Phenotypic Mutation 'Dalmatian' (pdf version)
Gene Symbol Sox10
Gene Name SRY-box containing gene 10
Synonym(s) Dom, Sox21
Accession Number

NCBI RefSeq: NM_011437; MGI: 98358

Allele Dalmatian
Institutional SourceBeutler Lab
Mapped Yes 
Chromosome 15
Chromosomal Location 79,154,913-79,164,490 bp (-)
Type of Mutation MISSENSE
DNA Base Change
(Sense Strand)
T to G at 79,163,324 bp (GRCm38)
Amino Acid Change Asparagine changed to Lysine
Ref Sequences
N131K in NCBI: NP_035567.1 (fasta)
SMART Domains

DomainStartEndE-ValueType
Pfam:Sox_N 11 94 7.5e-22 PFAM
HMG 103 173 8.16e-27 SMART
low complexity region 183 205 N/A INTRINSIC
low complexity region 238 245 N/A INTRINSIC
low complexity region 310 332 N/A INTRINSIC
Predicted Effect probably damaging

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
(Using NCBI: NP_035567.1)
Phenotypic Category pigmentation, skin/coat/nails
Penetrance 100% 
Alleles Listed at MGI

All alleles(9) : Targeted, other(5) Spontaneous(1) Chemically induced(1) Radiation induced(2)

Lab Alleles APN: IGL01693:Sox10
UTSW: Kat, R0479:Sox10, R0589:Sox10, R0624:Sox10, R0679:Sox10, R0835:Sox10, R1517:Sox10, X0062:Sox10
Mode of Inheritance Autosomal Dominant
Local Stock Embryos, Sperm, gDNA
Repository

MMRRC: 030336-UCD

Last Updated 01/31/2014 8:58 AM by Peter Jurek
Record Created unknown
Record Posted 03/18/2008
Phenotypic Description
Heterozygous Dalmatian animals exhibit a classical piebald black and white coat (Figure 1).  Dalmatian animals show normal immune responses to infection by mouse cytomegalovirus (MCMV; MCMV Susceptibility and Resistance Screen), and exhibit normal Toll-like receptor (TLR) signal transduction as measured by TNF production (TLR Signaling Screen).
 
It is unknown whether homozygous Dalmatian mutants are viable. Heterozygotes are viable and fertile with no gross abnormalities.  Unlike Sox10Dom heterozygous animals (1-3), Dalmatian heterozygotes do not have a reduction in lifespan, but animals have not been examined for all known Sox10 mutant phenotypes, including deficits of hearing, central or peripheral demyelination, or enlargement of the colon (see Background).
Nature of Mutation
The Dalmatian mutation was mapped to Chromosome 15, and corresponds to a T to G transversion at position 680 of the Sox10 transcript, in exon 2 of 4 total exons.
 
663 TACCCTCACCTCCACAATGCTGAGCTCAGCAAG
126 -Y--P--H--L--H--N--A--E--L--S--K-
 
The mutated nucleotide is indicated in red lettering and results in a conversion of asparagine to lysine at residue 131 of the SOX10 protein.
Protein Prediction

Figure 2. Domain structure of SOX10. The position of the Dalmatian mutation is indicated and results in a conversion of asparagine to lysine. HMG, High mobility group; TAD, Transcription-activation domain.

Figure 3. Crystal structure of the SOX2b HMG domain interacting with DNA. The location of the Dalmatian mutation is indicated. UCSF Chimera model is based on PDB 1O4X, Williams et al., J. Biol. Chem. 279, 1449-1457 (2004). Click on the 3D structure to view it rotate.
The Sox10 gene, like its human orthologue which has been mapped to 22q13, encodes a 466 residue transcription factor.  The human and mouse SOX10 proteins are 98% identical (4).
 
SOX10 is a member of a superfamily of proteins that contain DNA-binding HMG (high-mobility-group) domains (Figure 2).  There is little sequence conservation throughout the superfamily but the HMG domain can be highly conserved within subgroups, as it is in the SOX proteins (5).  SOX (Sry-box) family members were identified because of the resemblance of their HMG domains to that of the male sex determination factor, Sry (5;6).  The SOX family of proteins is also subdivided into additional groups based on sequence identity and biochemical characteristics.  SOX10 belongs to the SOXE subfamily that also includes SOX8, and SOX9.  Similarities among subfamily members include exon/intron structure, extensive sequence conservation at the nucleotide and amino acid sequence level, and a transcription-activation domain located at the C-terminus, encompassing amino acids 377-466 for SOX10 (4-6).  The C-terminal transactivation domain is rich in serines, prolines, and glutamines (4).
 
The HMG box of all SOX proteins contains three α-helical regions arranged in a twisted L shape. Helices I and II are positioned in an antiparallel mode and form one arm of the HMG box.  Helix III is less rigid, and makes an average angle of about 90° with helices I and II (Figure 3; PDB ID 1O4X).  The L-shaped structure is maintained by a cluster of conserved, mainly aromatic amino acids (7-9).  The HMG domain presents its concave surface to the minor groove of DNA, thus allowing sequence-specific recognition.  Binding of the HMG box induces a strong bend in the DNA of 70-85°(7-11).  Because of its ability to influence the structure of bound DNA by organizing local chromatin structure and assembling other transcription factors into biologically active sterically defined complexes, proteins with HMG boxes are believed to exert at least part of their function as architectural proteins (5;12).  In the SOX10 protein, the HMG domain is located in amino acids 101-182 (4).  All SOX proteins have two conserved nuclear localization signals (NLS) located at the N and C termini of the HMG domain, which are a bipartite NLS motif and a basic cluster NLS motif, respectively.  Amino acids in these domains important for nuclear localization also participate in DNA binding (13).  The SOXE proteins are known to bind DNA as monomers, but do form cooperative dimers upon binding to adjacent recognition sites in DNA, with protein:protein interaction mediated by a conserved region situated in front of the HMG box, spanning amino acids 61-100 for SOX10.  These residues cooperate with the HMG domain during dimeric binding in a manner dependent on specific determinants within the first two α-helices of the HMG domain (11;14).  The SOXE proteins also have a nuclear export signal present in the HMG domain, and shuttling of SOX10 to and from the nucleus is apparently necessary for SOX10-mediated transactivation (15).  The first 60 amino acids of SOX10 are unique but may be important for cooperative interaction with other transcription factors, such as the POU domain protein Tst-1/Oct6/SCIP, which is coexpressed with SOX10 in developing Schwann cells (16;17).  In the case of synergy with the paired homeodomain protein PAX3, it is the HMG domain of SOX10 that physically interacts with the PAX3 transcription factor (18).
 
The Dalmatian mutation corresponds to an N131K substitution in the DNA-binding HMG domain of SOX10 protein. Residue 131 is located at the very end of the loop between helix I and helix II (Figure 2), and is sometimes described as beginning helix II (7-9).  Changes in the amino acid sequence at this location could affect the DNA-binding structure and function of SOX10.  At present, however, nothing is known concerning the stability of the mutant protein or its location within cells.
Expression/Localization
In the mouse and the rat, Sox10 mRNA is selectively expressed in neural crest cells during early stages of development, and in glial cells of both the peripheral nervous system (PNS) and central nervous system (CNS) later in development and in adulthood (2;4;16).  In adult rodents, Sox10 transcripts are abundant in brain and colon but not detectably expressed in heart, skeletal muscle, testis, liver, adrenals, spleen, lungs, or kidneys (2;16).  Sox10 message is expressed throughout the whole brain, but at much higher levels in areas with a high content of myelinated fibers (16).  During rodent development, Sox10 transcripts are first detected on embryonic day (E) 8.5 in regions corresponding to areas from which neural crest cells originate (16).  This expression pattern continues on E9.5 where diffuse but strong Sox10 expression is detected in the developing peripheral nervous system, most prominently in the trigeminal, geniculate, and acoustic ganglia.  Staining is also observed in segmentally repetitive stripes at the level of the anterior halvesof the somites before and during the formation of dorsal root ganglia condensations.  These expression patterns suggest that medially, dorsolaterally and ventrally migrating neural crest cells express Sox10.  At E10.5, all cranial ganglia, the otic vesicle,the dorsal root ganglia and the cranial and spinal nerves are formed and express Sox10 (2;4;16).  At E11.5, expression further progresses toward the periphery and colocalizes with outgrowing nerve fibers (2;4).  By E12.5, Sox10 expression is detected in the gut nervous system as enteric nervous system precursors also arise from neural crest (16).  Expression of Sox10 decreases during development as many structures differentiate but remains high in glial derivatives (4;16;19).
 
SOX10 is more widely expressed in human fetal and adult tissues than in rodents (4;20).  In fetal tissues from 17 to 25 weeks of development, SOX10 expression is essentially found in brain and, to a lesser extent, in lung and kidney.  In adult tissues, SOX10 is preferentially expressed in brain, colon, small intestine and heart, with lower levels seen in prostate, testis, bladder, pancreas and stomach.  During early human development, the SOX10 gene is expressed in neural crest cells.  As human development progresses, SOX10 becomes preferentially expressed in the neural crest derivatives that contribute to the formation of the peripheral nervous system.  Unlike mouse and rat, human SOX10 is expressed in cephalic mesectoderm, which gives rise to nasal bones, as well as fetal and adult cerebral cortex and major brain nuclei.  Thus, SOX10 gene expression is not restricted to glial cells in the CNS in humans as it is in rodents.
 
High levels of SOX10 protein have been detected in gliomas and melanomas (21).
Background
The Dalmatian mutant is classified as a white-spotting coat color mutant.  Such mutants exhibit white spots that include belly spots, head spots, belts spanning the caudal trunk region, piebald spotting and peppering.  The lack of pigment in the adult reflects the absence of mature melanocytes in that area due to defects at various stages of melanocyte development including proliferation, survival, migration, invasion of the integument, hair follicle entry and melanocyte stem cell renewal (22;23).  During embryonic development, melanoblasts show variable density along the rostral-caudal axis with large numbers seen around the optic cup, in the cervical region, and caudal to the hindlimbs.  In piebald spotted mutants, areas of hypopigmentation correlate to embryonic regions of low melanoblast density.  Hypopigmentation of the head, trunk, feet, tail and ventral regions likely reflect initially reduced melanoblast number, and a longer distance of melanoblast migration to reach these areas (22;24).  White-spotted mutants have been ascribed to a variety of genes including ones encoding the transcription factors MITF, PAX3, and SOX10 (mutated in Dalmatian), the KIT receptor tyrosine kinase (mutated in Casper and Pretty2), a G-protein coupled receptor and its ligand (endothelin receptor type B, EDNRB, and endothelin-3, EDN3), a transmembrane protein (Mucolipin 3) as well as ADAMTS-20, a putative ECM associated metalloprotease (mutated in splotch2pandaand whitebelly) (22;23).
 
Figure 4. Sox10 is expressed during the specification of migrating neural crest cells and persists in neurons and melanocytes. During melanocyte differentiation, SOX10 regulates the expression of Mitf and directly interacts with Mitf to control expression of Dct, an enzyme necessary for melanin synthesis. In the peripheral nervous system (PNS), SOX10 regulates the expression of the Schwann cell-specific myelin genes P0, Mbp, and Plp. It also regulates expression of connexin-32 and connexin-47 in peripheral nervous system myelin. In the autonomic nervous system, SOX10 regulates the expression of Mash1 and Phox2b, transcription factors necessary for sympathetic nerve fate. In the enteric nervous system (ENS), SOX10 interacts with PAX3 to activate the Gdnf- c-Ret pathway. It also regulates endothelin receptor-β during ENS development. Arrows indicate positive regulation by SOX10. Mitf, Micropthalmia-associated transcription factor; Dct, dopachrome tautomerase; P0, protein zero gene; Mbp, myelin basic protein; Plp, proteolipid protein; Gdnf, glial cell derived neurotrophic factor; Ednrb, endothelin receptor-β ...
SOX10 is an important, pleiotropic regulator of neural crest and oligodendrocyte development (2;3;19;25)(Figure 4). It functions in stem cell maintenance and maintains multipotency of early neural crest cells (26;27), but is also involved in specifying and differentiating peripheral glia, melanocytes, and components of the gut nervous system  from neural crest cells later in development (2;3;10;25;28-32).  In humans, dominantly inherited heterozygous SOX10 mutations are associated with Waardenburg-Shah syndrome, also known as Waardenburg syndrome type 4 (OMIM #277580).  This disease is a combination of Waardenburg syndrome (WS), characterized by deafness, hypopigmentation of the skin, hair, and irises, as well as Hirschsprung’s disease, characterized by aganglionic megacolon (OMIM #142623).  A more severe dysmyelination syndrome combined with Waardenburg-Shah, is also caused by SOX10 mutations (PCWH, OMIM #609136),  (17;33;34).  It is thought that Waardenburg-Shah is caused by SOX10 haploinsufficiency, whereas the more severe PCWH is caused by dominant-negative mutations (17;19;35).  SOX10 mutations also cause less severe forms of disease, including Waardenburg syndrome type 2E (OMIM #611584) (36), and a mild form of Yemenite deaf-blind hypopigmentation syndrome (see Putative Mechanism, OMIM #601706) (37).  Patients with these SOX10 mutations exhibit hypopigmentation defects and deafness without any additional symptoms.  Waardenburg-Shah is also associated with heterozygous and homozygous mutations in EDNRB (38-40) and homozygous mutations in EDN3 (38;41;42).  Other forms of Waardenburg syndrome are caused by mutations in PAX3 (WS types 1 and 3, OMIM #193500, 148820) (38;43), and MITF (WS type 2, OMIM #193510) (38;44).
 
Mutations in Sox10 in mice, including the spontaneous mutation Dominant megacolon (Sox10Dom), cause a dominant phenotype similar to Waardenburg-Shah syndrome.  Heterozygous animals have pigmentation defects, deafness, and reduced terminal enteric ganglia, leading to megacolon (2;3;25).  Homozygous Sox10Dom mice die at E13.5 (1-3), while homozygous knockout mice die at E16.5 (25).  Both Sox10Dom and Sox10 null embryos exhibit lack of oligodendrocyte differentiation, reduction or absence of many neural crest derivatives including melanocytes and enteric ganglia, and defects in sympathetic and dorsal root ganglia (2;3;16;19;25;28).  Neural crest cells fail to undergo lateral migration, and neural crest cell death is observed both before and during neural crest migration (2;19;25).  The Sox10Dom mutation results from a single nucleotide insertion in the Sox10 locus that replaces the C-terminal transactivation domain of SOX10 with 99 novel amino acids.  It is possible this mutation may have some dominant negative effects as it is expressed during development and homozygous embryos die earlier than knockout homozygotes.  However, the phenotypes of SoxDom and Sox knockout heterozygotes are very similar (2;3;25).
 
The majority of the genes found to be mutated in various forms of Waardenburg Syndrome in humans also cause white-spotting in mice (22), and play related roles in melanocyte specification and differentiation (2;27;29;38).  MITF has been shown to be the key transcriptional regulator of melanocyte development, regulating kit (necessary for melanocyte migration, mutated in Casper and Pretty2), as well as key melanogenic genes including tyrosinase (mutated in ghost), tyrosine-related protein 1 (Tyrp-1), dopachrome tautomerase (Dct) (45) and Slc45a2 (solute carrier family 45, member 2; mutated in cardigan, sweater, galak, and grey goose(54,55).  SOX10 and PAX3 synergize to activate Mitf early during melanocyte differentiation (10;27;29;38), and animals deficient in SOX10 show diminished Mitf expression as well as diminished expression of Ednrb (2;25;29;32).  Signaling through EDNRB, initiated by its ligand EDN3, increases the level of cAMP in melanocytes (38;46).  In turn, elevated levels of cAMP leads to various downstream consequences in melanocytes including upregulation of Mitf gene expression (38;47;48), as well as MITF phosphorylation at various sites leading either to its activation or degradation (38;49-51).  SOX10 continues to play an important role in melanocyte differentiation by directly activating expression of important genes such as tyr (52), and along with MITF, expression of dopachrome tautomerase (31).
Putative Mechanism
The Dalmatian mutation changes an asparagine to a lysine in the DNA-binding domain of SOX10.  This residue is sometimes described as being located at the end of the loop domain connecting the first two α-helices of the HMG box, but is sometimes considered to be the beginning of helix II (7-9).  Since the asparagine side chain can make efficient hydrogen bond interactions with the peptide backbone, asparagines are often found near the beginning and end of α-helices, and in turn motifs in β-sheets (53).  Although this portion of the protein does not appear to be important for the specificity of SOX10 DNA binding or dimerization properties (14), it is highly conserved and probably plays an important role in forming the critical L-shaped structure of the DNA-binding HMG domain.  Since N131 is located adjacent to residues that directly contact DNA, changes at this position may also affect DNA binding.  Indeed, a conservative serine to threonine mutation in human SOX10 at amino acid 135 has been shown to strongly affect the DNA-binding properties of SOX10 in vitro (37).  This residue directly contacts DNA in the related protein SRY (8), and in humans this mutation causes hypopigmentation and hearing loss (see Background) (37).
 
The SOX10 mutated protein in Dalmatian animals is clearly defective as it gives rise to a melanocyte defect, identical to the pigmentation defect in SoxDom (1).  Furthermore, this mutation is dominant suggesting that homozygotes for the N131K substitution could have more severe defects, such as those seen in animals homozygous for other Sox10 mutations (see Background).  Since Dalmatian animals do not have a severely reduced lifespan like SoxDom animals (1), it is possible the N131K mutation represents a weaker hypomorphic allele.  However, the mechanism for the effect of the Dalmatian allele on the melanocyte lineage is likely to be the same (see Background).  In SoxDom heterozygotes and homozygotes, SOX10-expressing cells are disrupted during development. Heterozygous animals retain normal SOX10 patterning early in development, although at reduced levels relative to wild type embryos.  Later, SOX10-expressing melanocyte and enteric nervous system cells are drastically reduced, leading to the pigmentation and gut defects seen in SoxDom heterozygotes (2;3).
Genotyping
The Dalmation mutation introduces an EcoN I restriction enzyme site in the Sox10 genomic DNA sequence.  Dalmation genotyping is performed by amplifying the region containing the mutation using PCR, followed by EcoN I restriction enzyme digestion.
 
Primers
Dal(F): 5’- TTTGCGATGGGAGAGTCTGACACC-3’
Dal(R): 5’- ACACTGTGAATGTGCGATCTAGTGG-3’
 
PCR Program
1) 94°C                            2:00
2) 94°C                            0:15
3) 56°C (annealing)           0:30
4) 72°C                            1:00
5) repeat steps (2-4)         34X 
6) 72°C                            10:00
7) 4°C                               ∞
 
The following sequence of 1313 nucleotides (from Genbank genomic region NC_000081 for linear genomic sequence of Sox10) is amplified:
 
1501       tttg cgatgggaga gtctgacaccctgcaggcag gcctgcgtcc ccccattctg
1561 ctcccctagg ctgtcagagc agacgagggg aaagagaggt gagcgaaaag gtgggaaatt
1621 ccaggggccc ggattagagc cgaataaagg gtccgttttt cttcctttcc atcaacaaac
1681 ctccacccaa aaggaggttt aggggaaaaa aacgaaaaaa aaaaaaaaaa aaaaacaccc
1741 acacctagag acggttggga tcagggggtg ggaagacgtg gaggcgggac gcacccacct
1801 agggtctggc atgtgcacgc gcccaggccc gagtgggttt agcgcaggca gggagagtcg
1861 ccacttcggg gctgcacccg cgtgccggga gtggcgccca gcgcctctcc atcgcgccct
1921 ccttcccgtc caggtgggcg ttgggctctt cacgaggacc ccggcggcgg gcccggggga
1981 ggcggccgaa gcggcggcgg ccgggagcga catggccgag gaacaagacc tatcagaggt
2041 ggagctgagc cctgtgggct cggaggaacc ccgctgcctg tccccaggca gcgcgccgtc
2101 gctgggaccc gacggcggcg gcggtggctc gggcttgcga gccagcccgg ggcccggtga
2161 actgggcaag gtcaagaagg aacagcagga cggcgaggcg gacgatgaca agttccccgt
2221 gtgcatccgc gaggcggtca gccaggtgct cagcggctac gactggacgc tggtgcccat
2281 gcccgtgcgc gtcaacggtg ccagcaagag caagccgcac gtcaagaggc ccatgaacgc
2341 cttcatggtg tgggcacagg cggcacgcag aaagctagcc gaccagtacc ctcacctcca
2401 caatgctgag ctcagcaaga cactaggcaa gctctggagg tgagcgctgc cccggcccaa
2461 cacccccctc gtgcgcgcgc actagggcta gcctgggacc ccagaacagg atcgcccagg
2521 cctctctctc aggggagacc aacctatgga agtttggtct cttggaagac cagatttgga
2581 gatctcgccc acccatctac ccaaagtgcc tctgtggggg gctcctctgg ctgcccactc
2641 tggaactcag aaccccagcg gcctaggctg ggcctcccca ccctgggacg gcgggcggga
2701 aggcgccccc tcgtggttgg aattctgtgg gtggtgggca gggaaggcaa catgggggtg
2761 tgggggaaag cttcacacca gacctccact agatcgcaca ttcacagtgt
 
The primer binding sites are underlined; EcoN I sites are highlighted in gray; novel EcoN I site caused by the Dalmation mutation is highlighted in dark gray; the mutated T is shown in red text.
 
Restriction Digest
Digest PCR reactions with EcoN I. Run on 2% agarose gel with heterozygous and C57BL/6J controls.
Products: Dalmatian allele- 366 bp, 400 bp, 500 bp.  Wild type allele- 500 bp, 766 bp.
References
 48.  
Science Writers Nora G. Smart
Illustrators Diantha La Vine
AuthorsOwen Siggs, Bruce Beutler
Edit History
04/19/2011 9:48 AM (current)
01/07/2011 9:03 AM
12/16/2010 9:47 AM
12/16/2010 9:47 AM
02/03/2010 5:29 PM