Phenotypic Mutation 'surface2' (pdf version)
List |< first << previous [record 50 of 74] next >> last >|
Allelesurface2
Mutation Type critical splice donor site
Chromosome12
Coordinate113,416,041 bp (GRCm38)
Base Change A ⇒ G (forward strand)
Gene Ighd
Gene Name immunoglobulin heavy constant delta
Synonym(s) IgD
Chromosomal Location 113,406,604-113,416,324 bp (-)
MGI Phenotype PHENOTYPE: Homozygotes for a null allele show delayed antibody affinity maturation and reduced IgE levels. Homozygotes for another null allele show 30-50% less B cells in spleen and lymph nodes, reduced IgG2b levels, and increased IgA levels. Homozygotes for an ENU-induced allele show shifted IgD expression. [provided by MGI curators]
Accession Number

MGI:96447

Mapped Yes 
Limits of the Critical Region 113406604 - 113416324 bp
Amino Acid Change
Institutional SourceBeutler Lab
Gene Model predicted gene model for protein(s):
Phenotypic Category
Phenotypequestion? Literature verified References
FACS IgD MFI - decreased
TLR signaling defect: hypersensitivity to LPS
TLR signaling defect: TNF production by macrophages
Penetrance  
Alleles Listed at MGI

All Mutations and Alleles(5) : Chemically induced (ENU)(1) Targeted(2) Transgenic (2)

Lab Alleles
AlleleSourceChrCoordTypePredicted EffectPPH Score
Surface UTSW 12 113416199 missense probably benign 0.01
R4703:Ighd UTSW 12 113416041 critical splice donor site probably benign
R4792:Ighd UTSW 12 113416199 missense probably benign 0.01
R5087:Ighd UTSW 12 113414427 unclassified probably benign
R5821:Ighd UTSW 12 113409633 missense probably benign 0.02
Mode of Inheritance Autosomal Recessive
Local Stock
Repository
Last Updated 2018-02-02 10:32 AM by Anne Murray
Record Created 2016-11-29 8:22 PM by Jin Huk Choi
Record Posted 2017-01-31
Phenotypic Description

Figure 1. Surface2 mice exhibit decreased expression of IgD on peripheral B cells. Flow cytometric analysis of peripheral blood was utilized to determine IgD mean fluorescence intensity. Raw data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 2. Surface2 mice exhibit decreased percentages of peripheral IgD+ B cells. Flow cytometric analysis of peripheral blood was utilized to determine B cell frequencies. Raw data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The surface2 phenotype was identified among N-ethyl-N-nitrosourea (ENU)-mutagenized G3 mice of the pedigree R4703, some of which showed reduced expression of IgD on B cells in the peripheral blood (Figure 1) as well as reduced percentages of IgD+ B cells in the peripheral blood (Figure 2).

Nature of Mutation

Figure 3. Linkage mapping of the reduced IgD+ B cell percentage using an additive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 94 mutations (X-axis) identified in the G1 male of pedigree R4703.  Raw phenotype data are shown for single locus linkage analysis without consideration of G2 dam identity.  Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 94 mutations. Both of the above phenotypes were linked by continuous variable mapping to a mutation in Ighd:  an A to G transition at base pair 113,416,041 (v38) on chromosome 12, or base pair 284 in the GenBank genomic region NC_000078 encoding Ighd. The strongest association was found with an additive model of inheritance to the IgD+ B cell percentage, wherein three variant homozygotes departed phenotypically from 20 homozygous reference mice and 25 heterozygous mice with a P value of 1.751 x 10-5 (Figure 3).  

 

The effect of the mutation at the cDNA and protein level have not examined, but the mutation is predicted to result in skipping of the 282-nucleotide exon 1 (out of 5 total exons). The next available start codon is in exon 2 (highlighted below).

 
             <--exon 1 intron 1-->         exon 2-->             <--exon 5
267 ……CCTTTCAAGTTTCCTG gtgagtatccctggacc…… GGGCCATGGCACCC……ATCAAGGTGAAGTAG…… 8790

89  ……-P--F--K--F--P--                     G--A--M--A--P-……-I--K--V--K--*-   290

 

Genomic numbering corresponds to NC_000078. The donor splice site of intron 1, which is destroyed by the surface2 mutation, is indicated in blue lettering and the mutated nucleotide is indicated in red. The new putative start codon is highlighted.

Protein Prediction
Figure 4. Domain structure of Cδ. Mouse IgD heavy chain has two Ig-like domains (CH1 and CH2). The two CH domains are connected through a flexible hinge region. The transmembrane domain is indicated. The surface2 mutation is indicated. This image is interactive; click to view other mutations and click the mutations to view more information.

Ighd encodes immunoglobulin heavy chain constant delta (Cδ). Immunoglobulin heavy chain genes have a variable domain and a constant region. Mouse IgD heavy chain has two Ig-like domains (CH1 and CH2, respectively) at the N-terminus and a transmembrane domain (Figure 4). The two CH domains are connected through a flexible hinge region. The intracellular tail of the membrane-bound IgD consists of three amino acids: Lys-Val-Lys (KVK).

 

The surface2 mutation is predicted to result in deletion of exon 1. Deletion of exon 1 would cause an in-frame deletion of the amino acids encoded therein, which comprise the CH1 domain.

Putative Mechanism

Upon maturation into circulating follicular B cells, B cells coexpress both IgM and IgD. Upon B cell activation by antigens and helper T cells, the B cells undergo isotype switching and lose IgM and IgD, switching to express the same variable domain linked to IgG, IgA, or IgE constant region domains. Isotype switching involves DNA recombination of the Ig heavy chain locus, Igh, and subsequent deletion of Ighm and Ighd constant region exons and the reorganization of the IghgIghe, or Igha constant region exons immediately 3’ to the VDJH variable exon. The VDJH exon is then spliced to IgG, IgE, or IgA constant region exons in the mRNA (1;2). B cells induce numerous responses to microbial infections, including antigen internalization, proliferation, T cell-independent antibody production, and the T cell-dependent antibody response. These responses are initiated upon antigen binding by the BCR, which rapidly recruits a signaling complex through interactions with Src family kinases (SFK) and the tyrosine kinase Syk (see the record for poppy). BCR engagement also activates pathways regulated by PKCβ (see Untied), PI-3K, and Ras/MAPK, which further modulate B cell responses [see (3;4for reviews of B cell antigen receptor signaling]. For more information about BCR-associated signaling, please see the record for crab. IgD is a potent inducer of TNF, IL1B, and IL1RN. IgD also induces release of IL-6, IL-10, and LIF from peripheral blood mononuclear cells. 

 

IgD-deficient mice have normal frequencies of B cells in the lymph node and spleen (5). A second study found that IgD-deficient mice exhibited 30 to 50% less B cells in the spleen and lymph nodes, but had a normal pre-B cell compartment (6). The loss of IgD expression resulted in an increase in IgM expression and comparable amounts of surface Ig expressed on B cells (5;6). T cell frequency and the ratio of CD4 to CD8 T cells in the IgD-deficient mice were normal (5). The IgD-deficient mice respond efficiently to both T-dependent and T-independent antigens (5;6). Affinity maturation of serum antibodies was delayed in the IgD-deficient mice (5).

Primers PCR Primer
surface2(F):5'- GTGTTGATGAAGCAGCTGAG -3'
surface2(R):5'- TCCTCTCAGAGTGCAAAGCC -3'

Sequencing Primer
surface2_seq(F):5'- TGTTGATGAAGCAGCTGAGAAAAG -3'
surface2_seq(R):5'- TTGGAAGTCAGCCACTGAAAATC -3'
References
Science Writers Anne Murray
Illustrators Katherine Timer
AuthorsMing Zeng, Xue Zhong, Jin Huk Choi, and Bruce Beutler
List |< first << previous [record 50 of 74] next >> last >|