Phenotypic Mutation 'Messi' (pdf version)
List |< first << previous [record 89 of 132] next >> last >|
AlleleMessi
Mutation Type nonsense
Chromosome18
Coordinate46,560,922 bp (GRCm38)
Base Change T ⇒ A (forward strand)
Gene Ticam2
Gene Name toll-like receptor adaptor molecule 2
Synonym(s) Tirp, TRAM
Chromosomal Location 46,559,155-46,574,533 bp (-)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] TIRP is a Toll/interleukin-1 receptor (IL1R; MIM 147810) (TIR) domain-containing adaptor protein involved in Toll receptor signaling (see TLR4; MIM 603030).[supplied by OMIM, Apr 2004]
PHENOTYPE: Homozygous inactivation of this gene affects TLR4-mediated immune responses. [provided by MGI curators]
Accession Number

NCBI RefSeq: NM_173394; MGI:3040056

Mapped Yes 
Amino Acid Change Lysine changed to Stop codon
Institutional SourceBeutler Lab
Gene Model predicted gene model for protein(s): [ENSMUSP00000043660] [ENSMUSP00000066239]
SMART Domains Protein: ENSMUSP00000066239
Gene: ENSMUSG00000056130
AA Change: K33*

DomainStartEndE-ValueType
Pfam:TIR_2 78 192 2e-10 PFAM
Predicted Effect probably null
Phenotypic Category
Phenotypequestion? Literature verified References
TLR signaling defect: hyposensitivity to LPS
TLR signaling defect: hyposensitivity to R848
TLR signaling defect: TNF production by macrophages
Penetrance  
Alleles Listed at MGI

All mutations/alleles(6) : Chemically induced(ENU)(1) Targeted(5)

Lab Alleles
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00587:Ticam2 APN 18 46560813 missense probably benign 0.04
Branch UTSW 18 46560651 missense probably damaging 1.00
Consequential UTSW 18 46560779 missense probably damaging 1.00
R0056:Ticam2 UTSW 18 46560334 missense possibly damaging 0.61
R0056:Ticam2 UTSW 18 46560334 missense possibly damaging 0.61
R0666:Ticam2 UTSW 18 46560651 missense probably damaging 1.00
R1676:Ticam2 UTSW 18 46560610 missense probably damaging 1.00
R2209:Ticam2 UTSW 18 46560400 missense probably damaging 1.00
R4927:Ticam2 UTSW 18 46560779 missense probably damaging 1.00
R4928:Ticam2 UTSW 18 46560922 nonsense probably null
R6841:Ticam2 UTSW 18 46560931 missense probably benign 0.02
Mode of Inheritance Autosomal Semidominant
Local Stock
Repository
Last Updated 2017-09-08 7:35 PM by Diantha La Vine
Record Created 2016-12-03 1:33 PM
Record Posted 2017-03-31
Phenotypic Description
Figure 1. Messi mice exhibited decreased TNFα secretion in response to the TLR4 ligand, LPS. TNFα levels were determined by ELISA. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The Messi phenotype was identified among ENU-mutagenized G3 mice of the pedigree R4928, some of which exhibited decreased TNFα secretion in response to the Toll-like receptor 4 (TLR4) ligand, LPS (Figure 1).

Nature of Mutation

Figure 2. Linkage mapping of the reduced TNFα secretion after LPS stimulation using an additive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 122 mutations (X-axis) identified in the G1 male of pedigree R4928. Normalized phenotype data are shown for single locus linkage analysis without consideration of G2 dam identity.  Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 122 mutations. Both of the above anomalies were linked by continuous variable mapping to a mutation in Ticam2:  an A to T transversion at base pair 46,560,922 (v38) on chromosome 18, or base pair 13,612 in the GenBank genomic region NC_000084 encoding Ticam2.  The strongest association was found with an additive model of linkage to the normalized TLR4 response to LPS, wherein four variant homozygotes and 10 heterozygotes departed phenotypically from six homozygous reference mice with a P value of 1.04 x 10-4 (Figure 2). 

 

The mutation corresponds to residue 573 in the mRNA sequence NM_173394 within exon 3 of 3 total exons.


 

558 CATGAGTCAGACTCCAAGAATTCTGAGGAAGCC

28  -H--E--S--D--S--K--N--S--E--E--A-

 

The mutated nucleotide is indicated in red.  The mutation results in substitution of lysine (K) 33 to a premature stop codon (K33*) in the TRAM protein.

Protein Prediction

Figure 3. Domain structure of TRAM.  The Toll/IL-1 receptor (TIR) domain is shown.  The Messi mutation is substitution of lysine 33 to a premature stop codon. 

Ticam2 [Toll-interleukin 1 receptor (TIR) domain-containing adaptor molecule-2; also TRAM (Trif-related adaptor molecule)] is a 232 amino acid protein adaptor in TLR4 signaling (Figure 3). TRAM contains a central Toll/IL-1 receptor (TIR) domain (amino acids 78-222), a conserved region of approximately 200 amino acids which mediates homo- and heterotypic protein interactions during signal transduction (1;2). The Messi mutation results in substitution of lysine (K) 33 to a premature stop codon (K33*); residue 33 is within an undefined N-terminal region of TRAM upstream of the TIR domain.

 

For more information about Ticam2, please see the record for Branch.

Putative Mechanism

The twelve mouse TLRs and ten human TLRs recognize a wide range of structurally distinct molecules, and all signal through only four adaptor proteins known to date: MyD88, Tirap (Mal; see the record for torpid), TICAM-1 (TRIF) and TRAM (3). TLR signaling through these adaptors initiates a cascade of signaling events involving various kinases, adaptors and ubiquitin ligases, ultimately leading to transcriptional activation of cytokine [e.g., TNF-α, interleukin (IL)-1, IL-6] and other genes through the transcription factors NF-κB, AP-1, interferon responsive factor (IRF)-3, and IRF-7. TRAM activates NF-κB, IRF-3 and IRF-7 downstream of TLR4 (2;4). The diminished response to LPS indicates loss of TRAM function.

Primers PCR Primer
Messi(F):5'- TCGGTGTCATCTTCTGCATG -3'
Messi(R):5'- TCTGGCAGCCTTTGTGAAGC -3'

Sequencing Primer
Messi_seq(F):5'- CTGCATGAAGTATCACAAATTTGAGG -3'
Messi_seq(R):5'- CTAGATAAGTGCCCCCTTT -3'
Genotyping

Genotyping is performed by amplifying the region containing the mutation using PCR, followed by sequencing of the amplified region to detect the mutation.
 

PCR Primers

R49280122_PCR_F: 5’- TCGGTGTCATCTTCTGCATG-3’

R49280122_PCR_R: 5’- TCTGGCAGCCTTTGTGAAGC-3’

 

Sequencing Primers

R49280122_SEQ_F: 5’- CTGCATGAAGTATCACAAATTTGAGG-3’
 

R49280122_SEQ_R: 5’- CTAGATAAGTGCCCCCTTT-3’
 

 

PCR program

1) 94°C             2:00

2) 94°C             0:30

3) 55°C             0:30

4) 72°C             1:00

5) repeat steps (2-4) 40X

6) 72°C             10:00

7) 4°C               hold

 

The following sequence of 531 nucleotides is amplified (NCBI RefSeq: NC_000084):

 

13247                                                   tctg gcagcctttg    

13261 tgaagctcaa aaaaaagtct gatagtttgg ttccttggtt ggctgccatt tctttatatt    

13321 atggtctttt tgaggatttg ggggtttttc ttgggggggg gttgattgtt ttttgtttca    

13381 gtttgaacaa aagttttttt tttttctttt aaatgctttg attgaacaaa taaaattctg    

13441 ccttgaaatt ttccttttca gattgaaaag aaaaatactc aaataaagct ccctcgtctg    

13501 ccccaccact ctgtcatggg tgttgggaag tctaaactag ataagtgccc cctttcttgg    

13561 cataaaaaag acagtgtgga tgccgatcaa gacggccatg agtcagactc caagaattct    

13621 gaggaagcct gcttgcgtgg ttttgtggag cagagcagtg gatcagagcc accaacagga    

13681 gagcaggacc aacctgaggc aaagggggcg gggcctgagg agcaagatga agaagagttc

13741 ctcaaatttg tgatacttca tgcagaagat gacaccga

 

Primer binding sites are underlined and the sequencing primer is highlighted; the mutated nucleotide is shown in red text (Chr. (+) = T>A; sense strand = A>T).

References
Science Writers Anne Murray
Illustrators Katherine Timer
AuthorsCristhiaan D. Ochoa, Hexin Shi, Ying Wang, Xue Zhong, Lei Sun, Jianhui Wang, Braden Hayse, and Bruce Beutler
List |< first << previous [record 89 of 132] next >> last >|