Phenotypic Mutation 'narwhal' (pdf version)
List |< first << previous [record 83 of 132] next >> last >|
Allelenarwhal
Mutation Type nonsense
Chromosome7
Coordinate56,295,498 bp (GRCm38)
Base Change A ⇒ T (forward strand)
Gene Oca2
Gene Name oculocutaneous albinism II
Synonym(s) D7H15S12, p, D7H15S12
Chromosomal Location 56,239,760-56,536,518 bp (+)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the human homolog of the mouse p (pink-eyed dilution) gene. The encoded protein is believed to be an integral membrane protein involved in small molecule transport, specifically tyrosine, which is a precursor to melanin synthesis. It is involved in mammalian pigmentation, where it may control skin color variation and act as a determinant of brown or blue eye color. Mutations in this gene result in type 2 oculocutaneous albinism. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2014]
PHENOTYPE: Mutations generally result in varying degrees of coat and eye pigment dilution. Specific alleles produce cleft palate, reproductive, endocrine or neurological disorders, and/or lethality. [provided by MGI curators]
Accession Number

NCBI RefSeq: NM_021879; MGI:97454

Mapped Yes 
Amino Acid Change Arginine changed to Stop codon
Institutional SourceBeutler Lab
Gene Model predicted gene model for protein(s): [ENSMUSP00000032633] [ENSMUSP00000119529] [ENSMUSP00000119099]
SMART Domains Protein: ENSMUSP00000032633
Gene: ENSMUSG00000030450
AA Change: R285*

DomainStartEndE-ValueType
transmembrane domain 171 193 N/A INTRINSIC
Pfam:ArsB 319 558 2e-10 PFAM
Pfam:CitMHS 337 770 2e-49 PFAM
Pfam:ArsB 562 827 8.9e-9 PFAM
Pfam:Na_sulph_symp 573 832 6e-13 PFAM
Predicted Effect probably null
Predicted Effect probably benign
SMART Domains Protein: ENSMUSP00000119099
Gene: ENSMUSG00000030450
AA Change: R285*

DomainStartEndE-ValueType
transmembrane domain 171 193 N/A INTRINSIC
Predicted Effect probably null
Phenotypic Category
Phenotypequestion? Literature verified References
pigmentation 5565073
skin/coat/nails 5565073
Penetrance  
Alleles Listed at MGI

All mutations/alleles(90) : Chemically and radiation induced(3) Chemically induced (ENU)(12) Chemically induced (other)(1) Gene trapped(1) Radiation induced(49) Spontaneous(20) Targeted(3) Transgenic(1)

Lab Alleles
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00509:Oca2 APN 7 56280846 missense probably damaging 0.99
IGL01022:Oca2 APN 7 56324756 missense probably damaging 1.00
IGL01666:Oca2 APN 7 56314811 splice site probably null
IGL02157:Oca2 APN 7 56324797 splice site probably null
IGL02213:Oca2 APN 7 56321484
IGL02314:Oca2 APN 7 56357151 missense probably benign 0.00
IGL03083:Oca2 APN 7 56295484 missense probably benign 0.28
IGL03356:Oca2 APN 7 56535968 missense probably benign 0.01
charbon UTSW 7 56316405 missense probably damaging 1.00
cotton UTSW 7 56535968 missense probably benign 0.00
Dirk UTSW 7 56535968 missense
draco1 UTSW 7 56423352 missense probably benign 0.00
faded UTSW 7 56324661 missense
hardy UTSW 7 56295460 missense probably damaging 1.00
quicksilver UTSW 7 56324661 missense probably damaging 0.98
renesmee UTSW 7 56535968 missense probably benign 0.00
snowflake UTSW 7 56324680 missense probably damaging 1.00
whitemouse UTSW 7 56414431 missense probably damaging 1.00
R0440:Oca2 UTSW 7 56423352 missense probably benign 0.00
R1067:Oca2 UTSW 7 56316393 missense probably damaging 1.00
R1349:Oca2 UTSW 7 56535968 missense probably benign 0.00
R1372:Oca2 UTSW 7 56535968 missense probably benign 0.00
R1457:Oca2 UTSW 7 56321521 missense probably damaging 1.00
R1737:Oca2 UTSW 7 56328785 missense probably damaging 1.00
R1802:Oca2 UTSW 7 56254980 missense possibly damaging 0.96
R1957:Oca2 UTSW 7 56321498 missense possibly damaging 0.82
R1966:Oca2 UTSW 7 56414467 missense probably damaging 0.99
R2082:Oca2 UTSW 7 56297137 missense probably benign 0.01
R2229:Oca2 UTSW 7 56357155 missense probably benign 0.11
R4120:Oca2 UTSW 7 56254882 missense probably damaging 1.00
R4192:Oca2 UTSW 7 56297249 missense probably damaging 1.00
R4405:Oca2 UTSW 7 56414434 missense possibly damaging 0.63
R4654:Oca2 UTSW 7 56328812 missense probably benign 0.44
R4701:Oca2 UTSW 7 56255002 missense probably benign 0.00
R4887:Oca2 UTSW 7 56330358 nonsense probably null
R5053:Oca2 UTSW 7 56323580 missense probably benign 0.02
R5215:Oca2 UTSW 7 56295498 nonsense probably null
R5430:Oca2 UTSW 7 56295460 missense probably damaging 1.00
R5677:Oca2 UTSW 7 56414462 missense probably damaging 1.00
R6416:Oca2 UTSW 7 56328767 missense probably benign 0.44
R6645:Oca2 UTSW 7 56314774 missense probably benign 0.21
Z1088:Oca2 UTSW 7 56330375 missense probably null 0.83
Mode of Inheritance Autosomal Recessive
Local Stock Live Mice
Repository
Last Updated 2018-01-12 4:26 PM by Diantha La Vine
Record Created 2016-12-30 7:47 AM by Carlos Reyna
Record Posted 2017-01-05
Phenotypic Description
Figure 1. The narwhal mice exhibit a light gray coat and red eyes. A wild-type littermate (top) is shown for reference.

The narwhal phenotype was identified among N-ethyl-N-nitrosourea (ENU)-induced G3 mice of the pedigree R5215, some of which exhibited a light gray coat and red eyes (Figure 1).

Nature of Mutation

Whole exome HiSeq sequencing of the G1 grandsire identified 75 mutations. Among these, only one affected a gene with known effects on pigmentation, Oca2. The mutation in Oca2 was presumed to be causative because the narwhal hypopigmentation phenotype mimics other known alleles of Oca2 (see MGI for a list of Oca2 alleles as well as the Beutler Oca2 alleles: quicksilverfadedcharbondraco1snowflakeand whitemouse). The Oca2 mutation in narwhal is an A to T transversion at base pair 56,295,498 (v38) on chromosome 7, or base pair 55,906 in the GenBank genomic region NC_000073. The mutation corresponds to residue 983 in the mRNA sequence NM_021879 within exon 8 of 24 total exons.

 

968 CACGTGGTGGTGAGCAGAACCTTTGAGATAGTG

278 -H--V--V--V--S--R--T--F--E--I--V-

 

The mutated nucleotide is indicated in red. The mutation results in substitution of arginine 285 to a premature stop codon (R285*) in the OCA2 protein.

Protein Prediction

Figure 2. Domain organization of the OCA2 protein. (A) Topography. (B) Domain structure. The narwhal mutation results in substitution of arginine 285 to a premature stop codon in the OCA2 protein. Other mutations found in OCA2  are noted in red. This image is interactive. Click on the mutations for more specific information.    

OCA2 is a 110-kDa twelve transmembrane-spanning protein (Figure 2) that exhibits homology to a number of bacterial transporters (1). The exact function of OCA2 in melanocytes is unknown. The narwhal mutation occurs within the extracellular loop between transmembrane domains 1 and 2.

 

Please see the record quicksilver for information about Oca2.

Putative Mechanism

Mutations in Oca2 are known to cause a variable reduction of eumelanin (black-brown) pigment and altered morphology of black pigment granules (eumelanosomes), but have little effect on pheomelanin (yellow-red) pigment (2;3). For example, mice with null alleles of Oca2 have very little to no eumelanin in their coat and eyes, resulting in a hypopigmentation phenotype: light grey fur with pink eyes on a nonagouti background (e.g., C57BL/6J), and cream-colored mice on an agouti background (4;5). The null mice have a reduced number of very small eumelanosomes in pigmented tissue with a concomitant decrease in the expression levels of melanosomal proteins (e.g., tyrosinase; see the record for ghost). The light coat color of narwhal mice suggests a reduced function of the OCA2 protein in these animals.

Primers PCR Primer
narwhal(F):5'- CATAAATCAGTTGGCATTCCTCACC -3'
narwhal(R):5'- CCAAGATGTTGTTGGCCCTG -3'

Sequencing Primer
narwhal_seq(F):5'- CCACAGGTTCTACATTCAAGGATTAG -3'
narwhal_seq(R):5'- GTGCTATCAGACTTCTCCAGAAACTG -3'
References
  4. Silvers, W. K. (1979) The Coat Colors of Mice. .
Science Writers Anne Murray
Illustrators Katherine Timer
AuthorsCarlos Reyna and Jamie Russell
List |< first << previous [record 83 of 132] next >> last >|