Phenotypic Mutation 'runt'

• Allele: runt
• Mutation Type: frame shift
• Chromosome: 1
• Coordinate: 82,265,453 bp (GRCm39)
• Base Change: TGGGGTGGACATCGAACTGAAGGAG ⇒ TG (forward strand)
• Gene: Irs1
• Gene Name: insulin receptor substrate 1
• Synonym(s): G972R, IRS-1
• Chromosomal Location: 82,210,822-82,269,137 bp (-) (GRCm39)
• MGI Phenotype: FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein which is phosphorylated by insulin receptor tyrosine kinase. Mutations in this gene are associated with type II diabetes and susceptibility to insulin resistance. [provided by RefSeq, Nov 2009] ; PHENOTYPE: Homozygotes for targeted null mutations exhibit 50 percent reductions in body weights at birth and at 4 months of age, impaired glucose tolerance, and mild insulin and IGF-1 resistance. [provided by MGI curators]
• Mapped: Yes
• Institutional Source: Beutler Lab
• Gene Model: predicted gene model for protein(s): [ENSMUSP00000063795 ^†] † probably from a misspliced transcript
• AlphaFold: no structure available at present
• SMART Domains: Protein: ENSMUSP00000063795; Gene: ENSMUSG00000055980; AA Change: 913

Domain	Start	End	E-Value	Type
PH	13	117	8.13e-14	SMART
low complexity region	123	143	N/A	INTRINSIC
IRS	155	257	1.19e-35	SMART
PTBI	155	257	7.8e-60	SMART
low complexity region	263	276	N/A	INTRINSIC
low complexity region	378	399	N/A	INTRINSIC
low complexity region	407	419	N/A	INTRINSIC
low complexity region	551	568	N/A	INTRINSIC
low complexity region	662	689	N/A	INTRINSIC
low complexity region	784	794	N/A	INTRINSIC
low complexity region	801	810	N/A	INTRINSIC
low complexity region	824	837	N/A	INTRINSIC
low complexity region	1019	1040	N/A	INTRINSIC
low complexity region	1051	1062	N/A	INTRINSIC
low complexity region	1111	1127	N/A	INTRINSIC
low complexity region	1185	1200	N/A	INTRINSIC

• Predicted Effect: probably null
• Meta Mutation Damage Score: 0.9755
• Is this an essential gene?: Possibly essential (E-score: 0.558)
• Phenotypic Category: Autosomal Recessive
• Mode of Inheritance: Autosomal Recessive
• Last Updated: 2019-09-04 9:41 PM by Anne Murray
• Record Created: 2017-01-02 10:03 PM
• Record Posted: 2018-10-24
• Science Writers: Eva Marie Y. Moresco, Anne Murray
• Illustrators: Diantha La Vine
• Authors: Emre Turer and Bruce Beutler

Accession Number

NCBI RefSeq: NM_010570; MGI:99454

Alleles Listed at MGI

All Mutations and Alleles(13) : Chemically induced (ENU)(1) Chemically induced (other)(1) Radiation induced(1) Spontaneous(2) Targeted(6) Transgenic(2)

Phenotypic Description

Figure 1. Runt mice display elevated fasting serum insulin levels. Fasting insulin levels (raw data) are plotted. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 2. Runt mice display reduced body weight. Scaled weight data are plotted. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The runt phenotype was identified among G3 mice of the pedigree R4836, some of which had elevated fasting insulin levels (Figure 1) and reduced body weight (Figure 2) compared to wild-type controls.

Nature of Mutation

Figure 3. Linkage mapping of the fasting insulin phenotype using a recessive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 80 mutations (X-axis) identified in the G1 male of pedigree R4836. Raw data were used for single locus linkage analysis with consideration of G2 dam identity. Horizontal pink and red lines represent, respectively, thresholds of P = 0.05, and P = 0.05 after applying Bonferroni correction.

Figure 4. Linkage mapping of body weight phenotype in position-based superpedigree using an additive model of inheritance. (A) Scaled weight data are plotted for three pedigrees containing the runt mutation. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated. (B) Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of all mutations (X-axis) identified in the three pedigrees in A. Scaled weight data were used for single locus linkage analysis without consideration of G2 dam identity. Horizontal pink and red lines represent, respectively, thresholds of P = 0.05, and P = 0.05 after applying Bonferroni correction.

Whole exome HiSeq sequencing of the G1 grandsire identified 80 mutations. The elevated fasting insulin level was linked to a mutation in Irs1: a 23 bp deletion in exon 1 (of 2 total exons) that causes a frameshift. Linkage was found with a recessive model of inheritance, wherein 2 variant homozygotes differed phenotypically from 19 heterozygous and 26 homozygous reference mice (P = 3.005 x 10^-5; Figure 3). The body weight phenotype was not linked to the Irs1 mutation with a significant P value when analyzed in the original pedigree (R4836), but showed significant linkage when analyzed in position-based (P = 8.596 x 10^-5; Figure 4) and gene-based superpedigrees (P = 1.083 x 10^-8; not shown).

C57BL/6J: 3668 GCAACTTCCCGTAGCT CTCCTTCAGTTCGATGTCCACCC CAGCTCCACCCAGCT 908  -A--T--S--R--S-- S--P--S--V--R--C--P--P- -Q--L--H--P--A-

runt: 3668 GCAACTTCCCGTAGCT CAGCTCCACCCAGCTCCTAG 908  -A--T--S--R--S-- S--A--P--P--S--S--*

Nucleotide numbering corresponds to NC_000067; the deleted nucleotides are shown in red.  The mutation is predicted to result in the addition of 5 aberrant amino acids after aa913 followed by a premature stop codon.

Protein Prediction

Figure 5. Domain organization of IRS1. The runt mutation results in a 23bp deletion that causes a frameshift. The mutation is predicted to result in the addition of 5 aberrant amino acids after aa913 followed by a premature stop codon. Other mutations found in the IRS protein are noted in red. Click on each mutation for more information.

Figure 6. Crystal structure of human PH-PTB in IRS1. UCSF Chimera model is based on PDB 1QQG, Dhe-Paganon, et al. Proc.Natl.Acad.Sci.USA. 96, 8378-8383 (1999). Click on the 3D structure to view it rotate.

Irs1 encodes insulin receptor substate-1 (IRS1), one of four members of the IRS family (IRS1 through IRS4). The IRS proteins consist of N-terminal pleckstrin homology (PH) and phosphotyrosine binding (PTB) domains followed by long, unstructured C-terminal tails containing numerous tyrosine, serine, and threonine residues [Figure 5; reviewed in (1)]. IRS1 and IRS2 (see the record for dum_dum) have highly similar PH and PTB domains; the two proteins function analogously in insulin receptor (IR; see the record for gummi_bear) signaling (2). IRS1 and IRS2 differ within their respective tail regions. The PH and PTB domains of IRS1 interact with the activated IR and are necessary for insulin-stimulated tyrosine phosphorylation of IRS1 (3-6). Both domains fold into a seven-stranded, antiparallel β-sandwich capped at one end by an α-helix [Figure 6; PDB:1QQG; (7;8)]. The PTB domain binds to the juxtamembrane region of the IR (8); in vitro binding experiments showed that the IRS1 PTB recognizes an NPXpY sequence motif with a hydrophobic residue at pY−8 (6;9). The IRS1 PH domain binds to phosphatidylinositol phosphates, which putatively promotes IRS1 localization to the IR at the cell membrane (7).

IRS1 and IRS2 are regulated by phosphorylation of more than 50 serine/threonine residues within their C-terminal tails (1;10). Depending on the sites affected and the time course of phosphorylation, phosphorylation can have positive or negative regulatory effects on IRS function. Positive regulatory sites are phosphorylated by several kinases, including PKB and PKCz. While IKKβ, JNK, ERK, S6K phosphorylate IRS1 on inhibitory sites. A few of these phosphorylation sites are described in more detail, below. For a more detailed description of IRS1 phosphorylation, see (1;10). Ser24 phosphorylation is essential for insulin receptor:IRS1 complex formation (11). PKCδ-mediated phosphorylation of Ser24 diminishes the ability of IRS-1 to bind phosphatidylinositol-4,5-bisphosphate (PIP₂) (12). JNK1 promotes the phosphorylation of Ser307 in response to TNFα (13). Phosphorylation of Ser307 interferes with the interaction between the IR and IRS1, subsequently preventing IRS1 Tyr phosphorylation (13). Ser307 is also a potential phosphorylation site for IKKβ (14) and PKCθ (15). Ser318 is a putative target of PKCz and JNK. Phosphorylation of Ser318 is predicted to disrupt the interaction between the insulin receptor and IRS1. mTORC1 (mammalian target of rapamycin complex 1) and mTORC2 are protein complexes that function in cell metabolism and cell growth. mTORC1 promotes IRS1 serine phosphorylation at Ser636, which causes IRS1 downregulation and excludes IRS1 from the membrane (16). mTORC2-mediated IRS1 phosphorylation mediates IRS1 degradation (17). mTORC2 regulates the stability and insulin-induced localization of Fbw8 to the cytosol whereby the Fbw8/Cul7 ubiquitin ligase complex promotes IRS1 ubiquitination and degradation. Human IRS1 is phosphorylated by Akt at Ser629 (18). Ser629 phosphorylation causes reduced Ser636 phosphorylation, subsequently increasing insulin signaling. Akt also putatively phosphorylates IRS1 at Ser522, which suppresses insulin signaling (19).

The runt mutation is predicted to result in the addition of five aberrant amino acids after amino acid 913 followed by a premature stop codon.

Expression/Localization

Both IRS1 and IRS2 are widely expressed in mammalian tissues. IRS1 is predicted to predominantly function in skeletal muscle and fat, and IRS2 predominantly functions in the liver.

Background

Figure 7. Binding of insulin to the insulin receptor (IR) propagates signaling to activate three main pathways: the MAP kinase, Cbl/CAP, and PI3K pathways. Insulin binding to the IR promotes autophosphorylation of the receptor. IRS1/2 recruitment to the IR results in PI3K and GRB2 activation. Activated PI3K phosphorylates membrane phospholipids, the major product being phosphatidylinositol-3,4,5-trisphosphate (PIP₃). PIP₃ in turn activates PIP₃-dependent kinase 1 (PDK1). PDK1 activates another kinase called protein kinase B (PKB; alternatively, AKT). Insulin-mediated activation of AKT2/PKBβ results in inhibition of lipolysis and gluoconeogenesis as well as activation of protein and glycogen synthesis. PDK1 phosphorylates some isoforms of protein kinase C (PKC). The PKC isoform, PKCλ/ζ, phosphorylates proteins associated with intracellular vesicles containing the glucose transporter, GLUT4, resulting in their migration to and fusion with, the plasma membrane and subsequent increased glucose uptake and metabolism in adipose tissue. GRB2 activation results in signal transduction via the monomeric G-protein, RAS. Activation of RAS ultimately leads to changes in the expression of numerous genes via activation of members of the extracellular signal-regulated kinases, ERK.

The insulin signaling pathway regulates glucose uptake and release as well as the synthesis and storage of carbohydrates and lipids (Figure 7). Binding of insulin to the ectodomain of the IR activates the insulin signaling pathway by triggering a conformational change that facilitates IR autophosphorylation of the kinase domain. Phosphorylation of the kinase activation loop stimulates IR catalytic activity. Phosphorylation of the juxtamembrane region of the IR recruits downstream signaling proteins (e.g., IRS1, IRS2, and Shc [see the record for shrine (Shc2)]). Activated IR activates three main signaling pathways: MAP kinase, Cbl/CAP, and PI3K (20). The PI3K pathway, activated by the IRS proteins, mediates the metabolic functions of insulin through effectors such as GSK3β, mTORC1, mTORC2, and Forkhead transcription factors. Shc activates the Shc-Grb2-Sos-Ras-Raf-MAPK pathway, which controls cellular proliferation and gene transcriptionIRS1 and IRS2 are the main substrates phosphorylated by the IR in response to insulin binding. IRS1 and IRS2 do not have intrinsic enzyme activity, but function as docking proteins that bind and activate signal transduction proteins including the p85 regulatory subunit of class 1A PI3K (see the record for anubis) (21;22). For more information about IR-associated signaling, please the record for gummi_bear.

Mutations in IRS1 are associated with noninsulin-dependent diabetes mellitus (OMIM: #125853) (23-25). Degradation of IRS1 contributes to insulin resistance. Prolonged insulin stimulation and subsequent activation of the mTOR signaling pathway promotes IRS degradation by the 26S proteasome (26). A mutation in IRS1 (p.G972R) is a risk factor for coronary artery disease (27). The G972R mutation was also associated with a higher frequency of diabetes mellitus (14.9% among carriers), with a 60% increase of plasma total triglycerides, and with increased total plasma cholesterol levels (27).

Putative Mechanism

Systemic knockout of either IRS1 or IRS2 in mice leads to hyperinsulinemia, impaired glucose tolerance, and reduced insulin sensitivity (28-31). However, distinct phenotypes are also observed in Irs1^-/- and Irs2^-/- mice.  Irs1^-/- mice display growth retardation (50 to 60% of WT weight) and their insulin resistance is compensated by β cell hyperplasia so that fasting blood glucose levels are normal in 4-8 week old mice (28;29). Irs1^-/- mice also showed higher blood pressures and plasma triglyceride levels with concomitant reduced levels of lipoprotein lipase activity than wild-type mice (32).  In contrast, Irs2^-/- mice show mild growth retardation (90% of WT weight) and develop diabetes due to a lack of β cell compensation for insulin resistance (30). Mice expressing a spontaneous Irs1 mutation showed reduced body sizes, hearing loss, less serum IGF1 levels, hyperinsulinemia, mild insulin resistance, low bone mineral densities, reduced trabecular and cortical thicknesses, and low bone formation rates (33).

The phenotypes observed in the runt mice indicate loss of IRS1-associated function.

Primers

PCR Primer
runt_pcr_F: ACGGCTATTTGGCACCGAAC
runt_pcr_R: CTCGAAAGGTAGACACAGCTG

Sequencing Primer
runt_seq_F: AACGGGTTGGCCTGCAAAC
runt_seq_R: TCGACCCACAAGGCTGTC

Genotyping

PCR program

1) 94°C 2:00
2) 94°C 0:30
3) 55°C 0:30
4) 72°C 1:00
5) repeat steps (2-4) 40x
6) 72°C 10:00
7) 4°C hold

The following sequence of 431 nucleotides is amplified (chromosome 1, - strand):

1   ctcgaaaggt agacacagct gcacagacca acagccgcct ggctcgaccc acaaggctgt
61  ccttggggga tcccaaggca agcaccttac cccgggttcg agagcagcaa cagcagcagc
121 agtcttccct gcaccctccc gagcccaaaa gcccaggaga atatgtgaat attgaattcg
181 ggagcggcca gcctggctat ttagctggcc ctgcaacttc ccgtagctct ccttcagttc
241 gatgtccacc ccagctccac ccagctccta gagaagagac tggctcggaa gagtacatga
301 acatggactt ggggccaggc cggagggcaa cctggcagga gagtggtgga gttgagttgg
361 gcagaatagg ccctgcacct ccggggtctg ctacggtttg caggccaacc cgttcggtgc
421 caaatagccg t

Primer binding sites are underlined and the sequencing primers are highlighted; the mutated nucleotide is shown in red.

References

  1. Copps, K. D., and White, M. F. (2012) Regulation of Insulin Sensitivity by serine/threonine Phosphorylation of Insulin Receptor Substrate Proteins IRS1 and IRS2. Diabetologia. 55, 2565-2582.

  2. Sun, X. J., Wang, L. M., Zhang, Y., Yenush, L., Myers, M. G.,Jr, Glasheen, E., Lane, W. S., Pierce, J. H., and White, M. F. (1995) Role of IRS-2 in Insulin and Cytokine Signalling. Nature. 377, 173-177.

  3. Yenush, L., Makati, K. J., Smith-Hall, J., Ishibashi, O., Myers, M. G.,Jr, and White, M. F. (1996) The Pleckstrin Homology Domain is the Principal Link between the Insulin Receptor and IRS-1. J Biol Chem. 271, 24300-24306.

  4. Myers, M. G.,Jr, Grammer, T. C., Brooks, J., Glasheen, E. M., Wang, L. M., Sun, X. J., Blenis, J., Pierce, J. H., and White, M. F. (1995) The Pleckstrin Homology Domain in Insulin Receptor Substrate-1 Sensitizes Insulin Signaling. J Biol Chem. 270, 11715-11718.

  5. Voliovitch, H., Schindler, D. G., Hadari, Y. R., Taylor, S. I., Accili, D., and Zick, Y. (1995) Tyrosine Phosphorylation of Insulin Receptor Substrate-1 in Vivo Depends upon the Presence of its Pleckstrin Homology Region. J Biol Chem. 270, 18083-18087.

  6. Wolf, G., Trub, T., Ottinger, E., Groninga, L., Lynch, A., White, M. F., Miyazaki, M., Lee, J., and Shoelson, S. E. (1995) PTB Domains of IRS-1 and Shc have Distinct but Overlapping Binding Specificities. J Biol Chem. 270, 27407-27410.

  7. Dhe-Paganon, S., Ottinger, E. A., Nolte, R. T., Eck, M. J., and Shoelson, S. E. (1999) Crystal Structure of the Pleckstrin Homology-Phosphotyrosine Binding (PH-PTB) Targeting Region of Insulin Receptor Substrate 1. Proc Natl Acad Sci U S A. 96, 8378-8383.

  8. Eck, M. J., Dhe-Paganon, S., Trub, T., Nolte, R. T., and Shoelson, S. E. (1996) Structure of the IRS-1 PTB Domain Bound to the Juxtamembrane Region of the Insulin Receptor. Cell. 85, 695-705.

  9. He, W., O'Neill, T. J., and Gustafson, T. A. (1995) Distinct Modes of Interaction of SHC and Insulin Receptor Substrate-1 with the Insulin Receptor NPEY Region Via Non-SH2 Domains. J Biol Chem. 270, 23258-23262.

  10. Boura-Halfon, S., and Zick, Y. (2009) Phosphorylation of IRS Proteins, Insulin Action, and Insulin Resistance. Am J Physiol Endocrinol Metab. 296, E581-91.

  11. Farhang-Fallah, J., Randhawa, V. K., Nimnual, A., Klip, A., Bar-Sagi, D., and Rozakis-Adcock, M. (2002) The Pleckstrin Homology (PH) Domain-Interacting Protein Couples the Insulin Receptor Substrate 1 PH Domain to Insulin Signaling Pathways Leading to Mitogenesis and GLUT4 Translocation. Mol Cell Biol. 22, 7325-7336.

  12. Greene, M. W., Ruhoff, M. S., Roth, R. A., Kim, J. A., Quon, M. J., and Krause, J. A. (2006) PKCdelta-Mediated IRS-1 Ser24 Phosphorylation Negatively Regulates IRS-1 Function. Biochem Biophys Res Commun. 349, 976-986.

  13. Aguirre, V., Uchida, T., Yenush, L., Davis, R., and White, M. F. (2000) The c-Jun NH(2)-Terminal Kinase Promotes Insulin Resistance during Association with Insulin Receptor Substrate-1 and Phosphorylation of Ser(307). J Biol Chem. 275, 9047-9054.

  14. Gao, Z., Hwang, D., Bataille, F., Lefevre, M., York, D., Quon, M. J., and Ye, J. (2002) Serine Phosphorylation of Insulin Receptor Substrate 1 by Inhibitor Kappa B Kinase Complex. J Biol Chem. 277, 48115-48121.

  15. Yu, C., Chen, Y., Cline, G. W., Zhang, D., Zong, H., Wang, Y., Bergeron, R., Kim, J. K., Cushman, S. W., Cooney, G. J., Atcheson, B., White, M. F., Kraegen, E. W., and Shulman, G. I. (2002) Mechanism by which Fatty Acids Inhibit Insulin Activation of Insulin Receptor Substrate-1 (IRS-1)-Associated Phosphatidylinositol 3-Kinase Activity in Muscle. J Biol Chem. 277, 50230-50236.

  16. Tremblay, F., and Marette, A. (2001) Amino Acid and Insulin Signaling Via the mTOR/p70 S6 Kinase Pathway. A Negative Feedback Mechanism Leading to Insulin Resistance in Skeletal Muscle Cells. J Biol Chem. 276, 38052-38060.

  17. Destefano, M. A., and Jacinto, E. (2013) Regulation of Insulin Receptor Substrate-1 by mTORC2 (Mammalian Target of Rapamycin Complex 2). Biochem Soc Trans. 41, 896-901.

  18. Luo, M., Langlais, P., Yi, Z., Lefort, N., De Filippis, E. A., Hwang, H., Christ-Roberts, C. Y., and Mandarino, L. J. (2007) Phosphorylation of Human Insulin Receptor Substrate-1 at Serine 629 Plays a Positive Role in Insulin Signaling. Endocrinology. 148, 4895-4905.

  19. Giraud, J., Haas, M., Feener, E. P., Copps, K. D., Dong, X., Dunn, S. L., and White, M. F. (2007) Phosphorylation of Irs1 at SER-522 Inhibits Insulin Signaling. Mol Endocrinol. 21, 2294-2302.

  20. Khan, A. H., and Pessin, J. E. (2002) Insulin Regulation of Glucose Uptake: A Complex Interplay of Intracellular Signalling Pathways. Diabetologia. 45, 1475-1483.

  21. Sun, X. J., Rothenberg, P., Kahn, C. R., Backer, J. M., Araki, E., Wilden, P. A., Cahill, D. A., Goldstein, B. J., and White, M. F. (1991) Structure of the Insulin Receptor Substrate IRS-1 Defines a Unique Signal Transduction Protein. Nature. 352, 73-77.

  22. Sun, X. J., Crimmins, D. L., Myers, M. G.,Jr, Miralpeix, M., and White, M. F. (1993) Pleiotropic Insulin Signals are Engaged by Multisite Phosphorylation of IRS-1. Mol Cell Biol. 13, 7418-7428.

  23. Laakso, M., Malkki, M., Kekalainen, P., Kuusisto, J., and Deeb, S. S. (1994) Insulin Receptor Substrate-1 Variants in Non-Insulin-Dependent Diabetes. J Clin Invest. 94, 1141-1146.

  24. Almind, K., Bjorbaek, C., Vestergaard, H., Hansen, T., Echwald, S., and Pedersen, O. (1993) Aminoacid Polymorphisms of Insulin Receptor Substrate-1 in Non-Insulin-Dependent Diabetes Mellitus. Lancet. 342, 828-832.

  25. Rung, J., Cauchi, S., Albrechtsen, A., Shen, L., Rocheleau, G., Cavalcanti-Proenca, C., Bacot, F., Balkau, B., Belisle, A., Borch-Johnsen, K., Charpentier, G., Dina, C., Durand, E., Elliott, P., Hadjadj, S., Jarvelin, M. R., Laitinen, J., Lauritzen, T., Marre, M., Mazur, A., Meyre, D., Montpetit, A., Pisinger, C., Posner, B., Poulsen, P., Pouta, A., Prentki, M., Ribel-Madsen, R., Ruokonen, A., Sandbaek, A., Serre, D., Tichet, J., Vaxillaire, M., Wojtaszewski, J. F., Vaag, A., Hansen, T., Polychronakos, C., Pedersen, O., Froguel, P., and Sladek, R. (2009) Genetic Variant Near IRS1 is Associated with Type 2 Diabetes, Insulin Resistance and Hyperinsulinemia. Nat Genet. 41, 1110-1115.

  26. Shah, O. J., Wang, Z., and Hunter, T. (2004) Inappropriate Activation of the TSC/Rheb/mTOR/S6K Cassette Induces IRS1/2 Depletion, Insulin Resistance, and Cell Survival Deficiencies. Curr Biol. 14, 1650-1656.

  27. Baroni, M. G., D'Andrea, M. P., Montali, A., Pannitteri, G., Barilla, F., Campagna, F., Mazzei, E., Lovari, S., Seccareccia, F., Campa, P. P., Ricci, G., Pozzilli, P., Urbinati, G., and Arca, M. (1999) A Common Mutation of the Insulin Receptor Substrate-1 Gene is a Risk Factor for Coronary Artery Disease. Arterioscler Thromb Vasc Biol. 19, 2975-2980.

  28. Araki, E., Lipes, M. A., Patti, M. E., Bruning, J. C., Haag, B.,3rd, Johnson, R. S., and Kahn, C. R. (1994) Alternative Pathway of Insulin Signalling in Mice with Targeted Disruption of the IRS-1 Gene. Nature. 372, 186-190.

  29. Tamemoto, H., Kadowaki, T., Tobe, K., Yagi, T., Sakura, H., Hayakawa, T., Terauchi, Y., Ueki, K., Kaburagi, Y., and Satoh, S. (1994) Insulin Resistance and Growth Retardation in Mice Lacking Insulin Receptor Substrate-1. Nature. 372, 182-186.

  30. Withers, D. J., Gutierrez, J. S., Towery, H., Burks, D. J., Ren, J. M., Previs, S., Zhang, Y., Bernal, D., Pons, S., Shulman, G. I., Bonner-Weir, S., and White, M. F. (1998) Disruption of IRS-2 Causes Type 2 Diabetes in Mice. Nature. 391, 900-904.

  31. Kido, Y., Burks, D. J., Withers, D., Bruning, J. C., Kahn, C. R., White, M. F., and Accili, D. (2000) Tissue-Specific Insulin Resistance in Mice with Mutations in the Insulin Receptor, IRS-1, and IRS-2. J Clin Invest. 105, 199-205.

  32. Abe, H., Yamada, N., Kamata, K., Kuwaki, T., Shimada, M., Osuga, J., Shionoiri, F., Yahagi, N., Kadowaki, T., Tamemoto, H., Ishibashi, S., Yazaki, Y., and Makuuchi, M. (1998) Hypertension, Hypertriglyceridemia, and Impaired Endothelium-Dependent Vascular Relaxation in Mice Lacking Insulin Receptor Substrate-1. J Clin Invest. 101, 1784-1788.

  33. DeMambro, V. E., Kawai, M., Clemens, T. L., Fulzele, K., Maynard, J. A., Marin de Evsikova, C., Johnson, K. R., Canalis, E., Beamer, W. G., Rosen, C. J., and Donahue, L. R. (2010) A Novel Spontaneous Mutation of Irs1 in Mice Results in Hyperinsulinemia, Reduced Growth, Low Bone Mass and Impaired Adipogenesis. J Endocrinol. 204, 241-253.