
SMART Domains Protein: ENSMUSP00000134863
Gene: ENSMUSG00000052613

transmembrane domain 128 150 N/A INTRINSIC
low complexity region 215 232 N/A INTRINSIC
Predicted Effect probably benign
SMART Domains Protein: ENSMUSP00000135495
Gene: ENSMUSG00000052613

signal peptide 1 26 N/A INTRINSIC
CA 64 145 1.22e-1 SMART
CA 174 263 5.48e-8 SMART
Blast:CA 304 330 2e-8 BLAST
Predicted Effect probably benign
Meta Mutation Damage Score 0.9755 question?
Is this an essential gene? Non Essential (E-score: 0.000) question?
Phenotypic Category
Phenotypequestion? Literature verified References
FACS CD44+ CD8 T cells - increased
FACS CD44+ T cells - increased
OVA-specific IgE after 2nd OVA/Alum - increased
Candidate Explorer Status CE: potential candidate; Verification probability: 0.317; ML prob: 0.348; human score: 1
Single pedigree
Linkage Analysis Data
Alleles Listed at MGI

All alleles(20) : Chemically induced (ENU)(5) Chemically induced (other)(1) Gene trapped(2) Radiation induced(1) Transgenic(2) Spontaneous(6) Targeted(3)

Lab Alleles
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00421:Pcdh15 APN 10 74185345 nonsense probably null
IGL00432:Pcdh15 APN 10 74291082 splice site probably benign
IGL00533:Pcdh15 APN 10 74502720 missense probably damaging 1.00
IGL00596:Pcdh15 APN 10 74630744 missense probably benign 0.00
IGL00930:Pcdh15 APN 10 74630698 missense probably benign 0.08
IGL00970:Pcdh15 APN 10 74379340 missense probably damaging 1.00
IGL01087:Pcdh15 APN 10 74342632 missense possibly damaging 0.90
IGL01763:Pcdh15 APN 10 74210461 missense probably benign 0.09
IGL01787:Pcdh15 APN 10 74450283 missense probably benign 0.25
IGL02070:Pcdh15 APN 10 74630868 missense probably benign 0.00
IGL02234:Pcdh15 APN 10 74631862 missense probably benign 0.02
IGL02268:Pcdh15 APN 10 74342672 missense probably damaging 1.00
IGL02280:Pcdh15 APN 10 74222463 missense probably damaging 1.00
IGL02363:Pcdh15 APN 10 74317086 missense probably damaging 0.98
IGL02420:Pcdh15 APN 10 74303106 missense probably damaging 0.98
IGL02749:Pcdh15 APN 10 74631068 missense probably benign 0.00
IGL02939:Pcdh15 APN 10 74504816 splice site probably benign
IGL02970:Pcdh15 APN 10 74290962 splice site probably benign
IGL03010:Pcdh15 APN 10 74385945 missense probably damaging 1.00
IGL03061:Pcdh15 APN 10 74317011 missense probably damaging 0.97
IGL03095:Pcdh15 APN 10 74355874 missense probably damaging 1.00
IGL03149:Pcdh15 APN 10 74630695 missense probably damaging 1.00
IGL03187:Pcdh15 APN 10 74355874 missense probably damaging 1.00
IGL03279:Pcdh15 APN 10 74317072 missense probably damaging 1.00
IGL03392:Pcdh15 APN 10 74624272 missense probably damaging 1.00
loop UTSW 10 74185378 missense probably damaging 1.00
mcduck UTSW 10 74626844 critical splice donor site probably null
spaz UTSW 10 74210425 missense probably damaging 1.00
sphere UTSW 10 74624284 missense probably damaging 1.00
squirm UTSW 10 large deletion
1mM(1):Pcdh15 UTSW 10 74626137 intron probably benign
BB009:Pcdh15 UTSW 10 74645527 missense probably benign 0.18
BB019:Pcdh15 UTSW 10 74645527 missense probably benign 0.18
R0038:Pcdh15 UTSW 10 74643440 missense possibly damaging 0.95
R0103:Pcdh15 UTSW 10 74210425 missense probably damaging 1.00
R0110:Pcdh15 UTSW 10 74290976 missense probably damaging 1.00
R0111:Pcdh15 UTSW 10 74626819 nonsense probably null
R0119:Pcdh15 UTSW 10 74170575 missense probably damaging 1.00
R0131:Pcdh15 UTSW 10 74170608 missense probably null 1.00
R0445:Pcdh15 UTSW 10 74342549 missense probably damaging 1.00
R0464:Pcdh15 UTSW 10 74626844 critical splice donor site probably null
R0503:Pcdh15 UTSW 10 74210385 missense probably damaging 1.00
R0507:Pcdh15 UTSW 10 74621297 missense probably damaging 1.00
R0510:Pcdh15 UTSW 10 74290976 missense probably damaging 1.00
R0742:Pcdh15 UTSW 10 74621297 missense probably damaging 1.00
R0790:Pcdh15 UTSW 10 74631053 missense probably benign 0.01
R0829:Pcdh15 UTSW 10 74502766 missense probably damaging 1.00
R0839:Pcdh15 UTSW 10 74626782 missense probably null 1.00
R0882:Pcdh15 UTSW 10 74342656 missense probably damaging 1.00
R0894:Pcdh15 UTSW 10 74624255 missense probably damaging 1.00
R0944:Pcdh15 UTSW 10 74210470 missense probably damaging 0.99
R1081:Pcdh15 UTSW 10 74450313 missense probably damaging 1.00
R1148:Pcdh15 UTSW 10 74170560 missense probably damaging 1.00
R1148:Pcdh15 UTSW 10 74170560 missense probably damaging 1.00
R1484:Pcdh15 UTSW 10 74291001 missense probably damaging 1.00
R1521:Pcdh15 UTSW 10 74594191 missense probably damaging 1.00
R1694:Pcdh15 UTSW 10 74594163 missense probably damaging 1.00
R1795:Pcdh15 UTSW 10 74624255 missense probably damaging 1.00
R2021:Pcdh15 UTSW 10 74631193 missense possibly damaging 0.93
R2022:Pcdh15 UTSW 10 74631193 missense possibly damaging 0.93
R2023:Pcdh15 UTSW 10 74631193 missense possibly damaging 0.93
R2076:Pcdh15 UTSW 10 74342647 missense probably damaging 1.00
R2199:Pcdh15 UTSW 10 74170509 missense probably damaging 1.00
R2510:Pcdh15 UTSW 10 74631499 missense probably benign 0.39
R2511:Pcdh15 UTSW 10 74645996 missense possibly damaging 0.94
R3418:Pcdh15 UTSW 10 74584222 missense probably benign 0.12
R3419:Pcdh15 UTSW 10 74584222 missense probably benign 0.12
R3433:Pcdh15 UTSW 10 74631499 missense probably benign 0.39
R3619:Pcdh15 UTSW 10 74643395 missense probably benign 0.19
R3723:Pcdh15 UTSW 10 74645848 missense probably benign 0.05
R3724:Pcdh15 UTSW 10 74645848 missense probably benign 0.05
R3778:Pcdh15 UTSW 10 73947151 splice site probably null
R3851:Pcdh15 UTSW 10 74631686 missense probably damaging 0.97
R4175:Pcdh15 UTSW 10 74631997 intron probably benign
R4261:Pcdh15 UTSW 10 74645680 missense probably damaging 1.00
R4385:Pcdh15 UTSW 10 74550490 missense probably damaging 1.00
R4585:Pcdh15 UTSW 10 74624284 missense probably damaging 1.00
R4602:Pcdh15 UTSW 10 74594214 missense probably damaging 1.00
R4639:Pcdh15 UTSW 10 74643607 missense probably benign 0.00
R4703:Pcdh15 UTSW 10 74450163 missense probably damaging 1.00
R4819:Pcdh15 UTSW 10 74324389 missense probably damaging 1.00
R4906:Pcdh15 UTSW 10 74504793 nonsense probably null
R4961:Pcdh15 UTSW 10 74379417 splice site probably null
R5018:Pcdh15 UTSW 10 74643775 missense possibly damaging 0.68
R5125:Pcdh15 UTSW 10 74584080 missense probably damaging 0.98
R5225:Pcdh15 UTSW 10 74303154 missense probably damaging 1.00
R5259:Pcdh15 UTSW 10 74396372 missense possibly damaging 0.67
R5279:Pcdh15 UTSW 10 74594183 missense probably damaging 1.00
R5395:Pcdh15 UTSW 10 74185287 missense probably damaging 1.00
R5458:Pcdh15 UTSW 10 74504779 missense probably damaging 1.00
R5617:Pcdh15 UTSW 10 74635672 intron probably benign
R5665:Pcdh15 UTSW 10 74626788 missense probably damaging 1.00
R5770:Pcdh15 UTSW 10 74185345 nonsense probably null
R5805:Pcdh15 UTSW 10 74230259 missense probably damaging 1.00
R5914:Pcdh15 UTSW 10 74630936 missense probably benign 0.42
R5988:Pcdh15 UTSW 10 74379357 missense probably benign 0.05
R6133:Pcdh15 UTSW 10 74645973 splice site probably null
R6189:Pcdh15 UTSW 10 74342651 missense probably null 1.00
R6414:Pcdh15 UTSW 10 74185426 missense probably damaging 1.00
R6536:Pcdh15 UTSW 10 74631389 missense probably damaging 1.00
R6612:Pcdh15 UTSW 10 74185378 missense probably damaging 1.00
R6711:Pcdh15 UTSW 10 74642387 missense possibly damaging 0.83
R6793:Pcdh15 UTSW 10 74631139 missense probably damaging 1.00
R6841:Pcdh15 UTSW 10 74450220 missense probably damaging 1.00
R6845:Pcdh15 UTSW 10 74630633 missense probably benign
R6915:Pcdh15 UTSW 10 74643809 missense probably benign 0.16
R6954:Pcdh15 UTSW 10 74645989 missense possibly damaging 0.92
R6970:Pcdh15 UTSW 10 74502687 missense probably damaging 0.98
R7018:Pcdh15 UTSW 10 74466354 missense probably damaging 1.00
R7064:Pcdh15 UTSW 10 74630614 missense possibly damaging 0.67
R7079:Pcdh15 UTSW 10 74317125 missense probably benign 0.21
R7172:Pcdh15 UTSW 10 74502765 missense probably damaging 1.00
R7220:Pcdh15 UTSW 10 74342609 missense possibly damaging 0.64
R7237:Pcdh15 UTSW 10 74584191 missense possibly damaging 0.88
R7266:Pcdh15 UTSW 10 74379390 nonsense probably null
R7276:Pcdh15 UTSW 10 74324392 missense probably benign 0.25
R7359:Pcdh15 UTSW 10 74584216 missense probably damaging 0.99
R7396:Pcdh15 UTSW 10 74630690 missense probably benign 0.17
R7421:Pcdh15 UTSW 10 74454065 missense possibly damaging 0.90
R7424:Pcdh15 UTSW 10 74506485 missense probably benign 0.09
R7463:Pcdh15 UTSW 10 74631770 missense possibly damaging 0.66
R7469:Pcdh15 UTSW 10 74645980 missense probably benign
R7512:Pcdh15 UTSW 10 74641382 missense possibly damaging 0.81
R7767:Pcdh15 UTSW 10 74486256 missense probably benign 0.07
R7830:Pcdh15 UTSW 10 74385901 missense probably damaging 1.00
R7890:Pcdh15 UTSW 10 74642314 missense probably damaging 1.00
R7897:Pcdh15 UTSW 10 74453995 missense probably damaging 1.00
R7908:Pcdh15 UTSW 10 74643582 missense probably benign 0.04
R7932:Pcdh15 UTSW 10 74645527 missense probably benign 0.18
R7940:Pcdh15 UTSW 10 74594190 missense probably damaging 1.00
R8230:Pcdh15 UTSW 10 74355875 missense probably damaging 1.00
R8307:Pcdh15 UTSW 10 74506475 nonsense probably null
R8382:Pcdh15 UTSW 10 74643395 missense probably benign 0.19
R8397:Pcdh15 UTSW 10 74291033 missense probably damaging 1.00
R8498:Pcdh15 UTSW 10 74482142 missense probably damaging 1.00
RF020:Pcdh15 UTSW 10 74185410 missense probably damaging 1.00
Z1176:Pcdh15 UTSW 10 74630701 missense probably benign 0.00
Z1177:Pcdh15 UTSW 10 74504800 missense probably damaging 1.00
Mode of Inheritance Autosomal Recessive
Local Stock Live Mice
Last Updated 2019-10-23 1:57 PM by Diantha La Vine
Record Created 2016-11-15 2:03 PM by Jamie Russell
Record Posted 2016-12-01
Phenotypic Description

Figure 1. The tortilla mice exhibit ataxia, hyperactivity, and circling.

The tortilla phenotype was initially identified among N-ethyl-N-nitrosourea (ENU)-induced G3 mice of the pedigree R4192. Mutants display ataxia, hyperactivity and circling (Figure 1).

Nature of Mutation

Figure 2. Linkage mapping of the behavioral phenotype using a recessive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 40 mutations (X-axis) identified in the G1 male of pedigree R4192. Binary phenotype data are shown for single locus linkage analysis without consideration of G2 dam identity.  Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 40 mutations. The behavioral phenotype was linked to a mutation in Pcdh15: a G to T transversion at base pair 74,379,417 (v38) on chromosome 10, or base pair 1,280,076 in the GenBank genomic region NC_000076 encoding Pcdh15 within the donor splice site of intron 15 (ENSMUST00000195531.5). Linkage was found with a recessive model of inheritance, wherein six variant homozygotes departed phenotypically from four homozygous reference mice and 11 heterozygous mice with a P value of 1.08 x 10-4 (Figure 2). Although significant linkages was found with a recessive model of inheritance, a substantial semidominant effect was also observed (P = 1.73 x 10-4). 


The effect of the mutation at the cDNA and protein level have not examined, but the mutation is predicted to result in skipping of the 80-nucleotide exon 15 (out of 35 total exons), resulting in an in-frame deletion of amino acids 640-666 of the protein.


            <--exon 14    <--exon 15 intron 15-->           exon 16-->          <--exon 35

1256638 ……TTAAATCTACAG ……CTTTCAGAAAC gtaagttacaagggaatgat…… CACAGGGATTCTC…… ……ACAAAACTCTGA 1546720
636     ……-L--N--L--Q- ……-L--S--E--T                        --T--G--I--L-…… ……-T--K--L--*- 1714
            correct        deleted                                      correct


DNA numbering corresponds to NC_000076. The donor splice site of intron 15, which is destroyed by the tortilla mutation, is indicated in blue lettering and the mutated nucleotide is indicated in red.

Illustration of Mutations in
Gene & Protein
Protein Prediction


Figure 3. Domain structures of Pcdh15 splice variants. PCDH15 isoforms consist of up to 11 extracellular cadherin (EC) repeats, one transmembrane domain and a variable cytoplasmic domain that contains a PDZ-binding motif (PBM).The four isoform classes are defined based upon the cytoplasmic tail variation or the absence of the tail. The isoforms CD1, CD2, and CD3 are full length and contain a cytoplasmic tail encoded by 35, 38, and 39 exons, respectively. Isoform S1 is predicted to be secreted, contains only 10 EC repeats and lacks a cytoplasmic tail. The tortilla  mutation is within intron 15. This image is interactive. Other mutations found in the protein are noted in red. Click on each allele for more information.

The mouse Pcdh15 gene encodes a protein that belongs to the protocadherin protein family (Figure 3). Protocadherins are atypical members of the large cadherin (calcium-dependent cell-cell adhesion proteins (1)) superfamily of transmembrane proteins that are defined by the presence of a variable number of extracellular cadherin domains known as EC repeats (2;3).


The Pcdh15 gene encodes multiple isoforms of the PCDH15 protein; exon 1 is non-coding (4;5). The amino acids of each isoform are unique from each other, but each isoform contains a signal sequence, a unique extracellular region, and a cytoplasmic domain (4;6). The A isoform has 11 cadherin repeats, 1 transmembrane domain and a 542 amino acid cytoplasmic domain (CD1) that contains 2 proline-rich regions and the C-terminal motif STSL, which is a type 1 PDZ (for postsynaptic density 95/Discs large/zona occludens-1)-binding consensus sequence (4;5;7;8).


The tortilla mutation may result in skipping of exon 15, deleting amino acids 640-666 from the EC repeat region. All of the isoforms of PCDH15 (CD-1, CD-2, and CD-3 classes) are predicted to be affected by the tortilla mutation (Figure 3). 


Please see the record squirm for information about Pcdh15.

Putative Mechanism

Hearing and balance both depend on the function of hair cells of the inner ear.  The hair cells of the inner ear are mechanosensors that perceive sound, head movement, and gravity (9).  The hair bundle present in hair cells is composed of numerous stereocilia that develop from microvilli and have a stiff core of parallel actin filaments anchored in the cuticular plate, a meshwork of horizontal actin filaments beneath the apical cell membrane. The stereocilia are connected to each other by numerous filaments, including tip links, horizontal top connectors, shaft connectors, transient lateral links and ankle links. The tip link is composed of Pcdh15 and Cdh23 and is two intertwined strands; Pcdh15 localizes to the lower end of the tip link while Cdh23 is localized to the upper end (10;11). In the retina, the USH proteins colocalize in the synaptic layer of the OPL (12-14), as well as in the ciliary region between the outer and inner segments, particularly in the connecting cilium and the calycal processes (13;14).  PCDH15 colocalizes with harmonin, myosin VIIa, and CDH23 at the synaptic terminals of photoreceptor cells in the retina.


Human mutations that are predicted to truncate PCDH15 in the extracellular domain typically cause Usher syndrome (USH; OMIM: #602083) (7;8), whereas missense mutations are commonly associated with non-syndromic deafness (DFNB23; OMIM #609533). USH syndrome is the most common type of deaf-blindness in humans. USH can be associated with vestibular dysfunction and balance problems, reduced odor identification, reduced sperm motility, mental deficiency, cerebral atrophy, and ataxia (13;14).


The tortilla phenotype mimics that of the Ames waltzer mouse model (Pcdh15av; av; MGI:1856467); homozygous Ames waltzer mice are characterized by circling, head-tossing, hyperactivity, impaired swimming and profound deafness due to defects in the cochlea and degeneration of hair cells, spiral ganglion cells and saccular macula (5;10). In a second Pcdh15 mutant mouse model, Pcdh15av-3J (MGI:1856394), a spontaneous single-base insertion after base pair 4,521 in Pcdh15, was identified (5;15). The mutation results in a frameshift and a premature stop codon; the truncated protein lacks the cytoplasmic domain (5). The Pcdh15av-3J mouse exhibited circling, difficulty swimming, and deafness due to outer hair cell degeneration, disorganized reticular lamina, absent apical (lateral or tip) links, dissociated kinocilia from the stereociliary bundles, and distorted and irregular outer hair cell bundles within the organ of Corti (15-18). The findings from the Pcdh15av-3J mouse indicate that an intact cytoplasmic domain is necessary for the function of PCDH15 in hearing and vestibular function. 

Primers PCR Primer

Sequencing Primer

PCR program

1) 94°C 2:00
2) 94°C 0:30
3) 55°C 0:30
4) 72°C 1:00
5) repeat steps (2-4) 40x
6) 72°C 10:00
7) 4°C hold

The following sequence of 414 nucleotides is amplified (chromosome 10, + strand):

1   ggtacatgcc agaaaatgcc agatacaata taaaatattt tattcaatct cttgacatta
61  ggccatactt tattctttaa cactaatagt ttgaacattc tacaactagt gtataattga
121 attatgtttt cttctctgaa ggcaactgat cgagagggag atccaatcac atatgccatc
181 gagaatggag accctcagag agtttttaat ctttcagaaa cgtaagttac aagggaatga
241 tttatacttg atcacacccc tccctcctcc ccccaccgcc cctgttaatg tcaaacaaca
301 tgctgttagc aagaggatag actttcagct gtttgtagtt ttattttaca ttttttctat
361 gaatgttaat gagcactggg ggtaattcta aactcaaaac ctttccctgg agac

Primer binding sites are underlined and the sequencing primers are highlighted; the mutated nucleotide is shown in red.

  15. Cook, S., and Lane, P. (1993) Re-Mutation to Ames Waltzer. Mouse Genome. 91, 554.
Science Writers Anne Murray
Illustrators Katherine Timer
AuthorsLauren Prince, Jamie Russell, and Bruce Beutler