Phenotypic Mutation 'runt' (pdf version)
Allelerunt
Mutation Type frame shift
Chromosome1
Coordinate82,287,732 bp (GRCm38)
Base Change TGGGGTGGACATCGAACTGAAGGAG ⇒ TG (forward strand)
Gene Irs1
Gene Name insulin receptor substrate 1
Synonym(s) G972R, IRS-1
Chromosomal Location 82,233,101-82,291,416 bp (-)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein which is phosphorylated by insulin receptor tyrosine kinase. Mutations in this gene are associated with type II diabetes and susceptibility to insulin resistance. [provided by RefSeq, Nov 2009]
PHENOTYPE: Homozygotes for targeted null mutations exhibit 50 percent reductions in body weights at birth and at 4 months of age, impaired glucose tolerance, and mild insulin and IGF-1 resistance. [provided by MGI curators]
Accession Number

NCBI RefSeq: NM_010570; MGI:99454

Mapped Yes 
Amino Acid Change
Institutional SourceBeutler Lab
Gene Model predicted gene model for protein(s): [ENSMUSP00000063795 ]   † probably from a misspliced transcript
SMART Domains Protein: ENSMUSP00000063795
Gene: ENSMUSG00000055980

DomainStartEndE-ValueType
PH 13 117 8.13e-14 SMART
low complexity region 123 143 N/A INTRINSIC
IRS 155 257 1.19e-35 SMART
PTBI 155 257 7.8e-60 SMART
low complexity region 263 276 N/A INTRINSIC
low complexity region 378 399 N/A INTRINSIC
low complexity region 407 419 N/A INTRINSIC
low complexity region 551 568 N/A INTRINSIC
low complexity region 662 689 N/A INTRINSIC
low complexity region 784 794 N/A INTRINSIC
low complexity region 801 810 N/A INTRINSIC
low complexity region 824 837 N/A INTRINSIC
low complexity region 1019 1040 N/A INTRINSIC
low complexity region 1051 1062 N/A INTRINSIC
low complexity region 1111 1127 N/A INTRINSIC
low complexity region 1185 1200 N/A INTRINSIC
Predicted Effect probably null
Meta Mutation Damage Score 0.9755 question?
Is this an essential gene? Possibly essential (E-score: 0.592) question?
Phenotypic Category
Phenotypequestion? Literature verified References
Body Weight - decreased 20032200
Body Weight (Male) - decreased 20032200
Body Weight (Z-score) - decreased
Fasting Insulin - increased
Fasting Insulin (Male) - increased
Candidate Explorer Status CE: excellent candidate; human score: 2; ML prob: 0.522
Single pedigree
Linkage Analysis Data
Penetrance  
Alleles Listed at MGI

All Mutations and Alleles(13) : Chemically induced (ENU)(1) Chemically induced (other)(1) Radiation induced(1) Spontaneous(2) Targeted(6) Transgenic(2)

Lab Alleles
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00325:Irs1 APN 1 82288483 missense probably benign 0.01
IGL00534:Irs1 APN 1 82288471 missense probably benign
IGL01926:Irs1 APN 1 82289959 missense probably damaging 0.98
IGL02130:Irs1 APN 1 82289467 missense probably damaging 1.00
IGL03338:Irs1 APN 1 82288401 missense probably benign 0.05
Hoverboard UTSW 1 82290098 nonsense probably null
runt2 UTSW 1 82286967 nonsense probably null
R0019:Irs1 UTSW 1 82287256 nonsense probably null
R0063:Irs1 UTSW 1 82288859 missense probably damaging 1.00
R0063:Irs1 UTSW 1 82288859 missense probably damaging 1.00
R0318:Irs1 UTSW 1 82288660 missense probably benign 0.01
R1199:Irs1 UTSW 1 82289626 missense probably damaging 1.00
R1363:Irs1 UTSW 1 82287288 missense probably benign 0.02
R1584:Irs1 UTSW 1 82289444 missense probably benign 0.24
R1874:Irs1 UTSW 1 82289853 frame shift probably null
R1903:Irs1 UTSW 1 82289461 missense probably damaging 1.00
R1929:Irs1 UTSW 1 82288459 missense probably benign
R1986:Irs1 UTSW 1 82288765 missense probably damaging 1.00
R2136:Irs1 UTSW 1 82290042 missense probably damaging 1.00
R2179:Irs1 UTSW 1 82290219 missense possibly damaging 0.81
R2271:Irs1 UTSW 1 82288459 missense probably benign
R2760:Irs1 UTSW 1 82288570 missense probably damaging 1.00
R3721:Irs1 UTSW 1 82290085 missense probably benign 0.11
R3821:Irs1 UTSW 1 82290049 missense probably benign
R4306:Irs1 UTSW 1 82287964 missense probably benign 0.11
R4420:Irs1 UTSW 1 82288450 missense possibly damaging 0.94
R4451:Irs1 UTSW 1 82289028 missense probably benign 0.00
R4479:Irs1 UTSW 1 82287294 missense probably damaging 1.00
R4771:Irs1 UTSW 1 82287975 missense probably benign 0.00
R4782:Irs1 UTSW 1 82287463 missense probably benign 0.00
R4836:Irs1 UTSW 1 82287732 frame shift probably null
R4880:Irs1 UTSW 1 82287732 frame shift probably null
R4881:Irs1 UTSW 1 82287732 frame shift probably null
R5031:Irs1 UTSW 1 82286967 nonsense probably null
R5053:Irs1 UTSW 1 82286922 missense probably benign
R5418:Irs1 UTSW 1 82288770 missense probably damaging 1.00
R5595:Irs1 UTSW 1 82289925 missense probably damaging 1.00
R5698:Irs1 UTSW 1 82288734 missense probably benign 0.01
R6381:Irs1 UTSW 1 82287684 missense possibly damaging 0.66
R6563:Irs1 UTSW 1 82288407 missense probably damaging 0.98
R7002:Irs1 UTSW 1 82288260 missense probably benign 0.13
R7095:Irs1 UTSW 1 82290098 nonsense probably null
R7195:Irs1 UTSW 1 82287456 missense probably benign 0.13
R7216:Irs1 UTSW 1 82289755 missense probably damaging 0.98
R7361:Irs1 UTSW 1 82289114 nonsense probably null
R7490:Irs1 UTSW 1 82287264 missense probably damaging 0.99
R7540:Irs1 UTSW 1 82288002 missense not run
R7706:Irs1 UTSW 1 82287691 missense probably damaging 1.00
R7910:Irs1 UTSW 1 82290081 missense probably benign 0.06
R7912:Irs1 UTSW 1 82289884 missense probably benign
R7991:Irs1 UTSW 1 82290081 missense probably benign 0.06
R7993:Irs1 UTSW 1 82289884 missense probably benign
X0063:Irs1 UTSW 1 82288908 missense probably damaging 1.00
X0065:Irs1 UTSW 1 82289365 missense probably damaging 1.00
Mode of Inheritance Autosomal Recessive
Local Stock
Repository
Last Updated 2019-09-04 9:41 PM by Anne Murray
Record Created 2017-01-02 10:03 PM
Record Posted 2018-10-24
Phenotypic Description
Figure 1. Runt mice display elevated fasting serum insulin levels. Fasting insulin levels (raw data) are plotted. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 2. Runt mice display reduced body weight. Scaled weight data are plotted. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The runt phenotype was identified among G3 mice of the pedigree R4836, some of which had elevated fasting insulin levels (Figure 1) and reduced body weight (Figure 2) compared to wild-type controls.

Nature of Mutation
Figure 3. Linkage mapping of the fasting insulin phenotype using a recessive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 80 mutations (X-axis) identified in the G1 male of pedigree R4836. Raw data were used for single locus linkage analysis with consideration of G2 dam identity. Horizontal pink and red lines represent, respectively, thresholds of P = 0.05, and P = 0.05 after applying Bonferroni correction.
Figure 4. Linkage mapping of body weight phenotype in position-based superpedigree using an additive model of inheritance. (A) Scaled weight data are plotted for three pedigrees containing the runt mutation. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated. (B) Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of all mutations (X-axis) identified in the three pedigrees in A. Scaled weight data were used for single locus linkage analysis without consideration of G2 dam identity. Horizontal pink and red lines represent, respectively, thresholds of P = 0.05, and P = 0.05 after applying Bonferroni correction.

Whole exome HiSeq sequencing of the G1 grandsire identified 80 mutations. The elevated fasting insulin level was linked to a mutation in Irs1: a 23 bp deletion in exon 1 (of 2 total exons) that causes a frameshift. Linkage was found with a recessive model of inheritance, wherein 2 variant homozygotes differed phenotypically from 19 heterozygous and 26 homozygous reference mice (P = 3.005 x 10-5; Figure 3). The body weight phenotype was not linked to the Irs1 mutation with a significant P value when analyzed in the original pedigree (R4836), but showed significant linkage when analyzed in position-based (P = 8.596 x 10-5; Figure 4) and gene-based superpedigrees (P = 1.083 x 10-8; not shown).

 

C57BL/6J:

3668 GCAACTTCCCGTAGCT CTCCTTCAGTTCGATGTCCACCC CAGCTCCACCCAGCT

908  -A--T--S--R--S-- S--P--S--V--R--C--P--P- -Q--L--H--P--A-

runt:

3668 GCAACTTCCCGTAGCT CAGCTCCACCCAGCTCCTAG

908  -A--T--S--R--S-- S--A--P--P--S--S--*

 

Nucleotide numbering corresponds to NC_000067; the deleted nucleotides are shown in red.  The mutation is predicted to result in the addition of 5 aberrant amino acids after aa913 followed by a premature stop codon.

Protein Prediction
Figure 5. Domain organization of IRS1. The runt mutation results in a 23bp deletion that causes a frameshift. The mutation is predicted to result in the addition of 5 aberrant amino acids after aa913 followed by a premature stop codon. Other mutations found in the IRS protein are noted in red. Click on each mutation for more information.
Figure 6. Crystal structure of human PH-PTB in IRS1. UCSF Chimera model is based on PDB 1QQG, Dhe-Paganon, et al. Proc.Natl.Acad.Sci.USA. 96, 8378-8383 (1999). Click on the 3D structure to view it rotate.

Irs1 encodes insulin receptor substate-1 (IRS1), one of four members of the IRS family (IRS1 through IRS4). The IRS proteins consist of N-terminal pleckstrin homology (PH) and phosphotyrosine binding (PTB) domains followed by long, unstructured C-terminal tails containing numerous tyrosine, serine, and threonine residues [Figure 5; reviewed in (1)]. IRS1 and IRS2 (see the record for dum_dum) have highly similar PH and PTB domains; the two proteins function analogously in insulin receptor (IR; see the record for gummi_bear) signaling (2). IRS1 and IRS2 differ within their respective tail regions. The PH and PTB domains of IRS1 interact with the activated IR and are necessary for insulin-stimulated tyrosine phosphorylation of IRS1 (3-6). Both domains fold into a seven-stranded, antiparallel β-sandwich capped at one end by an α-helix [Figure 6; PDB:1QQG; (7;8)]. The PTB domain binds to the juxtamembrane region of the IR (8); in vitro binding experiments showed that the IRS1 PTB recognizes an NPXpY sequence motif with a hydrophobic residue at pY−8 (6;9). The IRS1 PH domain binds to phosphatidylinositol phosphates, which putatively promotes IRS1 localization to the IR at the cell membrane (7).

 

IRS1 and IRS2 are regulated by phosphorylation of more than 50 serine/threonine residues within their C-terminal tails (1;10). Depending on the sites affected and the time course of phosphorylation, phosphorylation can have positive or negative regulatory effects on IRS function. Positive regulatory sites are phosphorylated by several kinases, including PKB and PKCz. While IKKβ, JNK, ERK, S6K phosphorylate IRS1 on inhibitory sites. A few of these phosphorylation sites are described in more detail, below. For a more detailed description of IRS1 phosphorylation, see (1;10). Ser24 phosphorylation is essential for insulin receptor:IRS1 complex formation (11). PKCδ-mediated phosphorylation of Ser24 diminishes the ability of IRS-1 to bind phosphatidylinositol-4,5-bisphosphate (PIP2) (12). JNK1 promotes the phosphorylation of Ser307 in response to TNFα (13). Phosphorylation of Ser307 interferes with the interaction between the IR and IRS1, subsequently preventing IRS1 Tyr phosphorylation (13). Ser307 is also a potential phosphorylation site for IKKβ (14) and PKCθ (15). Ser318 is a putative target of PKCz and JNK. Phosphorylation of Ser318 is predicted to disrupt the interaction between the insulin receptor and IRS1. mTORC1 (mammalian target of rapamycin complex 1) and mTORC2 are protein complexes that function in cell metabolism and cell growth. mTORC1 promotes IRS1 serine phosphorylation at Ser636, which causes IRS1 downregulation and excludes IRS1 from the membrane (16). mTORC2-mediated IRS1 phosphorylation mediates IRS1 degradation (17). mTORC2 regulates the stability and insulin-induced localization of Fbw8 to the cytosol whereby the Fbw8/Cul7 ubiquitin ligase complex promotes IRS1 ubiquitination and degradation. Human IRS1 is phosphorylated by Akt at Ser629 (18). Ser629 phosphorylation causes reduced Ser636 phosphorylation, subsequently increasing insulin signaling. Akt also putatively phosphorylates IRS1 at Ser522, which suppresses insulin signaling (19).

 

The runt mutation is predicted to result in the addition of five aberrant amino acids after amino acid 913 followed by a premature stop codon.

Expression/Localization

Both IRS1 and IRS2 are widely expressed in mammalian tissues. IRS1 is predicted to predominantly function in skeletal muscle and fat, and IRS2 predominantly functions in the liver.

Background
Figure 7. Binding of insulin to the insulin receptor (IR) propagates signaling to activate three main pathways: the MAP kinase, Cbl/CAP, and PI3K pathways. Insulin binding to the IR promotes autophosphorylation of the receptor. IRS1/2 recruitment to the IR results in PI3K and GRB2 activation. Activated PI3K phosphorylates membrane phospholipids, the major product being phosphatidylinositol-3,4,5-trisphosphate (PIP3). PIP3 in turn activates PIP3-dependent kinase 1 (PDK1). PDK1 activates another kinase called protein kinase B (PKB; alternatively, AKT). Insulin-mediated activation of AKT2/PKBβ results in inhibition of lipolysis and gluoconeogenesis as well as activation of protein and glycogen synthesis. PDK1 phosphorylates some isoforms of protein kinase C (PKC). The PKC isoform, PKCλ/ζ, phosphorylates proteins associated with intracellular vesicles containing the glucose transporter, GLUT4, resulting in their migration to and fusion with, the plasma membrane and subsequent increased glucose uptake and metabolism in adipose tissue. GRB2 activation results in signal transduction via the monomeric G-protein, RAS. Activation of RAS ultimately leads to changes in the expression of numerous genes via activation of members of the extracellular signal-regulated kinases, ERK.

The insulin signaling pathway regulates glucose uptake and release as well as the synthesis and storage of carbohydrates and lipids (Figure 7). Binding of insulin to the ectodomain of the IR activates the insulin signaling pathway by triggering a conformational change that facilitates IR autophosphorylation of the kinase domain. Phosphorylation of the kinase activation loop stimulates IR catalytic activity. Phosphorylation of the juxtamembrane region of the IR recruits downstream signaling proteins (e.g., IRS1, IRS2, and Shc [see the record for shrine (Shc2)]). Activated IR activates three main signaling pathways: MAP kinase, Cbl/CAP, and PI3K (20). The PI3K pathway, activated by the IRS proteins, mediates the metabolic functions of insulin through effectors such as GSK3β, mTORC1, mTORC2, and Forkhead transcription factors. Shc activates the Shc-Grb2-Sos-Ras-Raf-MAPK pathway, which controls cellular proliferation and gene transcriptionIRS1 and IRS2 are the main substrates phosphorylated by the IR in response to insulin binding. IRS1 and IRS2 do not have intrinsic enzyme activity, but function as docking proteins that bind and activate signal transduction proteins including the p85 regulatory subunit of class 1A PI3K (see the record for anubis) (21;22). For more information about IR-associated signaling, please the record for gummi_bear.

 

Mutations in IRS1 are associated with noninsulin-dependent diabetes mellitus (OMIM: #125853) (23-25). Degradation of IRS1 contributes to insulin resistance. Prolonged insulin stimulation and subsequent activation of the mTOR signaling pathway promotes IRS degradation by the 26S proteasome (26). A mutation in IRS1 (p.G972R) is a risk factor for coronary artery disease (27). The G972R mutation was also associated with a higher frequency of diabetes mellitus (14.9% among carriers), with a 60% increase of plasma total triglycerides, and with increased total plasma cholesterol levels (27).

Putative Mechanism

Systemic knockout of either IRS1 or IRS2 in mice leads to hyperinsulinemia, impaired glucose tolerance, and reduced insulin sensitivity (28-31). However, distinct phenotypes are also observed in Irs1-/- and Irs2-/- mice.  Irs1-/- mice display growth retardation (50 to 60% of WT weight) and their insulin resistance is compensated by β cell hyperplasia so that fasting blood glucose levels are normal in 4-8 week old mice (28;29)Irs1-/- mice also showed higher blood pressures and plasma triglyceride levels with concomitant reduced levels of lipoprotein lipase activity than wild-type mice (32).  In contrast, Irs2-/- mice show mild growth retardation (90% of WT weight) and develop diabetes due to a lack of β cell compensation for insulin resistance (30). Mice expressing a spontaneous Irs1 mutation showed reduced body sizes, hearing loss, less serum IGF1 levels, hyperinsulinemia, mild insulin resistance, low bone mineral densities, reduced trabecular and cortical thicknesses, and low bone formation rates (33).

 

The phenotypes observed in the runt mice indicate loss of IRS1-associated function.

Primers PCR Primer
runt_pcr_F: ACGGCTATTTGGCACCGAAC
runt_pcr_R: CTCGAAAGGTAGACACAGCTG

Sequencing Primer
runt_seq_F: AACGGGTTGGCCTGCAAAC
runt_seq_R: TCGACCCACAAGGCTGTC
Genotyping

PCR program

1) 94°C 2:00
2) 94°C 0:30
3) 55°C 0:30
4) 72°C 1:00
5) repeat steps (2-4) 40x
6) 72°C 10:00
7) 4°C hold


The following sequence of 431 nucleotides is amplified (chromosome 1, - strand):


1   ctcgaaaggt agacacagct gcacagacca acagccgcct ggctcgaccc acaaggctgt
61  ccttggggga tcccaaggca agcaccttac cccgggttcg agagcagcaa cagcagcagc
121 agtcttccct gcaccctccc gagcccaaaa gcccaggaga atatgtgaat attgaattcg
181 ggagcggcca gcctggctat ttagctggcc ctgcaacttc ccgtagctct ccttcagttc
241 gatgtccacc ccagctccac ccagctccta gagaagagac tggctcggaa gagtacatga
301 acatggactt ggggccaggc cggagggcaa cctggcagga gagtggtgga gttgagttgg
361 gcagaatagg ccctgcacct ccggggtctg ctacggtttg caggccaacc cgttcggtgc
421 caaatagccg t


Primer binding sites are underlined and the sequencing primers are highlighted; the mutated nucleotide is shown in red.

References
Science Writers Eva Marie Y. Moresco, Anne Murray
Illustrators Diantha La Vine
AuthorsEmre Turer and Bruce Beutler