Phenotypic Mutation 'gasder'

• Allele: gasder
• Mutation Type: missense
• Chromosome: 15
• Coordinate: 75,736,206 bp (GRCm39)
• Base Change: T ⇒ C (forward strand)
• Gene: Gsdmd
• Gene Name: gasdermin D
• Synonym(s): Dfna5l, Gsdmdc1, 1810036L03Rik, DF5L, M2-4
• Chromosomal Location: 75,734,176-75,739,257 bp (+) (GRCm39)
• MGI Phenotype: FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Gasdermin D is a member of the gasdermin family. Members of this family appear to play a role in regulation of epithelial proliferation. Gasdermin D has been suggested to act as a tumor suppressor. Alternatively spliced transcript variants have been described. [provided by RefSeq, Oct 2009] ; PHENOTYPE: Mice homozygous for a knock-out allele are viable and grossly normal with no apparent defects in the development and maintenance of the intestinal epithelium. Mice homozygous for another null allele exhibit impaired induced pyroptosis and Il1b secretion. [provided by MGI curators]
• Mapped: Yes
• Amino Acid Change: Serine changed to Proline
• Institutional Source: Beutler Lab
• Gene Model: predicted gene model for protein(s): [ENSMUSP00000023238] [ENSMUSP00000155802] [ENSMUSP00000155766]
• AlphaFold: Q9D8T2
• SMART Domains: Protein: ENSMUSP00000023238; Gene: ENSMUSG00000022575; AA Change: S112P

Domain	Start	End	E-Value	Type
Pfam:Gasdermin	4	461	8.3e-175	PFAM
low complexity region	470	482	N/A	INTRINSIC

• Predicted Effect: probably damaging ; PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
  (Using ENSMUST00000023238)
• Predicted Effect: probably damaging ; PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
  (Using ENSMUST00000229331)
• Predicted Effect: probably benign
• Meta Mutation Damage Score: 0.8881
• Is this an essential gene?: Non Essential (E-score: 0.000)
• Phenotypic Category: Autosomal Recessive
• Mode of Inheritance: Autosomal Recessive
• Last Updated: 2019-09-04 9:41 PM by Anne Murray
• Record Created: 2016-11-17 1:15 PM by Hexin Shi
• Record Posted: 2018-11-16
• Science Writers: Anne Murray
• Illustrators: Diantha La Vine
• Authors: Hexin Shi and Bruce Beutler

Accession Number

NCBI RefSeq: NM_026960; MGI:1916396

Alleles Listed at MGI

All Mutations and Alleles(19) : Chemically induced (other)(3) Endonuclease-mediated(3) Gene trapped(6) Radiation induced(2) Targeted(5)

Phenotypic Description

Figure 1. Gasder mice exhibited decreased IL-1β secretion in response to priming with lipopolysaccharide (LPS) followed by nigericin treatment. IL-1β levels were determined by ELISA. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 2. Gasder mice exhibited decreased IL-1β secretion in response to priming with lipopolysaccharide (LPS) followed by flagellin treatment. IL-1β levels were determined by ELISA. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The gasder phenotype was identified among N-ethyl-N-nitrosourea (ENU)-mutagenized G3 mice of the pedigree R4920, some of which showed reduced inflammatory responses related to reduced secretion of the proinflammatory cytokine interleukin (IL)-1β in response to priming with lipopolysaccharide (LPS) followed by flagellin treatment (NLRC4 inflammasome; Figure 1) and to priming with lipopolysaccharide (LPS) followed by nigericin treatment (NLRP3 inflammasome; Figure 2).

Nature of Mutation

Figure 3. Linkage mapping of the reduced IL-1β secretion after flagellin stimulation using a recessive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 45 mutations (X-axis) identified in the G1 male of pedigree R4920. Normalized phenotype data are shown for single locus linkage analysis without consideration of G2 dam identity. Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 45 mutations. Both of the above phenotypes were linked by continuous variable mapping to two genes on chromosome 15: Dendd3 and Gsdmd. The mutation in Gsdmd was presumed causative, and is a T to C transition at base pair 75,864,357 (v38) on chromosome 15, or base pair 2,217 in the GenBank genomic region NC_000081 encoding Gsdmd. The strongest association was found with a recessive model of inheritance to the NLRC4 inflammasome phenotype, wherein seven variant homozygotes departed phenotypically from 13 homozygous reference mice and 10 heterozygous mice with a P value of 1.391 x 10^-9 (Figure 3).  

The mutation corresponds to residue 483 in the NM_026960 mRNA sequence in exon 3 of 11 total exons. 

466 GGTGGGGCTGCAGTGTCTGACAGTTCCAGTGCC 107 -G--G--A--A--V--S--D--S--S--S--A-

The mutated nucleotide is indicated in red. The mutation results in a serine (S) to proline (P) substitution at residue 112 (S112P) in the GSDMD protein, and is strongly predicted by PolyPhen-2 to be damaging (score = 1.000).

Protein Prediction

Figure 4. Domain organization of GSDMD. The location of the gasder mutation is indicated. Abbreviations: LH, linker helix; HR, helix repeat; β, intermediated β-strand insertion. Domain information is from SMART and UniProt.

Figure 5. Crystal structure of mouse GSDMA3. Subdomains of GSDMA-C are colored as GSDMD-C in Figure 4. UCSF Chimera model is based on PDB 5B5R, Ding, et al. Nature. 535, 111-116 (2016). Click on the 3D structure to view it rotate.

Gsdmd encodes gasdermin D (GSDMD; alternatively, DFNA5L), a member of the gasdermin (GSDM) protein family that also includes GSDMA, GSDMB, GSDMC, GSDME (alternatively, DFNA5), and DFNB59 (alternatively, pejvakin). Mice lack GSDMB, but have three GSDMA (GSDMA1–3; see the record Michelin for information about GSDMA3) and four GSDMC (GSDMC1–4) proteins. The GSDM proteins share approximately 45 percent overall sequence homology, and mouse GSDMD shares approximately 70 percent homology with GSDMA3.

The GSDM proteins contain a novel, roughly conserved region known as the DFNA5-GSDM domain, which includes most of the protein sequence, excluding the very N-terminus and approximately 25 amino acids at the C-terminus (1-3). Additionally, all GSDM proteins contain four conserved leucine-rich motifs at the N-terminus and five at the C-terminus with the last motif being the most highly conserved. The GSDM proteins have two putative leucine zippers at the C-terminus, indicating that they may participate in DNA binding.

GSDMD is cleaved by caspases (i.e., caspase-1, caspase-4, caspase-5, or caspase-11) after Asp276 (in mouse) to form a 31-kDa N-terminal fragment (GSDMD-N) and a 22-kDa C-terminal fragment (GSDMD-C) (Figure 4) (4-6). The C-terminus has an autoinhibitory effect on the intrinsic activity of the N-terminus [(7); reviewed in (8)]. The first loop of the C-terminus inserts into the N-terminal domain to help stabilize the conformation of full-length GSDMD; cleavage releases the GSDMD-N autoinhibition by GSDMD-C (7). GSDMD-N can form arc- and split-shaped oligomers that form dynamic structures, which transform into larger thermodynamically stable ring‐shaped oligomers (9;10). GSDMD-N exhibits intrinsic pyroptosis-inducing activity after inflammasome activation (6;11); the function of GSDMD-N is discussed in more detail in the “Background” section. The structure of GSDMD-N is unknown, but the highly homologous GSDMA3-N contains an extended twisted β-sheet formed by nine tandem β-strands (β3 to β11) [Figure 5; PDB:5B5R; (12)]. GSDMD-C forms a compact globular fold comprising 10 α-helices and two β-strands [PDB:5B5R, (12); PDB:5WQT, (7); and PDB:6AO4, (13)]. The GSDMD-C fragment has four subdomains: the linker helix, the helix repeat-I bundle (α2 to α5), the helix repeat repeat-II bundle (α6, α7, α9, and α10), and the intermediate β-strand insertion (α8) (7). The two helix repeats are composed of similar four-helix bundles, and the linker helix contacts the two helix repeats. A flexible loop (amino acids 276 to 287) located between the N-terminal domain and the linker helix, stretches out to the N-terminal pocket.

The gasder mutation results in a serine (S) to proline (P) substitution at residue 112 (S112P) in the GSDMD protein; amino acid 112 is within GSDMD-N.

Expression/Localization

GSDMD is widely expressed, with high expression in gastrointestinal tissue, skin, placenta, esophagus, and stomach as well as in human B- and T-lymphocyte lines, in various tumor tissues, and cancer cell lines (14;15).

GSDMD localizes to the cytosol (10). Upon inflammasome activation, GSDMD (namely GSDMD-N) translocates to the plasma membrane and GSDMD-C remains cytoplasmic.

Background

Figure 6. Caspases induce pyroptosis by generating GSDMD pores on the plasma membrane. The NLRP3 inflammasome is shown. NLRP3 is present in the cytosol in an inactive conformation state due to its association with the SGT1/HSP90 chaperone complex. The NLRP3 inflammasome is activated by a wide variety of agents. Several activators have been shown to generate pore formation by a pannexin hemichannel that may allow extracellular molecules access to the cytoplasm and contact with NLRP3. Extracellular ATP mediates inflammasome activation through the P2X7 ATP-gated ion channel, triggering rapid K⁺ efflux from the cell (decreased potassium (K⁺) concentration may favor inflammasome assembly). Rupture of lysosomes containing certain particulates releases Cathepsin B into the cytoplasm, activating the inflammasome. NLRP3 activators may also trigger inflammasome assembly by generating reactive oxygen species (ROS), often produced under situations of cellular stress. The inactive state of caspase-1 contains a CARD-containing prodomain. Oligomerization of NLRP3 and the recruitment of caspase-1, ASC, and CARDINAL leads to the autoproteolytic maturation of caspase-1. Caspase-1 is capable of cleaving pro-1L-1β, pro-IL-18, and pro-IL-33. These mature cytokines mediate a variety of biological effects by activating key processes such as the nuclear factor κB and mitogen-activated protein kinase (MAPK) pathways.   

Members of the NLR family, including NLRC4 (see the record for inwood), NLRP1b, and NLRP3 (see the record for ND1), oligomerize and assemble into large caspase-1-activating multiprotein complexes termed inflammasomes upon the detection of pathogenic or other danger signals (e.g., lipopolysaccharide, peptidoglycan, pathogenic bacteria, DNA, single-stranded (ss) RNA, double-stranded (ds) RNA, environmental irritants, and endogenous danger signals) in the cytoplasm (Figure 6). Activated caspase-1 is able to cleave a variety of substrates, most notably the proinflammatory cytokines IL-1β, IL-18, and IL-33 to generate biologically active proteins. In turn, these cytokines mediate a wide variety of biological effects associated with infection, inflammation, and autoimmune processes by activating key processes such as the nuclear factor κB (NF-κB; see the record for panr2) and mitogen-activated protein kinase (MAPK) pathways. Activation of caspase-1 also leads to pyroptosis, which is a form of programmed necrosis that involves pore formation, membrane rupture, and leakage of cytosolic contents.

GSDMD is a mediator of inflammasome-activated caspase 1-induced pyroptosis as well as IL-1β and IL-18 secretion (6;11;16-18). GSDMD-N binds to phosphatidylinositol phosphates (i.e., PtdIns3P, PtdIns4P, PtdIns5P, PtdIns(3,4)P₂, PtdIns(3,5)P₂, and PtdIns(3,4,5)P₃) and phosphatidylserine found in the inner leaflet of cell membranes as well as to cardolipin found in inner and outer leaflets of bacterial membranes (12;19). Binding of GSDMD to the membrane facilitates plasma membrane pore formation, allowing the release of IL-1β (19-21); GSDMD-associated IL-1β secretion is independent of pyroptosis (17;18;22). After recognition of viral/bacterial dsDNA, the AIM2 inflammasome causes GSDMD-mediated potassium efflux. The potassium efflux subsequently inhibits the dsDNA sensor cGAS-STING and prevents interferon production (23).

GSDMD also functions in the formation of neutrophil extracellular traps (NETs) during NETosis (24;25). NETosis is a form of neutrophil cell death that releases chromatin structures (i.e., the NETs) to the extracellular space, providing host defense against extracellular pathogens. The NETs capture microorganisms, activate myeloid cells, and promote coagulation (26). GSDMD is proteolytically activated by cleavage at Cys268 by neutrophil proteases (e.g., neutrophil elastase; see the record for Elane) during NETosis, which subsequently affects protease activation and nuclear expansion (27;28).

Putative Mechanism

Figure 7. Activation of the NLRC4 inflammasome. Infection of macrophages with various gram-negative bacteria activates caspase-1 via NLRC4. A critical step is the cytosolic delivery of flagellin or proteins through the bacterial T3SS or T4SS. Flagellin is recognized by Naip5 or Naip6,  whereas rod proteins are recognized by Naip2. S. flexneri activates the NLRC4 inflammasome independently of flagellin through IpaB. Activation of caspase-1 via NLRC4 leads to the processing and release of IL-1β and IL-18, the processing of caspase-7, and pyroptosis. This image is interactive. Other mutations associated with the NLRC4 inflammasome pathway are noted in red. Click on each mutation for more information.

The NLRC4 inflammasome stimulates caspase-1 activation and subsequent IL-1β secretion from macrophages after exposure to lipopolysaccharide, peptidoglycan, and pathogenic bacteria (e.g., Aeromonas veronii, Escherichia coli, Listeria monocytogenes, Pseudomonas aeruginosa, Salmonella enterica serovar typhimurium (S. typhimurium), and Yersinia species) (29) (Figure 7).  In contrast to NLRP3-associated caspase-1 activation, which predominantly results in the processing and secretion of IL-1β and IL-18 without necessarily resulting in cell death, NLRC4-mediated activation of caspase-1 often results in cell death [reviewed in (30)]. For more information about the NLRC4-associated inflammasome, please see the record for inwood.

Gsdmd-deficient mouse bone marrow-derived macrophages exhibited resistance to LPS- and inflammasome-induced pyroptosis induction as well as reduced release of IL-1β (6;9). The phenotype of the gasder mice mimics that of the Gsdmd-deficient mouse, indicating loss of GSDMD-associated function.

Primers

PCR Primer
gasder_pcr_F: AGTCCTTTAAAGGTCCCATCAC
gasder_pcr_R: CCCTCATTCAGTGCTGAGAG

Sequencing Primer
gasder_seq_F: TTTAAAGGTCCCATCACTACAGAGG
gasder_seq_R: CATTCAGTGCTGAGAGATACTGCC

Genotyping

PCR program

1) 94°C 2:00
2) 94°C 0:30
3) 55°C 0:30
4) 72°C 1:00
5) repeat steps (2-4) 40x
6) 72°C 10:00
7) 4°C hold

The following sequence of 400 nucleotides is amplified (chromosome 15, + strand):

1   agtcctttaa aggtcccatc actacagagg aaagacaagg cagtggctcc tggactagga
61  ccttagagct ggtctcgttt tagaaccgga gtgttttggc tccttcaaag tctctgatgt
121 cgtcgatggg aacattcagg gcagagtgat gttgtcaggc atgggagaag ggaaaatttc
181 tggtggggct gcagtgtctg acagttccag tgcctccatg aatgtgtgta tactgcgtgt
241 gactcagaag acctgggaga ccatgcagca tgaaaggtga gcccctgaag ggaaggcatg
301 ccgcttccct taccttgagc agccgtgctt ctagggagcg ttgctgggtt gtgggcatca
361 gaagggttct gaggcagtat ctctcagcac tgaatgaggg 

Primer binding sites are underlined and the sequencing primers are highlighted; the mutated nucleotide is shown in red.

References

  1. Runkel, F., Marquardt, A., Stoeger, C., Kochmann, E., Simon, D., Kohnke, B., Korthaus, D., Wattler, F., Fuchs, H., Hrabe de Angelis, M., Stumm, G., Nehls, M., Wattler, S., Franz, T., and Augustin, M. (2004) The Dominant Alopecia Phenotypes Bareskin, Rex-Denuded, and Reduced Coat 2 are Caused by Mutations in Gasdermin 3. Genomics. 84, 824-835.

  2. Van Laer, L., Huizing, E. H., Verstreken, M., van Zuijlen, D., Wauters, J. G., Bossuyt, P. J., Van de Heyning, P., McGuirt, W. T., Smith, R. J., Willems, P. J., Legan, P. K., Richardson, G. P., and Van Camp, G. (1998) Nonsyndromic Hearing Impairment is Associated with a Mutation in DFNA5. Nat Genet. 20, 194-197.

  3. Delmaghani, S., del Castillo, F. J., Michel, V., Leibovici, M., Aghaie, A., Ron, U., Van Laer, L., Ben-Tal, N., Van Camp, G., Weil, D., Langa, F., Lathrop, M., Avan, P., and Petit, C. (2006) Mutations in the Gene Encoding Pejvakin, a Newly Identified Protein of the Afferent Auditory Pathway, Cause DFNB59 Auditory Neuropathy. Nat Genet. 38, 770-778.

  4. Rathkey, J. K., Benson, B. L., Chirieleison, S. M., Yang, J., Xiao, T. S., Dubyak, G. R., Huang, A. Y., and Abbott, D. W. (2017) Live-Cell Visualization of Gasdermin D-Driven Pyroptotic Cell Death. J Biol Chem. 292, 14649-14658.

  5. Yang, J., Liu, Z., Wang, C., Yang, R., Rathkey, J. K., Pinkard, O. W., Shi, W., Chen, Y., Dubyak, G. R., Abbott, D. W., and Xiao, T. S. (2018) Mechanism of Gasdermin D Recognition by Inflammatory Caspases and their Inhibition by a Gasdermin D-Derived Peptide Inhibitor. Proc Natl Acad Sci U S A. 115, 6792-6797.

  6. Kayagaki, N., Stowe, I. B., Lee, B. L., O'Rourke, K., Anderson, K., Warming, S., Cuellar, T., Haley, B., Roose-Girma, M., Phung, Q. T., Liu, P. S., Lill, J. R., Li, H., Wu, J., Kummerfeld, S., Zhang, J., Lee, W. P., Snipas, S. J., Salvesen, G. S., Morris, L. X., Fitzgerald, L., Zhang, Y., Bertram, E. M., Goodnow, C. C., and Dixit, V. M. (2015) Caspase-11 Cleaves Gasdermin D for Non-Canonical Inflammasome Signalling. Nature. 526, 666-671.

  7. Kuang, S., Zheng, J., Yang, H., Li, S., Duan, S., Shen, Y., Ji, C., Gan, J., Xu, X. W., and Li, J. (2017) Structure Insight of GSDMD Reveals the Basis of GSDMD Autoinhibition in Cell Pyroptosis. Proc Natl Acad Sci U S A. 114, 10642-10647.

  8. Qiu, S., Liu, J., and Xing, F. (2017) 'Hints' in the Killer Protein Gasdermin D: Unveiling the Secrets of Gasdermins Driving Cell Death. Cell Death Differ. 24, 588-596.

  9. Mulvihill, E., Sborgi, L., Mari, S. A., Pfreundschuh, M., Hiller, S., and Muller, D. J. (2018) Mechanism of Membrane Pore Formation by Human Gasdermin-D. EMBO J. 37, 10.15252/embj.201798321. Epub 2018 Jun 13.

  10. Chen, X., He, W. T., Hu, L., Li, J., Fang, Y., Wang, X., Xu, X., Wang, Z., Huang, K., and Han, J. (2016) Pyroptosis is Driven by Non-Selective Gasdermin-D Pore and its Morphology is Different from MLKL Channel-Mediated Necroptosis. Cell Res. 26, 1007-1020.

  11. Shi, J., Zhao, Y., Wang, K., Shi, X., Wang, Y., Huang, H., Zhuang, Y., Cai, T., Wang, F., and Shao, F. (2015) Cleavage of GSDMD by Inflammatory Caspases Determines Pyroptotic Cell Death. Nature. 526, 660-665.

  12. Ding, J., Wang, K., Liu, W., She, Y., Sun, Q., Shi, J., Sun, H., Wang, D. C., and Shao, F. (2016) Pore-Forming Activity and Structural Autoinhibition of the Gasdermin Family. Nature. 535, 111-116.

  13. Liu, Z., Wang, C., Rathkey, J. K., Yang, J., Dubyak, G. R., Abbott, D. W., and Xiao, T. S. (2018) Structures of the Gasdermin D C-Terminal Domains Reveal Mechanisms of Autoinhibition. Structure. 26, 778-784.e3.

  14. Katoh, M., and Katoh, M. (2004) Identification and Characterization of Human DFNA5L, Mouse Dfna5l, and Rat Dfna5l Genes in Silico. Int J Oncol. 25, 765-770.

  15. Saeki, N., Usui, T., Aoyagi, K., Kim, D. H., Sato, M., Mabuchi, T., Yanagihara, K., Ogawa, K., Sakamoto, H., Yoshida, T., and Sasaki, H. (2009) Distinctive Expression and Function of Four GSDM Family Genes (GSDMA-D) in Normal and Malignant Upper Gastrointestinal Epithelium. Genes Chromosomes Cancer. 48, 261-271.

  16. He, W. T., Wan, H., Hu, L., Chen, P., Wang, X., Huang, Z., Yang, Z. H., Zhong, C. Q., and Han, J. (2015) Gasdermin D is an Executor of Pyroptosis and Required for Interleukin-1beta Secretion. Cell Res. 25, 1285-1298.

  17. Evavold, C. L., Ruan, J., Tan, Y., Xia, S., Wu, H., and Kagan, J. C. (2018) The Pore-Forming Protein Gasdermin D Regulates Interleukin-1 Secretion from Living Macrophages. Immunity. 48, 35-44.e6.

  18. Heilig, R., Dick, M. S., Sborgi, L., Meunier, E., Hiller, S., and Broz, P. (2018) The Gasdermin-D Pore Acts as a Conduit for IL-1beta Secretion in Mice. Eur J Immunol. 48, 584-592.

  19. Liu, X., Zhang, Z., Ruan, J., Pan, Y., Magupalli, V. G., Wu, H., and Lieberman, J. (2016) Inflammasome-Activated Gasdermin D Causes Pyroptosis by Forming Membrane Pores. Nature. 535, 153-158.

  20. Sborgi, L., Ruhl, S., Mulvihill, E., Pipercevic, J., Heilig, R., Stahlberg, H., Farady, C. J., Muller, D. J., Broz, P., and Hiller, S. (2016) GSDMD Membrane Pore Formation Constitutes the Mechanism of Pyroptotic Cell Death. EMBO J. 35, 1766-1778.

  21. Aglietti, R. A., Estevez, A., Gupta, A., Ramirez, M. G., Liu, P. S., Kayagaki, N., Ciferri, C., Dixit, V. M., and Dueber, E. C. (2016) GsdmD p30 Elicited by Caspase-11 during Pyroptosis Forms Pores in Membranes. Proc Natl Acad Sci U S A. 113, 7858-7863.

  22. Kuriakose, T., and Kanneganti, T. D. (2018) Gasdermin D Flashes an Exit Signal for IL-1. Immunity. 48, 1-3.

  23. Banerjee, I., Behl, B., Mendonca, M., Shrivastava, G., Russo, A. J., Menoret, A., Ghosh, A., Vella, A. T., Vanaja, S. K., Sarkar, S. N., Fitzgerald, K. A., and Rathinam, V. A. K. (2018) Gasdermin D Restrains Type I Interferon Response to Cytosolic DNA by Disrupting Ionic Homeostasis. Immunity. 49, 413-426.e5.

  24. Sollberger, G., Choidas, A., Burn, G. L., Habenberger, P., Di Lucrezia, R., Kordes, S., Menninger, S., Eickhoff, J., Nussbaumer, P., Klebl, B., Kruger, R., Herzig, A., and Zychlinsky, A. (2018) Gasdermin D Plays a Vital Role in the Generation of Neutrophil Extracellular Traps. Sci Immunol. 3, 10.1126/sciimmunol.aar6689.

  25. Chen, K. W., Monteleone, M., Boucher, D., Sollberger, G., Ramnath, D., Condon, N. D., von Pein, J. B., Broz, P., Sweet, M. J., and Schroder, K. (2018) Noncanonical Inflammasome Signaling Elicits Gasdermin D-Dependent Neutrophil Extracellular Traps. Sci Immunol. 3, 10.1126/sciimmunol.aar6676.

  26. Jorch, S. K., and Kubes, P. (2017) An Emerging Role for Neutrophil Extracellular Traps in Noninfectious Disease. Nat Med. 23, 279-287.

  27. Brinkmann, V., Reichard, U., Goosmann, C., Fauler, B., Uhlemann, Y., Weiss, D. S., Weinrauch, Y., and Zychlinsky, A. (2004) Neutrophil Extracellular Traps Kill Bacteria. Science. 303, 1532-1535.

  28. Kambara, H., Liu, F., Zhang, X., Liu, P., Bajrami, B., Teng, Y., Zhao, L., Zhou, S., Yu, H., Zhou, W., Silberstein, L. E., Cheng, T., Han, M., Xu, Y., and Luo, H. R. (2018) Gasdermin D Exerts Anti-Inflammatory Effects by Promoting Neutrophil Death. Cell Rep. 22, 2924-2936.

  29. Damiano, J. S., Newman, R. M., and Reed, J. C. (2004) Multiple Roles of CLAN (Caspase-Associated Recruitment Domain, Leucine-Rich Repeat, and NAIP CIIA HET-E, and TP1-Containing Protein) in the Mammalian Innate Immune Response. J Immunol. 173, 6338-6345.

  30. Sutterwala, F. S., and Flavell, R. A. (2009) NLRC4/IPAF: A CARD Carrying Member of the NLR Family. Clin Immunol. 130, 2-6.